Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2016 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo

  • Authors:
    • Sainan Gao
    • Chao Fan
    • Hua Huang
    • Changlai Zhu
    • Min Su
    • Yuquan Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001, P.R. China, Department of Pathology, Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001, P.R. China, Department of Electron Microscopy, Nantong University, Nantong, Jiangsu 226001, P.R. China
    Copyright: © Gao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 459-466
    |
    Published online on: May 25, 2016
       https://doi.org/10.3892/ol.2016.4630
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Ovarian cancer is the leading cause of mortality due to gynecological malignancy, and vasculogenic mimicry (VM) formation is correlated with poor prognosis. In a previous study, the present authors observed that human chorionic gonadotropin (HCG) could promote VM formation in three‑dimensional OVCAR‑3 cell cultures. In order to investigate whether HCG could promote VM formation in ovarian cancer in vivo, the role of OVCAR‑3 cells overexpressing or depleted of chorionic gonadotropin, beta polypeptide 5 (CGB5, which is the fifth subunit of β‑HCG and was identified as the key part of HCG) were injected into nude mice in the present study, while BeWo cells were used as a positive control. The results demonstrated that overexpressed CGB5 promoted xenografts tumor formation in nude mice, and the results of hematoxylin and eosin and cluster of differentiation (CD)34‑periodic acid‑Schiff dual staining revealed that CGB5 promoted VM formation. Furthermore, reverse transcription-polymerase chain reaction and immunochemistry staining demonstrated that the expression of the vascular markers CD31, vascular endothelial growth factor and factor VIII was also upregulated in the CGB5-overexpressing xenografts tumors. In addition, the expression of luteinizing hormone receptor (LHR), the receptor of CGB5, was increased in CGB5-overexpressing cells. In conclusion, CGB5 may promote tumor growth and VM formation via activation of the LHR signal transduction pathway, which may support a novel strategy for ovarian cancer therapy.

Introduction

Ovarian cancer is the leading cause of mortality due to gynecological malignancy in recent years (1). Although the diagnosis and treatments of ovarian cancer are constantly under development, the prognosis of the patients remains poor, which is due to the biological behavior of the tumor (2). Ovarian cancer cells are able to migrate and invade into the peritoneal/pelvic cavity. Therefore, clarification of the mechanisms of cell migration and invasion is important to identify novel therapy methods for ovarian cancer treatment.

Blood supply is essential for tumors metastasis (3). Previous studies have suggested that the development of tumor microcirculation appears to be a rate-limiting step for metastasis (3–5). In 1999, Maniotis et al (6) identified a novel phenomenon in the biology of tumor vascularization known as vasculogenic mimicry (VM). VM is the unique ability of highly aggressive tumor cells, but not of poorly aggressive cells, to mimic the presence and function of endothelial cells and form matrix-rich networks de novo, which are able to convey blood plasma and red blood cells (6–8). In VM, the blood vessels wall is lined exclusively by tumor cells, without the participation of endothelial cells (9,10). As a secondary circulation system, VM has been recognized as an important form of vasculogenic structure in solid tumors, including melanoma, breast cancer, hepatocellular carcinoma, prostate cancer, clear cell renal cell carcinoma, glioblastoma, gastric adenocarcinoma, colorectal cancer and gestational choriocarcinoma (6,11–19). In ovarian cancer, VM has been correlated with poor prognosis, low survival and increased risk of cancer recurrence (6). However, the mechanisms involved in the generation of VM in ovarian cancer remain obscure.

Human chorionic gonadotropin (HCG), a hormone of trophoblastic origin, was considered to be a proangiogenic factor (20). HCG increases uterine arterial blood flow and stimulates angiogenesis in the ovary by stimulating the proliferation of vascular endothelial cells and the expression of vascular endothelial growth factor (VEGF) (21–23). HCG induces neovascularization in placenta during pregnancy (24). In ovarian cancer, the HCG protein and its receptor, luteinizing hormone receptor (LHR), exhibited positive expression (25). HCG is also ‘ectopically’ expressed in numerous malignant tumors such as endometrial carcinoma and ovarian, testicular and breast cancer (26–30). A previous study by the present authors demonstrated that HCG promotes VM formation in three-dimensional cultures of OVCAR-3 cells, and anoxia could promote VM formation via activation of hypoxia-inducible factor-1 (31). Therefore, the present authors hypothesize that HCG may be important in the development of VM in ovarian cancer.

To further investigate the role of chorionic gonadotropin, beta polypeptide 5 (CGB5, which is the fifth subunit of β-HCG and was identified as the key part of HCG) in ovarian cancer VM formation in vivo, a tumor formation model in vivo was constructed in the present study, and the effect of HCG binding to its receptor in VM formation was investigated in vivo. The results demonstrated the role of CGB5 in VM formation in vivo, and support a novel approach for ovarian cancer therapy.

Materials and methods

Cell lines and cell culture

The human epithelial ovarian cancer cell line OVCAR-3 and the human choriocarcinoma cell line BeWo were purchased from the American Type Culture Collection (Manassas, VA, USA). OVCAR-3 cells were cultured at 37°C and 5% CO2, in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.). BeWo cells were cultured in F-12 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 15% FBS.

CGB5 expression and small interfering RNA (siRNA) lentivirus production and infection

Human CGB complementary DNA (cDNA; accession no. NM_033043.1) was obtained from a human fetal ovary library, and subcloned into the pLenti6/entre-EGFP vector (Invitrogen; Thermo Fisher Scientific, Inc.), which led to pLenti/EGFP-CGB5. The siRNA template sequence 5′-AGCAGCAACAGCAGCAGCCTC-3′, which targeted CGB5, was constructed into the pcDNA™6.2-GW/EmGFP-miR vector (Invitrogen; Thermo Fisher Scientific, Inc.), and the construct was named pGFP-CGB5_siR. A total of 3 µg pLenti/EGFP-CGB5 vector, pGFP-CGB5_siR or pLenti6/entre-EGFP (which served as a control) and 9 µg ViraPower™ Packaging Mix (Invitrogen; Thermo Fisher Scientific, Inc.) were used to co-transfect 5×106 293FT cells (Thermo Fisher Scientific, Inc.) with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according the manufacturer's protocol. After transfection for 48 h, the supernatant containing the lentiviruses was harvested, centrifuged and stored at −80°C. For infection, the cells were seeded at 1×105 cells/well into a 6-well plate and cultured overnight, and then lentiviruses were added. After 24 h of infection, 10 ng blastin (Invitrogen; Thermo Fisher Scientific, Inc.) was added to the cells to obtain a stable cell clone, and the cells were then sorted by flow cytometry.

Animals and experiments

BALB/c female nude mice were purchased from the laboratory animal center of the Chinese Academy of Sciences (Beijing, China). Mice that were 4–6 weeks old and had an average body weight of 18–20 g were used in the study. The experimental procedures were performed according to the standards established by the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (32). For tumor formation in vivo, 36 mice were randomly divided into 6 groups, and injected with normal OVCAR-3 cells, control vector-transfected OVCAR-3 cells, CGB5-overexpressing OVCAR-3 cells, CGB5-knockdown OVCAR-3 cells or BeWo cells (6 mice/group). Tumors were allowed to grow for 2–6 weeks after tumor inoculation, and the mice were then sacrificed by cervical decapitation. Next, tumors were subjected to histopathological examination, transmission electron microscopy observation and reverse transcription-polymerase chain reaction (RT-PCR) analysis.

Hematoxylin and eosin (H&E) staining and cluster of differentiation (CD)34-periodic acid-Schiff (PAS) dual staining

The tumor xenograft specimens were fixed in 10% neutral buffered formalin and paraffin-embedded. Paraffin-embedded specimens were cut into serial 6-µm sections to be placed on slides. The sections were rehydrated through graded alcohols into water. Endogenous peroxidase was blocked with 3% hydrogen peroxide in 50% methanol for 10 min at room temperature. Upon rehydration, the sections were washed with phosphate-buffered saline (PBS) for 15 min and then pre-treated with 0.01 mol/l citrate acid buffer (pH 6.0) for 20 min at 100°C in a microwave oven. After rinsing with PBS, slides were incubated with primary antibodies against CD34 (sc-74499, Santa Cruz Biotechnology, Inc., Dallas, TX, USA; 1:100 dilution) overnight. After washing in PBS for three times, the slides were incubated with peroxidase-conjugated donkey anti-rabbit antibody (P0448, Dako North America, Inc., Carpinteria, CA, USA; 1:100 dilution) for 30 min. The reactions were visualized with diaminobenzidine (EnVision; Dako North America, Inc.) and counterstained with hematoxylin (EnVision; Dako North America, Inc). The CD34-immunohistochemically stained sections were further stained with PAS, followed by counterstaining with hematoxylin. These double-stained sections were used for observing microvascular and VM structures. Quantification of VM was performed as follows: VM channels and endothelium-dependent vessels in the H&E-stained sections were counted under a microscope using ×400 magnification, while CD34-PAS dual staining sections were viewed at ×400 magnification. The channels defined as VM were lined by PAS-positive material, with red cells in the center of the channels, but were not lined by CD34-positive endothelial cells. The mean numbers of VM in 10 areas were calculated as the VM channel density for each section.

Transmission electron microscopy observation

Fresh tumor xenograft tissues (0.5-mm3) were fixed in cold 2.5% glutaraldehyde in 0.1 mol/l sodium cacodylate buffer and post-fixed in a solution of 1% osmium tetroxide, then dehydrated and embedded in a standard manner (33). The specimens were then embedded, sectioned and stained by routine means for analysis with a transmission electron microscope (34).

Immunohistochemical staining

The paraffin sections were deparaffinized and rehydrated according to the method described above. After rinsing with PBS, the slides were incubated overnight with primary antibodies against Ki-67 (mouse monoclonal; sc-23900, Santa Cruz Biotechnology, Inc.; 1:100 dilution), VEGF (sc-7269, mouse monoclonal; Santa Cruz Biotechnology, Inc., 1:50), factor VIII (goat polyclonal; sc-33584, Santa Cruz Biotechnology, Inc.; 1:100 dilution), β-HCG (sc-7822, mouse monoclonal; Santa Cruz Biotechnology, Inc.; 1:100 dilution), LHR (sc-293165, mouse monoclonal; Santa Cruz Biotechnology, Inc.; 1:100 dilution) and CD31 (rabbit polyclonal; sc-8306, Santa Cruz Biotechnology, Inc.; 1:100 dilution). After washing in PBS for three times, the slides were incubated with peroxidase-conjugated donkey anti-mouse or anti-rabbit antibody (P0447 and P0448, respectively, Dako North America, Inc.; both 1:100 dilution) for 30 min. Negative controls were prepared by replacing the primary antibody with Tris-buffered saline. The reactions were visualized by diaminobenzidine and counterstained with hematoxylin.

RNA isolation and RT-PCR

Total RNA was isolated from the tumor xenograft tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). First-strand cDNA was synthesized from 20 µl total RNA using oligo(dT)18 primers and reverse transcriptase (Promega Corporation, Madison, WI, USA). RT-PCR was conducted using PCR Master Mix (Promega Corporation) with an initial denaturing step at 94°C for 5 min, followed by 20 cycles at 94°C for 45 sec, 58°C for 45 sec and 72°C for 45 sec, and a further extension at 72°C for 10 min. Glyceraldehyde 3-phosphate dehydrogenase was used as an internal control. The sequences of the primers are indicated in Table I.

Table I.

Sequences of the primers used in reverse transcription-polymerase chain reaction.

Table I.

Sequences of the primers used in reverse transcription-polymerase chain reaction.

Gene nameAccession no.Sequence (5′-3′)
CGB5NM_033043.1Forward: CTACTGCCCCACCATGACC
Reverse: ATGGACTCGAAGCGCACATC
CD31NM_000442.4Forward: ATTGCAGTGGTTATCATCGGAGTG
Reverse: CTCGTTGTTGGAGTTCAGAAGTGG
Factor VIIINM_000132.3Forward: ATCGAGGGTCTCGGGGATGCG
Reverse: TGCGAAGAGTGCTGCGAATGCT
LHRNM_000610.3Forward: TGGCTGCTGTAAACGTCGGG
Reverse: GGAGAGCTGTACCTTGACAGTG
GAPDHNM_001256799.1Forward: AAGGTGAAGGTCGGAGTC
Reverse: GAAGATGGTGATGGGATTTC

[i] CGB5, chorionic gonadotropin, beta polypeptide 5; CD, cluster of differentiation; LHR, luteinizing hormone receptor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Detection of secreted β-HCG by enzyme-linked immunosorbent assay (ELISA)

The concentrations of β-HCG released in the supernatants of the cell cultures were measured by specific human β-HCG ELISA, according to the manufacturer's protocol (BD Pharmingen, San Diego, CA, USA). Briefly, cells in 100 µl medium were seeded at 5×103 cells/well onto 96-well plates, and transfected with different reagents, as described earlier. At the appropriate time, 100 µl supernatants were harvested for ELISA.

Statistical analysis

All experiments were repeated ≥3 times. All numerical data were presented as the mean ± standard deviation. Data were analyzed using the two-tailed t test. P<0.05 was considered to indicate a statistically significant difference.

Results

CGB5 promotes tumor xenografts formation in vivo

To clarify if CGB5 affected VM formation and tumor development in vivo, the CGB5-expression vector and the siRNA vector targeting CGB5 were transfected into OVCAR-3 cells. Stable expression cell lines were obtained, and the expression of CGB5 at the messenger RNA (mRNA) level was effectively upregulated and downregulated, respectively, in OVCAR-3 cells, as detected by RT-PCR (Fig. 1A and B). Secreted β-HCG was measured in the supernatant of OVCAR-3 cells (Fig. 1C). Xenografts were established using these cells, which were resuspended at a density of 1×107 cells/ml, and 200 µl of this cell suspension was injected subcutaneously into nude mice. BeWo cells with high expression of β-HCG were used as a positive control (Fig. 1D). The tumors appeared gradually in the subcutaneous area of the right armpit of the mice following inoculation. After 2–6 weeks, tumors had grown to an average size of 1–2 cm3. The tumor formation rates of the nude mouse xenografts were 100.0% (6/6) for CGB5-overexpressing OVCAR-3 and BeWo cells, 83.3% (5/6) for normal or control vector-transfected OVCAR-3 cells and 33.3% (2/6) for CGB5-knockdown OVCAR-3 cells. The rates of tumor growth were also different, with tumors derived from BeWo and CGB5-overexpressing OVCAR-3 injected cells growing faster than tumors derived from CGB5-knockdown OVCAR-3 cells (Fig. 1E). In addition, the cell proliferation marker Ki-67 was detected by immunohistochemical staining, thus supporting such phenomenon (Fig. 1F). These data indicated that CGB5 may promote cell proliferation and tumor growth in ovarian cancer.

Figure 1.

Effect of CGB5 on tumor xenografts formation in vivo. (A) Lentivirus vector expressing CGB5 and small interfering RNA vector were infected in OVCAR-3 cells. EGFP expression demonstrated that the above vectors were stably infected in these cells. Control, pLenti6/entre-EGFP-infected cells; CGB5, CGB5-overexpressing cells; and CGB5 RNA interference, CGB5-knockdown cells. The BeWo cell line, which secrets high levels of β-HCG, was used as a positive control. Magnification, ×40. (B) Reverse transcription-polymerase chain reaction was used to determine the messenger RNA levels of CGB5 in the stably transfected cells. (C) The supernatant of these stably transfected cells was collected, and the β-HCG levels were detected by enzyme-linked immunosorbent assay. *P<0.05 vs. normal cells. (D) Cells were injected subcutaneously into the nude mice, and the tumors appeared gradually in the subcutaneous area of the right armpit of the mice at 2–6 weeks post-inoculation. (E) The speed of tumor growth was measured at 1, 2, 4 and 6 weeks after injection. (F) The cell proliferation marker Ki-67 was detected by immunohistochemical analysis. Magnification, ×400. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; EGFP, enhanced green fluorescent protein; RNAi, RNA interference; HCG, human chorionic gonadotropin.

The effect of CGB5 on VM formation in tumor xenografts

H&E staining and CD34-PAS dual staining were used to observe the morphology characteristic of VM in tumor xenografts. Based on H&E staining, spaces filled with red blood cells, which were completely surrounded by cancer cells, were observed (Fig. 2A a-e). Furthermore, staining of the endothelial cell marker CD34 was used to identify the endothelium in cancer tissue sections, while PAS staining was used to determine the basement membrane of tumor blood vessels (Fig. 2A f-j). The channel consisted of tumor cells that were positive for PAS and negative for CD34. Following statical analysis in 10 fields, the average numbers of blood supply patterns in tumors were defined as the number of VM in one section. Compared with the normal cells group, VM channels in xenografts were significantly increased in CGB5-overexpressing OVCAR-3 cells and in the BeWo cell group, while they were significantly reduced in the CGB5-knockdown OVCAR-3 cells group (Fig. 2B). There were cavities in the central structure of tumor nests, as clearly analyzed by transmission electron microscopy. Single, double, or multiple red blood cells-containing cavities structures could be observed in the choriocarcinoma specimens, according to their cell morphology. The number of cavities was much higher in CGB5-overexpressing tumor nests than in normal ovarian cancer specimens (Fig. 2C). These results indicated that HCG may promote the process of VM formation in ovarian cancer.

Figure 2.

Effect of CGB5 on VM formation by H&E and CD34-PAS staining. (A) After tumor growth to 1–2 cm3, the tumors were collected and cut into serial 6-µm sections. (a-e) H&E staining was used to detect VM formation. (f-j) PAS staining was used to identify matrix-associated vascular channels, while CD34 staining was used to identify the endothelium in the cancer tissue sections. PAS-positive and CD34-negative channels were considered as VM. (B) VM quantification was performed as follows: (a) VM channels and endothelium-dependent vessels in the H&E-stained sections were counted using ×400 magnification, and (b) CD34-PAS dual staining sections were viewed at ×400 magnification. *P<0.05 vs. normal cells. (C) Transmission electron microscopy examination. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RNAi, RNA interference; HCG, human chorionic gonadotropin; VM, vasculogenic mimicry; H&E, hematoxylin and eosin; PAS, periodic acid-Schiff.

CGB5 promotes vascular marker expression in tumor xenografts

To further confirm VM formation in the tumor xenografts, the vascular markers CD31, VEGF and factor VIII were detected. The mRNA levels of CD31, VEGF and factor VIII were increased in the CGB5-overexpressing cell group, whereas they were decreased in the CGB5-knockdown cell group (Fig. 3A). The results of immunohistochemical staining of CD31, VEGF and factor VIII exhibited the same tendency as the mRNA results (Fig. 3B). Compared with normal cells, the expression of vascular markers was higher in CGB5-overexpressing OVCAR-3 and BeWo cells. By contrast, the expression of these vascular markers was weak and focal in the CGB5-knockdown OVCAR-3 cell group (Fig. 3C).

Figure 3.

Expression of vascular markers in tumor xenografts. (A) Reverse transcription-polymerase chain reaction was used to determine the messenger RNA levels of the vascular markers CD31, VEGF and factor VIII in tumor tissues. (B) Statistical analysis of CD31, VEGF and factor VIII expression. *P<0.05 vs. normal cells. (C) Immunohistochemical analysis was used to detect CD31, VEGF and factor VIII expression. Magnification, ×400. CGB5, chorionic gonadotropin, beta polypeptide 5; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; VEGF, vascular endothelial growth factor; RNAi, RNA interference.

Change in LHR expression in tumor xenografts

Previous studies indicated that CGB5 may promote VM and tumor formation in vitro (31). However, the effect of CGB5 in the pathway mediated by LHR binding remains unknown. In the present study, the mRNA expression levels of LHR changed following the same tendency than CGB5 (Fig. 4A). Furthermore, immunochemistry demonstrated that LHR expression was increased in the CGB5-overexpressing OVCAR-3 cell group, while it was downregulated in the CGB5-knockdown OVCAR-3 cell group (Fig. 4B and C). These data indicated that CGB5 promotes VM formation in ovarian carcinoma via activation of LHR signal transduction.

Figure 4.

Expression of LHR in tumor xenografts. (A) Messenger RNA levels of CGB5 and LHR in tumor tissues were determined by reverse transcription-polymerase chain reaction. (B) Statistical analysis of CGB5 and LHR expression. *P<0.05 vs. normal cells. (C) Immunohistochemistry was used to detect CGB5 and LHR expression. CGB5, chorionic gonadotropin, beta polypeptide 5; HCG, human chorionic gonadotropin; LHR, luteinizing hormone receptor.

Discussion

HCG, which is primarily produced by the placenta, was considered to be a proangiogenic factor in recent reports (35). In the present study, CGB5 (the fifth subunit of β-HCG, which was identified as the key part of HCG) was used to investigate the role of HCG in VM formation. The current study identified that CGB5 may increase tumor growth, VM formation and LHR expression. These data indicated that, in ovarian carcinoma, CGB5 was the promoter of VM formation and tumor growth via the activation of LHR signal transduction.

HCG, a heterodimeric glycoprotein hormone, is composed of a single α-subunit and a target-specific β-subunit, which is encoded by a multigene cluster composed of six homologous sequences (β1, β2, β3, β5, β7 and β8) (24,36,37); however, only the heterodimers containing β5, β3 or β8 are transcriptionally active (37,38). Since the expression of the β5-subunit is the highest of all subunits (37), the present study selected CGB5 as the potential target gene in VM formation. It has been reported that HCG can increase uterine arterial blood flow and stimulate angiogenesis in the ovary by stimulating vascular endothelial cell proliferation and VEGF expression (21–22). HCG can also prevent luteolysis by maintaining luteal blood flow (31). In early pregnancy, HCG expression is associated with endometrial angiostimulation, since HCG increases blood supply and alters the uterine vasculature via vasodilatation, thus increasing the permeability, development and maturation of newly formed blood vessels (25). It has been reported that HCG exerts its effect possibly by interacting with its LHR receptor (39). The present study identified that CGB5 overexpression promoted tumor growth and formation, which was accompanied by an increase in LHR expression.

VM describes the unique ability of highly aggressive tumor cells to mimic the presence and function of endothelial cells, thus forming matrix-rich networks de novo, which could convey blood plasma and red blood cells (6–8). Based on H&E staining, channels which PAS-positive material and red cells in the center of the channels but CD34-negative endothelial cells may be identified as VM in vivo. The present study suggested that CGB5 may promote OVCAR-3 cells tumor growth and VM formation in tumor xenografts. It has been reported that certain ovarian cancer cells may differentiate into endothelial-like cells. To further identify the formation of VM, vascular markers, including CD31, factor VIII and VEGF, were also detected in OVCAR-3 cells in vivo. The expression of CD31, factor VIII and VEGF followed the same tendency as the levels of CGB5 in these cells.

In conclusion, ovarian cancer is a silent killer, and the present results provide clearly in vivo evidence that HCG is important in the formation of VM. Therefore, it is possible to speculate that the use of anti-HCG therapeutic targeting may provide a novel opportunity to circumvent tumors that express HCG, such as ovarian cancer and choriocarcinoma.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (Beijing, China; grant no. 30801226).

References

1 

Zhang B, Barekati Z, Kohler C, Radpour R, Asadollahi R, Holzgreve W and Zhong XY: Proteomics and biomarkers for ovarian cancer diagnosis. Ann Clin Lab Sci. 40:218–225. 2010.PubMed/NCBI

2 

Wang JY, Sun T, Zhao XL, Zhang SW, Zhang DF, Gu Q, Wang XH, Zhao N, Qie S and Sun BC: Functional significance of VEGF-a in human ovarian carcinoma: Role in vasculogenic mimicry. Cancer Biol Ther. 7:758–766. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Zhang S, Zhang D and Sun B: Vasculogenic mimicry: Current status and future prospects. Cancer Lett. 254:157–164. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Vartanian AA, Burova OS, Stepanova EV, Baryshnikov AY and Lichinitser MR: Melanoma vasculogenic mimicry is strongly related to reactive oxygen species level. Melanoma Res. 17:370–379. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Folkman J: Fundamental concepts of the angiogenic process. Curr Mol Med. 3:643–651. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Maniotis AJ, Folberg R, Hess A, Seftor EA, Gardner LM, Pe'er J, Trent JM, Meltzer PS and Hendrix MJ: Vascular channel formation by human melanoma cells in vivo and in vitro: Vasculogenic mimicry. Am J Pathol. 155:739–752. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Sun W, Fan YZ, Zhang WZ and Ge CY: A pilot histomorphology and hemodynamic of vasculogenic mimicry in gallbladder carcinomas in vivo and in vitro. J Exp Clin Cancer Res. 30:462011. View Article : Google Scholar : PubMed/NCBI

8 

Hess AR, Seftor EA, Seftor RE and Hendrix MJ: Phosphoinositide 3-kinase regulates membrane Type 1-matrix metalloproteinase (MMP) and MMP-2 activity during melanoma cell vasculogenic mimicry. Cancer Res. 63:4757–4762. 2003.PubMed/NCBI

9 

Sun B, Zhang D, Zhang S, Zhang W, Guo H and Zhao X: Hypoxia influences vasculogenic mimicry channel formation and tumor invasion-related protein expression in melanoma. Cancer Lett. 249:188–197. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Sood AK, Seftor EA, Fletcher MS, Gardner LM, Heidger PM, Buller RE, Seftor RE and Hendrix MJ: Molecular determinants of ovarian cancer plasticity. Am J Pathol. 158:1279–1288. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Shirakawa K, Wakasugi H, Heike Y, Watanabe I, Yamada S, Saito K and Konishi F: Vasculogenic mimicry and pseudo-comedo formation in breast cancer. Int J Cancer. 99:821–828. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Guzman G, Cotler SJ, Lin AY, Maniotis AJ and Folberg R: A pilot study of vasculogenic mimicry immunohistochemical expression in hepatocellular carcinoma. Arch Pathol Lab Med. 131:1776–1781. 2007.PubMed/NCBI

13 

Sharma N, Seftor RE, Seftor EA, Gruman LM, Heidger PM Jr, Cohen MB, Lubaroff DM and Hendrix MJ: Prostatic tumor cell plasticity involves cooperative interactions of distinct phenotypic subpopulations: Role in vasculogenic mimicry. Prostate. 50:189–201. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Vartanian AA, Stepanova EV, Gutorov SL, Solomko ESh, Grigorieva IN, Sokolova IN, Baryshnikov AY and Lichinitser MR: Prognostic significance of periodic acid-Schiff-positive patterns in clear cell renal cell carcinoma. Can J Urol. 16:4726–4732. 2009.PubMed/NCBI

15 

El Hallani S, Boisselier B, Peglion F, Rousseau A, Colin C, Idbaih A, Marie Y, Mokhtari K, Thomas JL, Eichmann A, et al: A new alternative mechanism in glioblastoma vascularization: Tubular vasculogenic mimicry. Brain. 133:973–982. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Li M, Gu Y, Zhang Z, Zhang S, Zhang D, Saleem AF, Zhao X and Sun B: Vasculogenic mimicry: A new prognostic sign of gastric adenocarcinoma. Pathol Oncol Res. 16:259–266. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Baeten CI, Hillen F, Pauwels P, de Bruine AP and Baeten CG: Prognostic role of vasculogenic mimicry in colorectal cancer. Dis Colon Rectum. 52:2028–2035. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Shih IeM: Trophoblastic vasculogenic mimicry in gestational choriocarcinoma. Mod Pathol. 24:646–652. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Sood AK, Fletcher MS, Zahn CM, Gruman LM, Coffin JE, Seftor EA and Hendrix MJ: The clinical significance of tumor cell-lined vasculature in ovarian carcinoma: Implications for anti-vasculogenic therapy. Cancer Biol Ther. 1:661–664. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Zygmunt M, Herr F, Keller-Schoenwetter S, Kunzi-Rapp K, Münstedt K, Rao CV, Lang U and Preissner KT: Characterization of human chorionic gonadotropin as a novel angiogenic factor. J Clin Endocrinol Metab. 87:5290–5296. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Toth P, Li X, Rao CV, Lincoln SR, Sanfilippo JS, Spinnato JA II and Yussman MA: Expression of functional human chorionic gonadotropin/human luteinizing hormone receptor gene in human uterine arteries. J Clin Endocrinol Metab. 79:307–315. 1994. View Article : Google Scholar : PubMed/NCBI

22 

Wulff C, Dickson SE, Duncan WC and Fraser HM: Angiogenesis in the human corpus luteum: Simulated early pregnancy by HCG treatment is associated with both angiogenesis and vessel stabilization. Hum Reprod. 16:2515–2524. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Berndt S, Perrier D'Hauterive S, Blacher S, Péqueux C, Lorquet S, Munaut C, Applanat M, Hervé MA, Lamandé N, Corvol P, et al: Angiogenic activity of human chorionic gonadotropin through LH receptor activation on endothelial and epithelial cells of the endometrium. FASEB J. 20:2630–2632. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Michel RM, Aguilar JL and Arrieta O: Human chorionic gonadotropin as an angiogenic factor in breast cancer during pregnancy. Med Hypotheses. 68:1035–1040. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Szajnik M, Nowak-Markwitz E, Szczepański MJ and Spaczyński M: Assessment of expression of luteinizing hormone (LH)/human chorionic gonadotropin (hCG) receptor (LH/hCGR) and hCG protein in ovarian cancer tissues. Ginekol Pol. 78:939–943. 2007.(In Polish). PubMed/NCBI

26 

Muller CY and Cole LA: The quagmire of hCG and hCG testing in gynecologic oncology. Gynecol Oncol. 112:663–672. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Lempiäinen A, Stenman UH, Blomqvist C and Hotakainen K: Free beta-subunit of human chorionic gonadotropin in serum is a diagnostically sensitive marker of seminomatous testicular cancer. Clin Chem. 54:1840–1843. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Iles RK, Delves PJ and Butler SA: Does hCG or hCGβ play a role in cancer cell biology? Mol Cell Endocrinol. 329:62–70. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Daniel KD, Kim GY, Vassiliou CC, Jalali-Yazdi F, Langer R and Cima MJ: Multi-reservoir device for detecting a soluble cancer biomarker. Lab Chip. 7:1288–1293. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Jankowska AG, Andrusiewicz M, Fischer N and Warchol PJ: Expression of hCG and GnRHs and their receptors in endometrial carcinoma and hyperplasia. Int J Gynecol Cancer. 20:92–101. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Su M, Wei W, Xu X, Wang X, Chen C, Su L and Zhang Y: Role of hCG in vasculogenic mimicry in OVCAR-3 ovarian cancer cell line. Int J Gynecol Cancer. 21:1366–1374. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Kavak S, Ayaz L and Emre M: Effects of rosiglitazone with insulin combination therapy on oxidative stress and lipid profile in left ventricular muscles of diabetic rats. Exp Diabetes Res. 2012:9056832012. View Article : Google Scholar : PubMed/NCBI

33 

Newton PT, Staines KA, Spevak L, Boskey AL, Teixeira CC, Macrae VE, Canfield AE and Farquharson C: Chondrogenic ATDC5 cells: An optimised model for rapid and physiological matrix mineralisation. Int J Mol Med. 30:1187–1193. 2012.PubMed/NCBI

34 

Scimeca M, Orlandi A, Terrenato I, Bischetti S and Bonanno E: Assessment of metal contaminants in non-small cell lung cancer by EDX microanalysis. Eur J Histochem. 58:24032014. View Article : Google Scholar : PubMed/NCBI

35 

Brouillet S, Hoffmann P, Chauvet S, Salomon A, Chamboredon S, Sergent F, Benharouga M, Feige JJ and Alfaidy N: Revisiting the role of hCG: new regulation of the angiogenic factor EG-VEGF and its receptors. Cell Mol Life Sci. 69:1537–50. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Hamada AL, Nakabayashi K, Sato A, Kiyoshi K, Takamatsu Y, Laoag-Fernandez JB, Ohara N and Maruo T: Transfection of antisense chorionic gonadotropin beta gene into choriocarcinoma cells suppresses the cell proliferation and induces apoptosis. J Clin Endocrinol Metab. 90:4873–4879. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Bo M and Boime I: Identification of the transcriptionally active genes of the chorionic gonadotropin beta gene cluster in vivo. J Biol Chem. 267:3179–3184. 1992.PubMed/NCBI

38 

Talmadge K, Boorstein WR, Vamvakopoulos NC, Gething MJ and Fiddes JC: Only three of the seven human chorionic gonadotropin beta subunit genes can be expressed in the placenta. Nucleic Acids Res. 12:8415–8436. 1984. View Article : Google Scholar : PubMed/NCBI

39 

Meng XL, Rennert OM and Chan WY: Human chorionic gonadotropin induces neuronal differentiation of PC12 cells through activation of stably expressed lutropin/choriogonadotropin receptor. Endocrinology. 148:5865–5873. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao S, Fan C, Huang H, Zhu C, Su M and Zhang Y: Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo. Oncol Lett 12: 459-466, 2016.
APA
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., & Zhang, Y. (2016). Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo. Oncology Letters, 12, 459-466. https://doi.org/10.3892/ol.2016.4630
MLA
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., Zhang, Y."Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo". Oncology Letters 12.1 (2016): 459-466.
Chicago
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., Zhang, Y."Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo". Oncology Letters 12, no. 1 (2016): 459-466. https://doi.org/10.3892/ol.2016.4630
Copy and paste a formatted citation
x
Spandidos Publications style
Gao S, Fan C, Huang H, Zhu C, Su M and Zhang Y: Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo. Oncol Lett 12: 459-466, 2016.
APA
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., & Zhang, Y. (2016). Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo. Oncology Letters, 12, 459-466. https://doi.org/10.3892/ol.2016.4630
MLA
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., Zhang, Y."Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo". Oncology Letters 12.1 (2016): 459-466.
Chicago
Gao, S., Fan, C., Huang, H., Zhu, C., Su, M., Zhang, Y."Effects of HCG on human epithelial ovarian cancer vasculogenic mimicry formation in vivo". Oncology Letters 12, no. 1 (2016): 459-466. https://doi.org/10.3892/ol.2016.4630
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team