UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in patients with metastatic gastrointestinal cancer treated with irinotecan-based regimens

  • Authors:
    • Chengxu Cui
    • Chang Shu
    • Dandan Cao
    • Yi Yang
    • Junbao Liu
    • Shuping Shi
    • Zhujun Shao
    • Nan Wang
    • Ting Yang
    • Hao Liang
    • Shanshan Zou
    • Songnian Hu
  • View Affiliations

  • Published online on: September 14, 2016     https://doi.org/10.3892/ol.2016.5130
  • Pages: 4231-4237
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Irinotecan-induced severe neutropenia and diarrhea, which remain unpredictable, has restrained the dose and clinical efficiency of irinotecan administration. In the present study, a total of 70 irinotecan-treated patients with histologically confirmed metastatic gastrointestinal cancer were enrolled. Despite genotyping well‑reported alleles, direct sequencing was specifically adopted to avoid ethnic heterogeneity and to identify novel variations. The promoter (‑1000 bp) and exon 1 regions of UDP glucuronosyltransferase family 1 member A complex locus (UGT1A1) gene family members UGT1A1, UGT1A7 and UGT1A9 were sequenced, and comprehensive analysis of their genetic polymorphisms was performed to determine the association between inherited genetic variations and irinotecan‑induced toxicity. A total of 23 different genetic variants were detected in the present study, including 2 novel polymorphisms. The results of the present study revealed that UGT1A1*6 and UGT1A7*3 are risk factors for irinotecan‑induced severe neutropenia, and UGT1A9*1b is associated with severe diarrhea. These results may provide biomarkers for the selection of the optimal chemotherapy for Chinese patients with metastatic gastrointestinal cancer.

Introduction

Irinotecan, also termed Camptosar and CPT-11, is a type of semi-artificial camptothecin compound that is one of the effective cytotoxic antineoplastic agents used to treat colorectal cancer (1). Irinotecan can be activated to SN-38 subsequent to hydrolysis of carboxylesterase in vivo, and derived into an inhibitor of topoisomerase I, which can synchronously be inactivated into SN-38G by UDP glucuronosyltransferase family 1 member A complex locus (UGT1A) (2). Thus, irinotecan interrupts the replication and transcription of DNA by preventing the relegation of single-stranded DNA and causes the death of tumor cells following a series of biotransformations. Irinotecan received authorization from the US Food and Drug Administration (FDA) in 1998, and has been approved as the primary therapy of metastatic adult colorectal cancer, combined with 5-fluorouracil (5-FU) and leucovorin (LV) (3). However, severe neutropenia and diarrhea, the primary toxicities of irinotecan, have restrained the dose and clinical efficiency of irinotecan (4). It has been reported that the curative effect and negative toxicity are each dependent on ethnicity (57).

The UGT1A gene family has 13 members in Homo sapiens, and is located on Chr2 (2q37). Each member is composed of a unique exon 1, followed by four common exons (exons 2–5). Therefore, each functional protein of the UGT1A family has a specific N-terminus, which is determined by the first exon sequence, to recognize the corresponding substrate. In addition, the last four mutual exons provide the identical C termini, which consists of 245 amino acids and guarantee the combination with uridine diphosphate glucuronic acid (8). UGT1A1, UGT1A7 and UGT1A9 have been shown to be the major effective factors during the inactivation of SN-38 (9,10), and genetic polymorphism in the UGT1A family has also been shown to affect the variability of irinotecan toxicity during clinical application (11,12).

Considering the complex mechanism involved in the association between the UGT1A family and toxicity of irinotecan, the FDA has instructed the manufacturer of irinotecan to revise the label and add the caution of relative toxicity and dose titration in patients with the UGT1A1*28 polymorphism, as well as the advice for patients to undergo allelic detection (13). For patients from the Asian population, UGT1A1*6 is considered to be another potential risk factor that is responsible for the toxicity among the Asian population in addition to the UGT1A1*28 allele (11,12,14). The Japanese Pharmaceuticals and Medical Devices Agency package insert for irinotecan states that individuals who are homozygous for the UGT1A1*6 or UCT1A1*28 alleles, or heterozygous with the UGT1A1*6/*28 genotype, are at an increased risk of severe adverse events, particularly neutropenia (15). The impact of UGT1A7 polymorphism on irinotecan-induced toxicity has also been well-studied (1618). In addition, UGT1A9*22 has been reported to be associated with the toxic potency of irinotecan (1820). Considering the ethnicity-specific distribution of genetic polymorphisms, the predictive markers for severe toxicity in Chinese patients treated with irinotecan-based regimens have not been affirmatively reported by studies yet.

In the present study, direct sequencing was adopted to avoid ethnic heterogeneity and to identify novel variations. The first exon regions of UGT1A1, UGT1A7 and UGT1A9 were sequenced, and comprehensive analysis of genetic polymorphisms was performed to determine the association between inherited genetic variations and irinotecan-induced toxicity. The major aim of the current study was to identify toxicity predictable markers of Chinese metastatic gastrointestinal cancer patients treated with irinotecan-based regimens.

Patients and methods

Patients

In total, 70 patients with histologically-confirmed metastatic gastrointestinal cancer were enrolled from the Cancer Institute and Hospital, Chinese Academy of Medical Sciences (Beijing, China) between January 2012 and December 2014. All patients were treated with the irinotecan-based folinic acid, fluorouracil (5-FU) and irinotecan (FOLFIRI) or capecitabine and irinotecan (XELIRI) regimens. The study protocol was approved by the Ethics Committee of Beijing Chao-Yang Sanhuan Cancer Hospital (Beijing, China), which is affiliated with the Cancer Institute and Hospital of the Chinese Academy of Medical Sciences. Written informed consent was obtained from all patients prior to entering the study.

Eligibility criteria

All patients were diagnosed with histologically-confirmed gastrointestinal cancer and were undergoing their first irinotecan-based chemotherapy. The patients were aged >18 years and had an Eastern Cooperative Oncology Group (ECOG) performance status (PS) of 0–2 and a life expectancy of ≥3 months.

Chemotherapy

The patients were treated with one of the following FOLFIRI-based regimens until progressive disease (PD), unacceptable toxicity, patient refusal or a medical decision to discontinue treatment. Patients treated with the FOLFIRI regimen received 180 mg/m2 irinotecan intravenously (IV), 400 mg/m2 LV IV and 400 mg/m2 5-FU bolus, followed by 2,400 mg/m2 5-FU IV, all administered on day 1, every 2 weeks. Patients treated with the XELIRI regimen received 120 mg/m2 irinotecan IV on days 1 and 8, and 800 mg/m2 oral capecitabine twice per day on days 1–14 every 3 weeks.

Genotyping and genetic analysis

Peripheral venous blood samples were obtained from 70 patients with metastatic gastrointestinal cancer, who were treated with irinotecan-based regimens (37 with FOLFIRI and 33 with XELIRI) for isolation of genomic DNA. Genomic DNA was isolated using the QIAamp DNA blood mini kit (Qiagen, Inc., Valencia, CA, USA). The promoter (−1000 bp) and exon 1 regions of UGT1A1, UGT1A7 and UGT1A9 were resequenced to screen for single nucleotide polymorphisms (SNPs), using the DYEnamic ET terminator cycle sequencing kit (GE Healthcare, Chalfont St. Giles, UK) on the ABI Prism 3730×l DNA analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Polymerase chain reaction (PCR) was performed in a final volume of 15 µl, containing 30 ng genomic DNA, 1*PCR Takara buffer (Mg2+ plus; Takara Biotechnology Co., Ltd., Dalian, China), 2.5 pmol of each primer, 25 pmol deoxynucleotide triphosphates and 1 U of Taq DNA polymerase (Takara Biotechnology Co., Ltd.). Following pre-denaturation at 93°C for 3 min, amplification was performed under the following conditions for 32 cycles: Denaturation at 95°C for 30 sec; annealing at 58°C for 40 sec; and extension at 72°C for 2 min. The primer sequences used are shown in Table I (21).

Table I.

Primer sequences.

Table I.

Primer sequences.

GenesPrimer IDPrimer sequences
UGT1A1U1_E1AF TCGTCCTTCTTCCTCTCTGG
U1_E1AR GCAGTGCATGCAAGAAGAAT
U1_E1BF TGTCTGGCTGTTCCCACTTA
U1_E1BR CCAGAAGATGATGCCAAAGA
U1_PF GGTCATTCTCTACCCCAGCA
U1_PR AAAGCTGTCAGTCCACAAAGG
UGT1A7U7_E1AF AAACTCATATTGCAGCACAGG
U7_E1AR AAGTCAAAAATACCATTGGATGAA
U7_E1BF GGAAGATCACTGAATTGCACAG
U7_E1BR TTCCTCTGGGGGTAGTGTAGAA
U7_PF TCTTTCCGTCGAACATGAGA
U7_PR CACATTCACTGCCAATGATTTA
UGT1A9U9_E1AF CCAAGGCAAAGACCATAAGCTA
U9_E1AR CAAACTCCTGCAATTTGAAAAA
U9_E1BF CATATACCCTGGAGGATCTGGA
U9_E1BR CTGACGAGTACACGCATTGG
U9_PF CCTCTGACCTCAAGGAGTGC
U9_PR CAATGATTTACCCAAAAGAACAAG

[i] F, forward; R, reverse; UGT1A, UDP glucuronosyltransferase family 1 member A complex locus.

Base calling, quality assessment and polymorphism determination from DNA sequencing were analyzed using Phred, Phrap, Consed (http://www.phrap.org/phredphrapconsed.html) and PolyPhred (http://droog.gs.washington.edu/polyphred/). Haploview 4.2 (Broad Institute of MIT and Harvard, Cambridge, MA, USA (22) was used to estimate allele frequencies, test the Hardy-Weinberg equilibrium, measure pairwise linkage disequilibrium (LD), establish haplotypes, estimate haplotype frequency, and analyze the association between the haplotypes and toxicity. LD blocks were defined by the ‘solid spine of LD’ algorithm, and LD structure was exhibited using GOLD heatmap color scheme (23,24). The allele designations were defined according to the UGT Allele Nomenclature Committee (25).

Statistical analysis

Patients underwent baseline evaluations, including physical examination, complete medical history, ECOG PS, complete blood count, and hepatic and renal function tests. Toxicity evaluations were performed according to National Cancer Institute Common Terminology Criteria for Adverse Events version 3.0 criteria. Associations between the clinical features and toxicity were analyzed by two-tailed Fisher's exact test or Student's t-test. In addition, associations between the alleles or genotypes and toxicity were analyzed by two-tailed Fisher's exact test. P<0.05 was considered to indicate a statistically significant difference, as calculated by PLINK v1.07 (http://pngu.mgh.harvard.edu/~purcell/plink) (26). Due to the exploratory nature of the present study, no adjustments were made for multiple comparisons.

Results

In total, 70 patients with histologically-confirmed metastatic gastrointestinal cancer, consisting of 37 patients with metastatic colorectal cancer and 33 patients with metastatic gastric cancer, were enrolled in the present study. The rates of grade 3–4 toxicity were as follows: Neutropenia, 18.57% (n=13); and diarrhea, 10% (n=7). These results are in accordance with a previous study of Asian patients (6). The clinical features of patients and the incidence of severe toxicity of the irinotecan-based regimens FOLFIRI and XELIRI are summarized in Table II.

Table II.

Clinical features of 70 patients with histologically-confirmed metastatic gastrointestinal cancer.

Table II.

Clinical features of 70 patients with histologically-confirmed metastatic gastrointestinal cancer.

FeaturesValue, n (%)
Age, years
  Median54
  Range25–77
Gender
  Male48 (68.57)
  Female22 (31.43)
Tumor location
  Colon37 (52.86)
  Stomach33 (47.14)
ECOG PS
  019 (27.14)
  146 (65.71)
  25 (7.14)
TNM stage IV  70 (100.00)
Regimen
  FOLFIRI37 (52.86)
  XELIRI33 (47.14)
Neutropenia grade 3–413 (18.57)
Diarrhea grade 3–4  7 (10.00)

[i] ECOG PS, Eastern Cooperative Oncology Group performance status; TNM, tumor-node-metastasis classification of malignant tumours; FOLFIRI, folinic acid, fluorouracil and irinotecan; XELIRI, capecitabine and irinotecan.

A total of 23 different genetic variants were detected in the present study, all of the variants were consistent with the Hardy-Weinberg equilibrium (P>0.05). Genetic variations in the UGT1A1, UGT1A7 and UGT1A9 genes were compared with the genomic reference sequence AF039138.1. The amino acids were located in the reference sequences NP_000454.1 (UGT1A1), NP_061950.2 (UGTIA7) and NP_066307.1 (UGTIA9). Of these variants, 2 novel polymorphisms were identified: M06 and M09, which are located in the promoter regions of UGT1A9 and UGT1A7, respectively. UGT1A1*6, which is found only in Asian populations, had the highest frequency [minor allele frequency (MAF), 22.5%] of the SNPs in UGT1A1 in the present study. The frequency of the UGT1A1*28 SNP (MAF, 9.3%) was comparable to the frequency previously found in the Asian population (MAF, 7.0%), and was much lower compared with the frequency in Caucasian patients (MAF, 31.6%), as previously reported (11,20). Other known UGT1A alleles, UGT1A1*80, UGT1A1*81, UGT1A7*2, UGT1A7*3 and UGT1A9*1b (UGT1A9*22), were found concurrently. Table III lists the summary of identified polymorphisms in UGT1A1, UGT1A7 and UGT1A9.

Table III.

Summary of identified polymorphisms in UGT1A1, UGT1A7 and UGT1A9.

Table III.

Summary of identified polymorphisms in UGT1A1, UGT1A7 and UGT1A9.

IDLocationdb SNP IDChangeAlleleFunctionMAFH-Wpval
M01UGT1A9 promoterrs3806598A>C0.2430.747
M02UGT1A9 promoterrs45440791T>C0.0071.000
M03UGT1A9 promoterrs2741045C>T0.0071.000
M04UGT1A9 promoterrs2741046T>A0.0071.000
M05UGT1A9 promoterrs3832043T9>T10*1b0.6160.818
M06UGT1A9 promoterC>T0.0071.000
M07UGT1A9 exon 1rs151216459G>TSynonymous0.0141.000
M08UGT1A7 promoterrs4530361A>G0.2500.633
M09UGT1A7 promoterT>C0.0071.000
M10UGT1A7 promoterrs28946877C>T0.1431.000
M11UGT1A7 promoterrs7586110T>G0.2460.296
M12UGT1A7 exon 1rs7577677C>ASynonymous0.2430.314
M13UGT1A7 exon 1rs17868323T>G*2&*3N129K0.4071.000
M14UGT1A7 exon 1rs17863778C>A*2&*3R131K0.4071.000
M15UGT1A7 exon 1rs17868324G>A*2&*3R131Q0.4071.000
M16UGT1A7 exon 1rs139969318A>GSynonymous0.0071.000
M17UGT1A7 exon 1rs11692021T>C*3W208R0.250.633
M18UGT1A7 exon 1rs45462096C>TSynonymous0.0141.000
M19UGT1A7 exon 1rs17864686G>ASynonymous0.1571.000
M20UGT1A1 promoterrs887829C>T*800.1071.000
M21UGT1A1 promoterrs873478G>C*810.0361.000
M22UGT1A1 promoterrs3064744TA6>TA7*280.0931.000
M23UGT1A1 exon 1rs4148323G>A*6G71R0.2250.550

[i] MAF, minor allele frequency; UGT1A, UDP glucuronosyltransferase family 1 member A complex locus; H-Wpval, Hardy-Weinberg P-value.

In total, 6 SNPs exhibited an association with grade 3–4 neutropenia, including M01 (P=0.009), M08 (P=0.011), M10 (P=0.025), M17 (P=0.011), M19 (P=0.014) and M23 (P=0.016) (Table IV). In addition, a significant association was observed between the UGT1A9*1b polymorphism (M05) and severe diarrhea (P= 0.045; Table IV). Of these 7 SNPs, two are functional mutations, consisting of UGT1A7*3 (P=0.011; OR, 3.391) and UGT1A1*6 (P=0.016; OR, 3.373). The hotspot allele UGT1A1*28, which has been previously reported (20), was not significantly associated with grade 3–4 neutropenia or severe diarrhea (P=1.000 and 0.620, respectively; Table IV). The present study established haplotypes of those 7 SNPs and calculated the association with irinotecan-induced toxicity (Table V). Of the 7 haplotypes that were assessed, haplotypes H03, H04, H05 and H06 were observed to be associated with a higher risk of grade 3–4 neutropenia (P=0.037, P=0.043, P=0.097 and P=0.004, respectively). In addition, H04 was found to be associated with grade 3–4 diarrhea (P=0.001).

Table IV.

Association between UGT1A polymorphisms and severe toxicity.

Table IV.

Association between UGT1A polymorphisms and severe toxicity.

Neutropenia grade 3–4Diarrhea grade 3–4


SNP IDdb SNP IDP-valueOR95% CIP-valueOR95% CI
M01rs38065980.0093.5841.457–8.8210.7451.2800.374–4.379
M02rs454407911.0000.000NA1.0000.000NA
M03rs27410451.0000.000NA0.100NANA
M04rs27410461.0000.000NA0.100NANA
M05rs38320431.0001.0030.417–2.4110.0453.2731.033–10.37
M060.186NANA1.0000.000NA
M07rs1512164591.0000.000NA1.0000.000NA
M08rs45303610.0113.3911.384–8.3120.3391.7780.553–5.714
M091.0000.000NA0.100NANA
M10rs289468770.0250.000NA1.0001.0000.206–4.845
M11rs75861100.0812.2920.923–5.6931.0000.8180.214–3.124
M12rs75776770.0772.3440.944–5.8191.0000.8360.219–3.19
M13rs178683230.6591.3140.558–3.0990.0842.9250.925–9.245
M14rs665348180.6591.3140.558–3.0990.0842.9250.925–9.245
M15rs178683240.6591.3140.558–3.0990.0842.9250.925–9.245
M16rs1399693180.186NANA1.0000.000NA
M17rs116920210.0113.3911.384–8.3120.3391.7780.553–5.714
M18rs454620961.0000.000NA1.0000.000NA
M19rs178646860.0140.000NA0.2362.4000.679–8.481
M20rs8878290.7370.6470.137–3.0620.6471.4490.292–7.199
M21rs8734780.5840.000NA0.4142.3460.244–22.59
M22rs30647441.0000.7800.162–3.7540.6201.7420.345–8.802
M23rs41483230.0163.3731.350–8.4310.1910.2410.03–1.92

[i] SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; UGT1A, UDP glucuronosyltransferase family 1 member A complex locus.

Table V.

Correlation between UGT1A haplotypes and severe toxicity.

Table V.

Correlation between UGT1A haplotypes and severe toxicity.

UGT1A haplotype P-value


Haplotype IDM01M05M08M10M17M19M23FrequencyNeutropenia grade 3–4Diarrhea grade 3–4
H01A10TACTGG0.5550.2690.114
H02C9TGCCGA0.1760.1830.274
H03A9TATTAG0.1200.0370.783
H04C9TGCCGG0.0440.0430.001
H05A10TACTGA0.0300.0970.502
H06C10TGCCGA0.0150.0040.629
H07A9TGCCGG0.0140.4940.059

[i] UGT1A, UDP glucuronosyltransferase family 1 member A complex locus.

Pairwise LD analysis was performed with the detected variations having a MAF >10%. LD blocks were defined by the ‘solid spine of LD’ algorithm, and LD structure was exhibited by the GOLD heatmap color scheme. As shown in Fig. 1, a linkage block was observed across the sequenced region in the present metastatic gastrointestinal cancer patients. The variants detected in the UGT1A7 and UGT1A9 regions were closely associated (block 1). Out of the 6 SNPs that exhibited an association with grade 3–4 neutropenia, 5 SNPs were located in the UGT1A7-UGT1A9 block (block 1). In addition, M17 (UGT1A7*3) was the only functional variant among the 5 SNPs. It was hypothesized that the significant association with grade 3–4 neutropenia of the other 4 SNPs was attributed to UGT1A7*3.

In total, 2 functional mutations exhibited a significant association with grade 3–4 neutropenia, including UGT1A7*3 (P=0.011; OR, 3.391; 95% CI, 1.384–8.312) and UGT1A1*6 (P=0.016; OR, 3.373; 95% CI, 1.350–8.431). The risk of severe neutropenia associated with UGT1A7*3 and UGT1A1*6 genotypes (Table VI), and the combined effects of those two alleles, was analyzed (Table VII). In the present study, patients with one UGT1A7*3 allele had an OR of 4.444 (95% CI, 1.060–18.627) for the risk of severe neutropenia. Compared with patients heterozygous for UGT1A7*3, patients homozygous for UGT1A7*3 demonstrated a 5-fold increase in risk, with an OR of 23.333 (95% CI, 1.609–338.419). The OR for patients homozygous for UGT1A1*6 (OR, 12.333; 95% CI, 0.607–250.508) was two times higher than the OR of patients heterozygous for UGT1A1*6 (OR, 6.167; 95% CI, 1.486–25.586). Combined effects analysis of those 2 alleles revealed that patients carrying the UGT1A7*3 and UGT1A1*6 alleles had a higher OR (OR, 7.333; 95% CI, 1.485–36.209) than the OR of patients carrying either UGT1A7*3 (OR, 5.556; 95% CI; 1.371–22.507) or UGT1A1*6 (OR, 6.491; 95% CI, 1.595–26.423). However, UGT1A9*1b was not significantly associated with the risk of severe toxicity in the heterozygous (P=0.617) or homozygous (P=0.065) state.

Table VI.

Risk of severe toxicity associated with UGT1A7*3, UGT1A1*6 and UGT1A9*1b.

Table VI.

Risk of severe toxicity associated with UGT1A7*3, UGT1A1*6 and UGT1A9*1b.

SNP IDAllele GenotypesaSevere toxicity, nOverall, nP-valueOR95% CI
M17UGT1A7*303b38
18b290.046   4.4441.060–18.627
22b  30.03523.3331.609–338.419
M23UGT1A1*603b40
19b270.010   6.1671.486–25.586
21b  20.18412.3330.607–250.508
M05UGT1A9*1b01c27
13c310.617   2.7860.272–28.496
23c110.065   9.7500.886–107.249

a Number of alleles carried by the patients.

b Number of patients developing neutropenia among all the patients in the same genotype group.

c Number of patients developing diarrhea among all the patients in the same genotype group. SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; UGT1A, UDP glucuronosyltransferase family 1 member A complex locus.

Table VII.

Risk of severe neutropenia associated with combined effects of UGT1A7*3 and UGT1A1*6.

Table VII.

Risk of severe neutropenia associated with combined effects of UGT1A7*3 and UGT1A1*6.

SNP IDAlleleGenotypesSevere neutropenia, nOverall, nP-valueOR95% CI
M17UGT1A7*30   3a38b0.0145.5561.371–22.507
1+210a31b
M23UGT1A1*60   3a40b0.0106.4911.595–26.423
1+210a29b
M17&M23 0   2a34b0.0127.3331.485–36.209
Others11a35b

a Number of patients developing toxicity among all the patients in the same genotype group.

b Number of alleles carried by the patient. SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; UGT1A, UDP glucuronosyltransferase family 1 member A complex locus.

Discussion

Polymorphisms in the UGT1A family have been demonstrated to repeatedly affect the variability of irinotecan-induced toxicity, and the results are dependent on ethnicity. The toxicity of irinotecan remains unpredictable and requires additional investigation (11,12,20).

Direct sequencing was adopted to avoid ethnic heterogeneity and to identify novel variations. Subsequent to sequencing of the promoter (−1000 bp) and exon 1 regions of UGT1A1, UGT1A7 and UGT1A9, comprehensive analysis of genetic polymorphisms in these alleles was performed in Chinese patients with metastatic gastrointestinal cancer treated using irinotecan-based regimens. A total of 23 different genetic variants were detected, including 2 novel polymorphisms. In total, 7 SNPs exhibited an association with grade 3–4 toxicity (P<0.05). Finally, 3 polymorphisms were focused on, 2 of which were the functional mutations UGT1A7*3 and UGT1A1*6 that exhibited a significant association with grade 3–4 neutropenia (UGT1A7*3: P=0.011, OR=3.391, 95% CI=1.384–8.312; and UGT1A1*6: P=0.016, OR=3.373, 95% CI=1.350–8.431). Patients that carried the UGT1A7*3 and UGT1A1*6 alleles had an increased risk of grade 3–4 neutropenia (OR, 7.333; 95% CI, 1.485–36.209). Another key mutation is UGT1A9*1b (−118 9T>10T), which is found predominantly in the Asian population, and leads to increased enzyme expression and glucuronidation rates (16,19). This was the only mutation significantly associated with grade 3–4 diarrhea (P=0.045; OR, 3.273; 95% CI, 1.033–10.37) in the present study.

UGT1A7*3 is located on UGT1A7 exon 1, and a transition of T>C results in the 208th amino acid, tryptophan, changing to arginine. The UGT1A7*3 allele has been reported to generate an enzyme with 50% reduced catalytic activity (27). It has also been reported that UGT1A7*3 affects the pharmacokinetics of SN-38 in studies investigating both Caucasian and Asian patients (11,16,18,20). In the present study, patients homozygous for UGT1A7*3 exhibited a 23.333-fold increased risk of grade 3–4 neutropenia (OR, 23.333; 95% CI, 1.609–338.419), while patients heterozygous for UGT1A7*3 had an OR of 4.444 (95% CI, 1.060–18.627).

UGT1A1*6, a unique allele in the Asian population, is located on UGT1A1 exon 1 (11,12). A transition of G>A results in a change of the 71st amino acid from glycine to arginine. Previous studies in the Asian population found that UGT1A1*28/*6 is a risk factor for irinotecan-induced toxicity (18,28). The OR for UGT1A1*6-homozygous patients (OR, 12.333; 95% CI, 0.607–250.508) was increased two-fold compared with the OR for UGT1A1*6-heterozygous patients (OR, 6.167; 95% CI, 1.486–25.586).

In conclusion, the UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in Chinese metastatic gastrointestinal cancer patients treated with irinotecan-based regimens.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81402999).

References

1 

Mathijssen RH, van Alphen RJ, Verweij J, Loos WJ, Nooter K, Stoter G and Sparreboom A: Clinical pharmacokinetics and metabolism of irinotecan (CPT-11). Clin Cancer Res. 7:2182–2194. 2001.PubMed/NCBI

2 

Guillemette C: Pharmacogenomics of human UDP-glucuronosyltransferase enzymes. Pharmacogenomics J. 3:136–158. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Cunningham D, Pyrhönen S, James RD, Punt CJ, Hickish TF, Heikkila R, Johannesen TB, Starkhammar H, Topham CA, Awad L, et al: Randomized trial of irinotecan plus supportive care versus supportive care alone after fluorouracil failure for patients with metastatic colorectal cancer. Lancet. 352:1413–1418. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Saltz LB, Cox JV, Blanke C, Rosen LS, Fehrenbacher L, Moore MJ, Maroun JA, Ackland SP, Locker PK, Pirotta N, et al: Irinotecan plus fluorouracil and leucovorin for metastatic colorectal cancer. N Engl J Med. 343:905–914. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Fuchs CS, Moore MR, Harker G, Villa L, Rinaldi D and Hecht JR: Phase III comparison of two irinotecan dosing regimens in second-line therapy of metastatic colorectal cancer. J Clin Oncol. 21:807–814. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Zhang W, Zhao ZY, Wu Q, Li J, Fu Q, Cheng J, Xu N, Wu CP and Xu LG: Multicenter phase II study of modified FOLFIRI in patients in a Chinese population with advanced colorectal cancer (CRC) refractory to fluoropyrimidine and oxaliplatin. J Clin Oncol. 23:292s. 2005.

7 

Maitland ML, Grimsley C, Kuttab-Boulos H, Witonsky D, Kasza KE, Yang L, Roe BA and Di Rienzo A: Comparative genomics analysis of human sequence variation in the UGT1A gene cluster. Pharmacogenomics J. 6:52–62. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Gong QH, Cho JW, Huang T, Potter C, Gholami N, Basu NK, Kubota S, Carvalho S, Pennington MW, Owens IS and Popescu NC: Thirteen UDPglucuronosyltransferase genes are encoded at the human UGT1 gene complex locus. Pharmacogenetics. 11:357–368. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Iyer L, King CD, Whitington PF, Green MD, Roy SK, Tephly TR, Coffman BL and Ratain MJ: Genetic predisposition to the metabolism of irinotecan (CPT-11). Role of uridine diphosphate glucuronosyltransferase isoform 1A1 in the glucuronidation of its active metabolite (SN-38) in human liver microsomes. J Clin Invest. 101:847–854. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Gagné JF, Montminy V, Belanger P, Journault K, Gaucher G and Guillemette C: Common human UGT1A polymorphisms and the altered metabolism of irinotecan active metabolite 7-ethyl-10-hydroxycamptothecin (SN-38). Mol Pharmacol. 62:608–617. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Han JY, Lim HS, Shin ES, Yoo YK, Park YH, Lee JE, Jang IJ, Lee DH and Lee JS: Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. J Clin Oncol. 24:2237–2244. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Minami H, Sai K, Saeki M, Saito Y, Ozawa S, Suzuki K, Kaniwa N, Sawada J, Hamaguchi T, Yamamoto N, et al: Irinotecan pharmacokinetics/pharmacodynamics and UGT1A genetic polymorphisms in Japanese: Roles of UGT1A1*6 and *28. Pharmacogenet Genomics. 17:497–504. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Pharmacia and Upjohn Company LLC, . Camptosar - irinotecan hydrochloride injection, solution. http://labeling.pfizer.com/Show Labeling.aspx?id=533

14 

Sai K, Saeki M, Saito Y, Ozawa S, Katori N, Jinno H, Hasegawa R, Kaniwa N, Sawada J, Komamura K, et al: UGT1A1 haplotypes associated with reduced glucuronidation and increased serum bilirubin in irinotecan-administered Japanese patients with cancer. Clin Pharmacol Ther. 75:501–515. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Bowcock AM, Anderson LA, Friedman LS, Black DM, Osborne-Lawrence S, Rowell SE, Hall JM, Solomon E and King MC: THRA1 and D17S183 flank an interval of <4 cM for the breast-ovarian cancer gene (BRCA1) on chromosome 17q21. Am J Hum Genet. 52:718–722. 1993.PubMed/NCBI

16 

Fujita K, Ando Y, Nagashima F, Yamamoto W, Eodo H, Araki K, Kodama K, Miya T, Narabayashi M and Sasaki Y: Genetic linkage of UGT1A7 and UGT1A9 polymorphisms to UGT1A1*6 is associated with reduced activity for SN-38 in Japanese patients with cancer. Cancer Chemother Pharmacol. 60:515–522. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Lankisch TO, Schulz C, Zwingers T, Erichsen TJ, Manns MP, Heinemann V and Strassburg CP: Gilbert's syndrome and irinotecan toxicity: Combination with UDP-glucuronosyltransferase 1A7 variants increases. Cancer Epidemiol Biomarkers Prev. 17:695–701. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Hazama S, Mishima H, Tsunedomi R, Okuyama Y, Kato T, Takahashi K, Nozawa H, Ando H, Kobayashi M, Takemoto H, et al: UGT1A1*6, 1A7*3, and 1A9*22 genotypes predict severe neutropenia in FOLFIRI-treated metastatic colorectal cancer in two prospective studies in Japan. Cancer Sci. 104:1662–1669. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Yamanaka H, Nakajima M, Katoh M, Hara Y, Tachibana O, Yamashita J, McLeod HL and Yokoi T: A novel polymorphism in the promoter region of human UGT1A9 gene (UGT1A9*22) and its effects on the transcriptional activity. Pharmacogenetics. 14:329–332. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Cecchin E, Innocenti F, D'Andrea M, Corona G, De Mattia E, Biason P, Buonadonna A and Toffoli G: Predictive role of the UGT1A1, UGT1A7, and UGT1A9 genetic variants and their haplotypes on the outcome of metastatic colorectal cancer patients treated with fluorouracil, leucovorin, and irinotecan. J Clin Oncol. 27:2457–2465. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Cui C, Shu C, Yang Y, Liu J, Shi S, Shao Z, Wang N, Yang T and Hu S: XELIRI compared with FOLFIRI as a second-line treatment in patients with metastatic colorectal cancer. Oncol Lett. 8:1864–1872. 2014.PubMed/NCBI

22 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Abecasis GR and Cookson WO: GOLD-graphical overview of linkage disequilibrium. Bioinformatics. 16:182–183. 2000. View Article : Google Scholar : PubMed/NCBI

25 

Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å, Kampf C, Sjöstedt E, Asplund A, et al: Proteomics. Tissue-based map of the human proteome. Science. 347:12604192015. View Article : Google Scholar : PubMed/NCBI

26 

Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Maller J, Sklar P, de Bakker PIW, Daly MJ and Sham PC: PLINK: A toolset for whole-genome association and population-based linkage analysis. Am J Hum Genet. 81:559–575. View Article : Google Scholar : PubMed/NCBI

27 

Guillemette C, Ritter JK, Auyeung DJ, Kessler FK and Housman DE: Structural heterogeneity at the UDP-glucuronosyltransferase 1 locus: Functional consequences of three novel missense mutations in the human UGT1A7 gene. Pharmacogenetics. 10:629–644. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Wang H, Bian T, Jin T, Chen Y, Lin A and Chen C: Association analysis of UGT1A genotype and haplotype with SN-38 glucuronidation in human livers. Pharmacogenomics. 15:785–798. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2016
Volume 12 Issue 5

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Cui C, Shu C, Cao D, Yang Y, Liu J, Shi S, Shao Z, Wang N, Yang T, Liang H, Liang H, et al: UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in patients with metastatic gastrointestinal cancer treated with irinotecan-based regimens. Oncol Lett 12: 4231-4237, 2016
APA
Cui, C., Shu, C., Cao, D., Yang, Y., Liu, J., Shi, S. ... Hu, S. (2016). UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in patients with metastatic gastrointestinal cancer treated with irinotecan-based regimens. Oncology Letters, 12, 4231-4237. https://doi.org/10.3892/ol.2016.5130
MLA
Cui, C., Shu, C., Cao, D., Yang, Y., Liu, J., Shi, S., Shao, Z., Wang, N., Yang, T., Liang, H., Zou, S., Hu, S."UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in patients with metastatic gastrointestinal cancer treated with irinotecan-based regimens". Oncology Letters 12.5 (2016): 4231-4237.
Chicago
Cui, C., Shu, C., Cao, D., Yang, Y., Liu, J., Shi, S., Shao, Z., Wang, N., Yang, T., Liang, H., Zou, S., Hu, S."UGT1A1*6, UGT1A7*3 and UGT1A9*1b polymorphisms are predictive markers for severe toxicity in patients with metastatic gastrointestinal cancer treated with irinotecan-based regimens". Oncology Letters 12, no. 5 (2016): 4231-4237. https://doi.org/10.3892/ol.2016.5130