Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
June-2016 Volume 11 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2016 Volume 11 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR-20b downregulates polymerases κ and θ in XP-V tumor cells

  • Authors:
    • Jia Guo
    • Zheng Jiang
    • Xiangru Li
    • Xi Wang
    • Yan Xiao
  • View Affiliations / Copyright

    Affiliations: Department of Endodontics, Oral Medical Center, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052, P.R. China, Department of Endodontics, Xiamen Stomatological Hospital, Xiamen, Fujian 361004, P.R. China
  • Pages: 3790-3794
    |
    Published online on: April 18, 2016
       https://doi.org/10.3892/ol.2016.4447
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

XP-V is a subtype of Xeroderma pigmentosum diseases with typical pigmentation and cancers in sun-exposed regions. The present study investigated the role of microRNA-20b (miR-20b) in the imbalance of polymerase expression levels in XP‑V tumor cells. Following software prediction results, certain miRNAs were chosen as candidate regulators for the observed imbalance in polymerases in XP‑V tumor cells. Reverse transcription‑quantitative polymerase chain reaction and western blot were used to test candidate miRNAs for their ability to reduce the expression of these polymerases. A luciferase reporter assay was used to further verify the western blot results. Polymerases κ and θ were expressed at lower levels in XP‑V tumor cells compared to normal control cells. A positive correlation was demonstrated between miR-20b and polymerases κ and θ. It was also demonstrated that a proportion of miRNAs had no effect on polymerases κ and θ, despite the software predicting that these miRNAs would target these two polymerases. Therefore, miR‑20b may be responsible for the low expression levels of polymerase κ and θ in XP‑V tumor cells, which accelerated mismatch in DNA replication repairing.

Introduction

Xeroderma pigmentosum (XP) is a sun-toxicity disease. A total of 8 subtypes (from XP-A to XP-G and XP-V) of this disease have been identified by their different pathogenic genes (1,2). The pathogenic mechanisms of almost all these subtypes result from a defect in nucleotide excision repair (3), except XP-V subtype, which results from a translesion synthesis (TLS) defect (4). XP-V is a common subtype (21%) in XP disease, and has a similar phenotype to other subtypes (2), including sun sensitivity, photophobia, early onset of freckling, and subsequent neoplastic changes in sun-exposed skin (5,6). The majority of studies have demonstrated that XP-V disease is a result of mutations in the POLH gene (encoding DNA polymerase η). Polymerase η is the main DNA polymerase responsible for TLS, and its defect could apparently reduce TLS efficiency and increase mismatch in DNA replication. These phenomena result in genomic instability, leading to a high incidence of tumors in patients (7–15). It has been previously demonstrated that polymerase η has defective expression in XP-V cells and that certain other polymerases involving TLS are unusually expressed, such as polymerase κ and ζ (encoded by POLK and REV3 l, respectively) (16). An additional polymerase, polymerase θ (encoded by POLQ), also has low expression in XP-V cells and tumor tissue and has the same function as polymerase η, which is to generate A/T mutations during the somatic hypermutation of immunoglobulin (Ig) genes (16,17). Given that a number of polymerases change their expression in XP-V cells and tumor tissue, certain factors may co-regulate the expression of these polymerases.

MicroRNAs (miRNAs) are endogenous, small non-coding RNAs that regulate translation and degradation of mRNAs at the post-transcriptional level (18). Protein expression from hundreds of genes are directly suppressed, albeit relatively mildly, by a single miRNA (19). Dysregulated miRNAs are correlated with various cancers and may function as tumor suppressors or oncogenes, depending on the function of their targets and cellular context (20). Therefore, certain miRNAs with unusual expression may explain the changes in expression of these polymerases in XP-V tumor that accelerate DNA mismatch.

Previous studies have mainly verified POLH mutation as an etiological factor of developing XP-V tumors (7–9,14). In the present study, polymerase-suppressive miRNAs associated with XP-V tumor were identified by analyzing miRNAs that may directly regulate DNA polymerases with unusual expression in XP-V tumor cells. miR-20b-5p was identified to be a polymerase suppressor by directly targeting POLK and POLQ.

Materials and methods

Prediction of miRNA as co-suppressor of POLK, REV3 l, and POLQ

POLK, REV3 l and POLQ all demonstrate low expression in XP-V tumor cells (16). Accordingly, Targetscan (http://www.targetscan.org), miRDB (http://mirdb.org/miRDB), and miRanda (http://www.microrna.org) were used to predict miRNA co-targeting these three genes.

Cell culture

All cells including XP-V tumor fibroblast cell lines, human skin fibroblasts (HSFs), and HeLa cells were cultured in DMEM supplemented with 20% FBS (HyClone, Logan, UT, USA). HeLa cells and HSFs were purchased from the cell bank of the Chinese Academy Of Sciences (Beijing, China). XP-V tumor fibroblast cell lines (XP30RO, XP1CH, and XP1SF) were purchased from The Coriell Institute (Camden, NJ, USA). Cells were incubated at 37°C in 5% CO2.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) for candidate miRNAs in XP-V cells

QIAgen miScript miRNA PCR Arrays kit (QIAgen Inc., Hilden, Germany) was used to extract, reverse transcribe and amplify total miRNAs in XP-V cell lines and HSFs according to the manufacturer's protocol. U6 was used as an endogenous control to normalize the amount of total miRNA in each sample. ABI 7500 Real-time PCR System (Applied Biosystems, Carlsbad, CA, USA) was used to analyze the data. Primers were synthesized by GenePharma (Shanghai, China) and the sequences are presented in Table I. To identify differences in miRNA expression, samples of HSF cells were defined as reference samples, and the quantity of all tested miRNAs in the reference sample was defined as ‘1.0.’ Student's t-test was used to compare relative expression levels between XP-V cell lines and HSF control cells.

Table I.

Primers sequences.

Table I.

Primers sequences.

Primer namePrimer sequence, 5′-3′
Primers for quantifying miRNA
  miR-520b AAGTGCTTCCTTTTAGAGGGA
  miR-520e GGTGCTTCCTTTTTGAGGG
  miR-302a-3p TGCTTCCATGTTTTGGTGA
  miR-302b-3p GCGTGCTTCCATGTTTTAGTA
  miR-302c-3p TGCTTCCATGTTTCAGTGG
  miR-302d-3p AGTGCTTCCATGTTTGAGTGT
  miR-93-5p GTGCTGTTCGTGCAGGTAG
  miR-373-3p GCTTCGATTTTGGGGTGT
  miR-548k AAAGTACTTGCGGATTTTGCT
  miR-20a-5p CGTCAGGCCTAAAGTGCTTAT
  miR-20b-5p CAAAGTGCTCATAGTGCAGGTAG
  miR-106a-5p AGTCAGGCCAAAGTGCTTAC
  miR-106b-5p GTAAAGTGCTGACAGTGCAGA
Primers for mutagenesis
  Forward Primer for mutagenesis in POLK UTR TTAAGCTAACTACTATTAAGCTGTCTTCTTTCACAAATATTAATATTTCACCTGATAGAAATGTAACTAAGATACATAATGTGTTTTAATACACAT
  Reverse Primer for mutagenesis in POLK UTR ATGTGTATTAAAACACATTATGTATCTTAGTTACATTTCTATCAGGTGAAATATTAATATTTGTGAAAGAAGACAGCTTAATAGTAGTTAGCTTAA
  Forward Primer for mutagenesis in POLQ UTR CATGGTTTACCCAGACAGATGTGGAACCTTTCACCTAAGTGCATATTTCAAGCATCTGTTCT
  Reverse Primer for mutagenesis in POLQ UTR AGAACAGATGCTTGAAATATGCACTTAGGTGAAAGGTTCCACATCTGTCTGGGTAAACCATG

[i] miRNA, microRNA; UTR, untranslated region; POLK, polymerase κ; POLQ, polymerase θ.

Transfection

HeLa cells were transfected with 200 nM candidate miRNA, miR-NC mimics, or miRNA inhibitor (GenePharma, Shanghai, China) using Turbofect transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA) when cells reached 70–80% confluence.

Western blot analysis

All cells were harvested using RIPA lysis buffer (Beyotime, Shanghai, China). Then, 1% PMSF (Bioprimacy Co., Ltd., Wuhan, China) was added directly prior to use. Protein concentration was measured using BCA protein assay (Thermo Fisher Scientific, Inc.). Protein was loaded onto 10% SDS-PAGE gel (Beyotime, Shanghai, China) and then transferred to PVDF membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The blot was blocked with 5% skim milk for 2 h and then probed with primary mouse monoclonal polymerase κ (dilution, 1:6,000; catalog no., ab57070), rabbit polyclonal polymerase θ (dilution, 1:3,000; catalog no., ab80906), and mouse monoclonal β-actin (dilution, 1:8,000; catalog no., ab8226) antibodies (Abcam, Cambridge, UK). After incubation at 4°C overnight, the blot was washed with TBST and incubated in secondary goat anti-mouse IgG-horseradish peroxidase antibody (dilution, 1:10,000; catalog no., sc-2005; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and goat anti-rabbit IgG-horseradish peroxidase antibody (dilution, 1:10,000; catalog no., sc-2004; Santa Cruz Biotechnology, Inc.) for 1 h at 25°C. The signal was developed with ECL reagent (Advansta, Inc., Menlo Park, CA, USA).

Luciferase reporter assay

The 3′-untranslated regions (UTRs) of POLK and POLQ were amplified using PCR from human genomic DNA and then ligated into pMIR-report (Ambion, Thermo Fisher Scientific, Inc.). Then, QuikChange Lightning site-directed mutagenesis kit (Stratagene Agilent Technologies, Santa Clara, CA, USA) was used to induce miR-20b-5p target sequences (complementary to the seed region for miR-20b-5p) to mutate TACTTT to GTGAAA in POLK and CACTTT to GTGAAA in POLQ. All constructs were confirmed by sequencing. Primers used are summarized in Table I. HeLa cells were co-transfected with wild-type or mutant 3′UTR luciferase reporter construct, the Renilla luciferase construct pRL-TK, and either miR-20b-5p or miR-NC mimics. Then, 48 h after transfection, luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA) and normalized by dividing the firefly luciferase activity with Renilla luciferase activity.

Statistical analyses

Values are expressed as mean ± standard deviation (SD) from triplicate experiments. Student's t-test was used to compare relative expression levels. Statistical analyses were performed by SPSS software, version 16.0 (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Using three web software predictions, it was found that no miRNA was predicted to target all three genes. Certain miRNAs were predicted to co-target POLQ and POLK but not REV3 L (Fig. 1). To find miRNAs co-regulating polymerases in XP-V tumor cells, only miRNAs that matched both POLK and POLQ from more than two software prediction results were selected. All other miRNAs were predicted to match only one of three genes, which were removed from the subsequent analysis. miR-520b, miR-520e, miR-302a, miR-302b, miR-302c, miR-302d, miR-93, miR-373, miR-548k, miR-20a, miR-20b, miR-106a, and miR-106b were chosen as candidate miRNAs.

Figure 1.

Prediction results of miRanda software for candidate miRNAs. Match sequences are listed between seed sequence in miRNAs and UTR sequence in genes. ‘|’ denotes complementary base pairing; ‘:’ denotes G-U match. miRNA, microRNA; UTR, untranslated region.

The RT-qPCR results demonstrated that only miR-20a, miR-20b, miR-106a, miR-106b, and miR-548k were expressed at significantly different levels between XP-V cell lines and HSFs (Fig. 2).

Figure 2.

Results of quantitative polymerase chain reaction analyses of miRNAs in control and XP-V cells. Sample X1, X2, and X3 are XP-V tumor cell lines XP30RO, XP1CH, and XP1SF, respectively. *P<0.05 between samples X1, X2, X3 and HSFs. RQ denotes mRNA relative quantity.

The western blot analysis results verified that polymerase κ and θ were expressed at lower levels in XP-V tumor cell lines compared to the normal control cell line. Furthermore, when the above five miRNAs were transfected into HeLa cells, only miR-20b transfection resulted in reduced polymerase κ and θ levels (Fig. 3).

Figure 3.

Western blot results of endogenous Pol κ and θ protein in different cell lines. (A) Compared with HSF cells, three XP-V cell lines had lower expression of Pol κ and θ. X1, XP30RO; X2, XP1CH; X3, XP1SF. (B) When HeLa cells were transfected with candidate miRNA mimics, only miR-20b-5p in candidate miRNAs could decrease Pol κ and θ expression. NC, miR-negative control; 548k, miR-548k; 106a, miR-106a-5p; 106b, miR-106b-5p; 20a, miR-20a-5p; 20b, miR-20b-5p. (C) Verification of miR-20b inhibition for Pol κ and θ expression in HeLa cells transfected by miR-20b-5p mimics. 20b inhibitor, the inhibitor of miR-20b-5p. GAPDH was used as endogenous control to normalize each sample. pol κ and θ, polymerase κ and θ; HSF, human skin fibroblasts.

To determine whether such an inhibitory effect on translation was mediated by specific and direct interaction of miR-20b-5p with POLK and POLQ target site, luciferase reporter plasmids containing 3′UTR of both genes were constructed. The dual-luciferase assay demonstrated that the introduction of miR-20b-5p significantly reduced luciferase activity with respect to miR-NC, whereas such inhibitory effect was absent in cells transfected with reporter plasmids containing the mutant 3′UTR of both genes (Fig. 4).

Figure 4.

Analysis of luciferase activity. (A) HeLa cells were co-transfected with firefly luciferase reporter containing either wild-type (POLK/POLQ-report) or mutant (POLK/POLQ-mut-report) 3′UTR, Renilla luciferase reporter pRL-TK (as internal control), and either miR-20b-5p or miR-NC mimics. (B) Relative luciferase activity was measured and normalized by Renilla luciferase activity. Normalized luciferase activity for miR-NC transfected cells was set as 1. Data shown are the mean ± standard deviation from three independent experiments. *P<0.01 vs. miR-NC; unpaired Student's t-test. POLK, polymerase κ; POLQ, polymerase θ; UTR, untranslated region.

Discussion

Low expression levels of polymerases in XP-V cells such as polymerase η, κ, and ζ may lead to a significant reduction in the accuracy of TLS in XP-V cells (21). Polymerase θ has also been indicated to serve a role in base excision repair, and lower expression of polymerase θ may also seem unfavorable for DNA replication repair (22). In XP-V tumor cells, polymerases ζ, κ, and θ are indeed expressed at low levels, in addition to the dysfunction of polymerase η that disrupts DNA lesion replication and promotes genetic instability (16,21). In the present study, no miRNA was predicted to co-regulate POLK and REV3 L expression, although these two genes both belonged to the Y-family of DNA polymerases (23). However, miR-20-5p was verified to function as co-suppressor of POLK and POLQ depending on its targets. The high expression of miR-20-5p in XP-V tumor cells could obviously decrease the expression of POLK and POLQ. Moreover, in XP-V tumor cells, these two polymerases with low expression may explain abnormal DNA replication repair apart from polymerase η dysfunction (21). Therefore, miR-20-5p may also serve an important role in XP-V tumors, accelerating DNA instability by down-regulating POLK and POLQ.

In summary, the current study demonstrated miR-20b-5p may co-regulate POLK and POLQ. Furthermore, miRNA may also be a novel factor that affect error-prone DNA replication in XP-V tumor cells.

Acknowledgements

The study was supported by grants from the National Natural Science Foundation of China (grant nos. 81400492 and 31400839).

References

1 

Kraemer KH, Lee MM and Scotto J: Xeroderma pigmentosum. Cutaneous, ocular and neurologic abnormalities in 830 published cases. Arch Dermatol. 123:241–250. 1987. View Article : Google Scholar : PubMed/NCBI

2 

Kraemer KH and DiGiovanna JJ; Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Fong CT, Mefford HC, Smith RJH and Stephens K: Xeroderma Pigmentosum. University of Washington. 1993–2015. 2003.

3 

Berneburg M and Lehmann AR: Xeroderma pigmentosum and related disorders: Defects in DNA repair and transcription. Adv Genet. 43:71–102. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Cleaver JE: Xeroderma pigmentosum: Variants with normal DNA repair and normal sensitivity to ultraviolet light. J Invest Dermatol. 58:124–128. 1972. View Article : Google Scholar : PubMed/NCBI

5 

Maher VM, Ouellette LM, Curren RD and McCormick JJ: Frequency of ultraviolet light-induced mutations is higher in xeroderma pigmentosum variant cells than in normal human cells. Nature. 261:593–595. 1976. View Article : Google Scholar : PubMed/NCBI

6 

Myhr BC, Turnbull D and DiPaolo JA: Ultraviolet mutagenesis of normal and xeroderma pigmentosum variant human fibroblasts. Mutat Res. 62:341–353. 1979. View Article : Google Scholar : PubMed/NCBI

7 

Masutani C, Kusumoto R, Yamada A, Dohmae N, Yokoi M, Yuasa M, Araki M, Iwai S, Takio K and Hanaoka F: The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase eta. Nature. 399:700–704. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Johnson RE, Kondratick CM, Prakash S and Prakash L: hRAD30 mutations in the variant form of xeroderma pigmentosum. Science. 285:263–265. 1999. View Article : Google Scholar : PubMed/NCBI

9 

Inui H, Oh KS, Nadem C, Ueda T, Khan SG, Metin A, Gozukara E, Emmert S, Slor H, Busch DB, et al: Xeroderma pigmentosum-variant patients from America, Europe and Asia. J Invest Dermatol. 128:2055–2068. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Gratchev A, Strein P, Utikal J and Sergij G: Molecular genetics of Xeroderma pigmentosum variant. Exp Dermatol. 12:529–536. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Broughton BC, Cordonnier A, Kleijer WJ, Jaspers NG, Fawcett H, Raams A, Garritsen VH, Stary A, Avril MF, Boudsocq F, et al: Molecular analysis of mutations in DNA polymerase eta in xeroderma pigmentosum-variant patients. Proc Natl Acad Sci USA. 99:815–820. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Kannouche P, Broughton BC, Volker M, Hanaoka F, Mullenders LH and Lehmann AR: Domain structure, localization and function of DNA polymerase eta, defective in xeroderma pigmentosum variant cells. Genes Dev. 15:158–172. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Yuasa M, Masutani C, Eki T and Hanaoka F: Genomic structure, chromosomal localization and identification of mutations in the xeroderma pigmentosum variant (XPV) gene. Oncogene. 19:4721–4728. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Tanioka M, Masaki T, Ono R, Nagano T, Otoshi-Honda E, Matsumura Y, Takigawa M, Inui H, Miyachi Y, Moriwaki S and Nishigori C: Molecular analysis of DNA polymerase eta gene in Japanese patients diagnosed as xeroderma pigmentosum variant type. J Invest Dermatol. 127:1745–1751. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Johnson RE, Prakash S and Prakash L: Efficient bypass of a thymine-thymine dimer by yeast DNA polymerase, Poleta. Science. 283:1001–1004. 1999. View Article : Google Scholar : PubMed/NCBI

16 

Guo J, Zhou G, Zhang W, Song Y and Bian Z: A novel mutation causes XP-V disease and XP-V tumor proneness may involve imbalance of numerous DNA polymerases. Oncol Lett. 6:1583–1590. 2013.PubMed/NCBI

17 

Masuda K, Ouchida R, Hikida M, Kurosaki T, Yokoi M, Masutani C, Seki M, Wood RD, Hanaoka F and O-Wang J: DNA polymerases eta and theta function in the same genetic pathway to generate mutations at A/T during somatic hypermutation of Ig genes. J Biol Chem. 282:17387–17394. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Baek D, Villén J, Shin C, Camargo FD, Gygi SP and Bartel DP: The impact of microRNAs on protein output. Nature. 455:64–71. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Esquela-Kerscher A and Slack FJ: Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Ziv O, Geacintov N, Nakajima S, Yasui A and Livneh Z: DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients. Proc Natl Acad Sci USA. 106:11552–11557. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Yoshimura M, Kohzaki M, Nakamura J, Asagoshi K, Sonoda E, Hou E, Prasad R, Wilson SH, Tano K, Yasui A, et al: Vertebrate POLQ and POLbeta cooperate in base excision repair of oxidative DNA damage. Mol Cell. 24:115–125. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Ohmori H, Friedberg EC, Fuchs RP, Goodman MF, Hanaoka F, Hinkle D, Kunkel TA, Lawrence CW, Livneh Z, Nohmi T, et al: The Y-family of DNA polymerases. Mol Cell. 8:7–8. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo J, Jiang Z, Li X, Wang X and Xiao Y: miR-20b downregulates polymerases κ and θ in XP-V tumor cells. Oncol Lett 11: 3790-3794, 2016.
APA
Guo, J., Jiang, Z., Li, X., Wang, X., & Xiao, Y. (2016). miR-20b downregulates polymerases κ and θ in XP-V tumor cells. Oncology Letters, 11, 3790-3794. https://doi.org/10.3892/ol.2016.4447
MLA
Guo, J., Jiang, Z., Li, X., Wang, X., Xiao, Y."miR-20b downregulates polymerases κ and θ in XP-V tumor cells". Oncology Letters 11.6 (2016): 3790-3794.
Chicago
Guo, J., Jiang, Z., Li, X., Wang, X., Xiao, Y."miR-20b downregulates polymerases κ and θ in XP-V tumor cells". Oncology Letters 11, no. 6 (2016): 3790-3794. https://doi.org/10.3892/ol.2016.4447
Copy and paste a formatted citation
x
Spandidos Publications style
Guo J, Jiang Z, Li X, Wang X and Xiao Y: miR-20b downregulates polymerases κ and θ in XP-V tumor cells. Oncol Lett 11: 3790-3794, 2016.
APA
Guo, J., Jiang, Z., Li, X., Wang, X., & Xiao, Y. (2016). miR-20b downregulates polymerases κ and θ in XP-V tumor cells. Oncology Letters, 11, 3790-3794. https://doi.org/10.3892/ol.2016.4447
MLA
Guo, J., Jiang, Z., Li, X., Wang, X., Xiao, Y."miR-20b downregulates polymerases κ and θ in XP-V tumor cells". Oncology Letters 11.6 (2016): 3790-3794.
Chicago
Guo, J., Jiang, Z., Li, X., Wang, X., Xiao, Y."miR-20b downregulates polymerases κ and θ in XP-V tumor cells". Oncology Letters 11, no. 6 (2016): 3790-3794. https://doi.org/10.3892/ol.2016.4447
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team