Trametes robiniophila may induce apoptosis and inhibit MMPs expression in the human gastric carcinoma cell line MKN‑45

  • Authors:
    • Xuening Ji
    • Chunxia Pan
    • Xiaowen Li
    • Yunbin Gao
    • Lu Xia
    • Xiulian Quan
    • Jinyan Lv
    • Ruoyu Wang
  • View Affiliations

  • Published online on: December 20, 2016     https://doi.org/10.3892/ol.2016.5517
  • Pages: 841-846
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Gastric carcinoma (GC) is one of the most common malignant tumors and is mainly treated by invasive surgeries. The present study aimed to investigate the treatment potential of Trametes robiniophila on GC using the human GC cell line MKN‑45. Cells were incubated with Trametes robiniophila at a concentration of 0, 5 and 10 mg/ml for 24 h. The apoptosis of the cell line was examined with acridine orange/ethidium bromide staining and flow cytometry. The expression of B-cell lymphoma (Bcl)‑2, Fas, caspase‑3, matrix metalloproteinase (MMP)‑2 and MMP‑9 was analyzed using reverse transcription‑polymerase chain reaction and western blotting. With increasing drug concentrations, the proportion of apoptotic and necrotic cells increased. For a certain concentration, the apoptotic ratio also increased with increasing response times. Compared with the control group, the Bcl‑2, MMP‑2 and MMP‑9 expression levels in the MKN‑45 cell line decreased, while the expression levels of Fas and caspase‑3 increased (P<0.05), and the expression patterns were strengthened with increasing drug concentrations. The present study revealed that Trametes robiniophila had treatment potential on GC, and it may act on gastric cells through apoptotic induction and MMPs expression inhibition. Based on the present results, Trametes robiniophila may be considered as an alternative approach for noninvasive therapy of GC. However, future studies should be performed to clarify this further.

Introduction

Gastric carcinoma (GC) remains a major health issue worldwide, with 1 million newly diagnosed cases and 700,000 mortalities each year (1). Occurrence of GC varies with geography, and in Asia or the Pacific Islands, the incidences and mortality rates of GC can be twice as high as those in Western countries (2). GC is considered as a multifactorial disease due to numerous inherited and environmental factors, including genetic background, infectious agents and dietary habits (3). Surgery remains the only curative therapy for GC treatment, and perioperative and adjuvant chemotherapy can improve the outcome (4,5). However, no clear superiority of one strategy over others has been observed, and serious side effects and dose-limiting toxicities of chemotherapy treatments are common (6). In addition, >50% of resected GC patients experience reccurrence and metastases (7). Safe, natural and non-toxic agents that can interfere with the essential steps of cancer development are increasingly used for cancer therapy (8,9). Traditional Chinese medicines (TCMs) have recently drawn great attention as possible anticancer agents with few side effects.

Trametes robiniophila Murr. (Huaier) is a fungal species in China that has been applied in TCM for >1,600 years (10). In recent years, the antitumor effect of Huaier has been demonstrated, and Trametes robiniophila extracted from the fungus in hot water to eliminate the free proteins and amino acids has been increasingly applied in clinical cancer therapy (10,11). The major active ingredient of Trametes robiniophila is proteoglycan, including 41.53% polysaccharides, 12.93% amino acids and 8.72% water (12). However, the inhibition effect on cancer of proteoglycan and other isolated ingredients was much lower than that of Trametes robiniophila (13,14). The antitumor effect of Trametes robiniophila involves various mechanisms, including induction of apoptosis, anti-angiogenesis, drug resistance reversal, anti-metastasis and system immune activation (15). The current study attempted to investigate the antitumor effect of Trametes robiniophila on GC using the human GC cell line MKN-45. The apoptosis of the cell line was examined with acridine orange (AO)/ethidium bromide (EB) staining and flow cytometry, and the expression level of molecules involved in the apoptotic and metastatic processes of tumors were analyzed using reverse transcription-polymerase chain reaction (RT-PCR) and western blotting.

Materials and methods

Preparation of Trametes robiniophila

Trametes robiniophila was purchased from Qidong Gaitianli Pharmaceutical Co., Ltd. (Qidong, China). Trametes robiniophila (1.0 g) was dissolved in 10 ml RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and sterilized using a 0.22-µm filter to obtain the 100 mg/ml stock solution that was suitable for long-term storage at 37°C.

Preparation of the MKN-45 cell line

The GC cell line MKN-45 was obtained from the Shanghai Institute of Cellular Biology of Chinese Academy of Sciences (Shanghai, China) and was routinely cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (Hangzhou Sijiqing Bioengineering Material Co., Ltd., Hangzhou, Zhejiang, China), 100 U/ml penicillin and 100 mg/ml streptomycin (Biyuntian, Jiangsu, China) under the conditions of 5% CO2 at 4°C.

AO/EB staining to detect apoptosis

The cell concentrations were adjusted to 5×104 cells/ml, and cells were incubated on slides in 24-well plates for 24 h. For experimental use, the Trametes robiniophila stock solution was diluted to a final concentration of 5 or 10 mg/ml, with 0 mg/ml serving as control. AO/EB (4 µg; Amresco, LLC, Solon, OH, USA) was added to each well after 48 h. The apoptosis of the cell line was detected with a fluorescence microscope at 510 nm. Each treatment was represented by three replicates.

Flow cytometric analysis of apoptosis

Cells were cultured with Trametes robiniophila for 24, 48 and 72 h as aforementioned. Annexin V-fluorescein isothiocyanate (5 µl; Kaiji Bio Co., Nanjing, China) was added to different wells and incubated for 10 min at room temperature. The cells were resuspended with 1X binding buffer, and 5 µl propidium iodide (PI) was added. Next, the apoptosis of the cells was analyzed by flow cytometry. Each treatment was represented by three replicates.

RT-PCR

Total RNA was isolated from cells treated with Trametes robiniophila for 24 h using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) (16). RT-PCR was used to detect the gene expression level of matrix metalloproteinase (MMP)-2, MMP-9, B-cell lymphoma (Bcl)-2, Fas, caspase-3 and the reference gene β-actin. Primers and annealing temperature information is shown in Table I. The RNA was reversely transcribed into complementary DNA using an RT-PCR kit (Thermo Fisher Scientific, Inc.), and the final reaction mixture (20 µl) contained 4 µl of 5X reaction buffer, 1 µl RNase inhibitor, 1 µl oligo(dT)18 primer, 2 µl 10 mM deoxynucleotides, 1 µl Moloney-murine leukemia virus reverse transcriptase, 2 µl RNA template and 9 µl double distilled H2O. The thermal cycling parameters for the amplification were as follows: A denaturation step at 95°C for 3 min, followed by 30 cycles at 95°C for 15 sec, the annealing temperature indicated in Table I for 30 sec and 72°C for 45 sec. The RT-PCR products were semi-quantified with the UVP Gel Imaging System (UVP, Inc., Upland, CA, USA).

Table I.

Detailed information of primers.

Table I.

Detailed information of primers.

GeneSequence (5′-3′)Ta (°C)Length (bp)
Bcl-2Forward GCTGTCGCAGAGGGGCTAC55375
Reverse ATCCTCCCCCAGTTCACCC
FasForward CTGCCATAAGCCCTGTCCTC56316
Reverse GGTGTTGCTGGTGAGTGTGC
Caspase-3Forward CAAATGGACCTGTTGACCTGA56351
Reverse ATTCTGTTGCCACCTTTCGG
MMP-2Forward GATGCCGCCTTTAACTGG55278
Reverse TCAGCAGCCTAGCCAGTCG
MMP-9Forward CAGTACCGAGAGAAAGCCTATTTCTG54101
Reverse TAGGTCACGTAGCCCACTTGGT
β-actinForward GGGAAATCGTGCGTGACATT55183
Reverse GGAAGGAAGGCTGGAAGAGTG

[i] MMP, matrix metalloproteinase; Bcl, B-cell lymphoma; Ta, annealing temperature.

Western blot analysis

The cells and Trametes robiniophila were cultured as aforementioned. Total protein was extracted from the cells using a 400 µl single detergent lysis buffer (including phenylmethylsulfonyl fluoride) and radioimmunoprecipitation buffer (Sangon Biotech, Shanghai, China). The lysis mixture was then added to a homogenizer, and centrifuged at 13,500 × g and 4°C for 5 min. The supernatant was subpackaged into Eppendorf tube and stored at −20°C. The extracts were boiled with loading buffer for 5 min and then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% gels. Targeted proteins were transferred onto polyvinylidene difluoride membranes. The membranes were washed with Tris-buffered saline containing Tween 20 three times, for 20 min each time. Then, the membranes were incubated overnight with antibodies against Bcl-2 (catalog no. 15071), caspase-3 (catalog no. 9668) and Fas (catalog no. 8023) (all Cell Signaling Technology, Inc., Danvers, MA, USA) at 4°C. Following an additional three washes, anti-mouse immunoglobulin G, horseradish peroxidase-linked secondary antibodies (catalog no. 7076; 1:3,000 dilution; Cell Signaling Technology, Inc.) were added and incubated at room temperature for 1 h. Upon three final washes, the blots were developed using Beyo ECL Plus reagent (Beyotime Institute of Biotechnology, Haimen, China) and the results were detected in the UVP Gel Imaging System. β-actin was used as reference. The expression levels were calculated with Quantity One software (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Statistical analysis

All the data were expressed as the mean ± standard deviation. Differences between the groups were calculated using one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference. All statistical analyses were conducted using SPSS version 16.0 (SPSS, Inc., Chicago, IL, USA).

Results

Cell apoptosis is induced by Trametes robiniophila

Morphological changes in the human GC cell line MKN-45 following treatment with different concentrations of Trametes robiniophila (0, 5 and 10 mg/ml) for 24 h are shown in Fig. 1. Compared with the control group, the majority of the Trametes robiniophila-treated cancer cells became enlarged and irregular-shaped, and exhibited vacuolated changes in the cytoplasm. These morphological changes demonstrated cell damage subsequent to Trametes robiniophila treatment. MKN-45 cells treated with 5 mg/ml Trametes robiniophila were yellow-dyed, indicating the occurrence of apoptosis (Fig. 1).

Flow cytometry was used to detect intact cells, early apoptotic cells, late apoptotic cells and dead cells. Following treatment with Trametes robiniophila, the cell death rate [as indicated by the upper right (UR) quadrant, which represents the percentage of cells in advanced-stage apoptosis] and the early apoptosis rate [as indicated by the lower right (LR) quadrant, which represents the percentage of cells in prophase apoptosis] of the MKN-45 cell line increased in a time- and dose-dependent manner (Fig. 2). Apoptotic cells (as indicated by the sum of the UR and LR quadrants, which represents the percentage of cells in all apoptosis stages) of the MKN-45 cell line were significantly different from those of the control group after being exposed to Trametes robiniophila for 24, 48 and 72 h at drug concentrations of 5 and 10 mg/ml (all P<0.001) (Table II).

Table II.

Proportion of apoptotic cells in the MKN-45 cell line.

Table II.

Proportion of apoptotic cells in the MKN-45 cell line.

MKN-45

Apoptotic cells (%)24 h48 h72 h
Control   6.5   7.3   7.5
5 mg/ml14.6a18.3a50.2a
10 mg/ml18.0a24.5a58.0a

a P<0.05 vs. the control group.

Trametes robiniophila significantly influences the transcription of MMP-2, MMP-9, Bcl-2, Fas and caspase-3

The expression of MMP-2, MMP-9, Bcl-2, Fas and caspase-3 was significantly influenced by Trametes robiniophila. Analysis of the optical density value revealed that, for the MKN-45 cell line, the expression of MMP-2, MMP-9 and Bcl-2 was significantly downregulated (at 5 mg/ml and 10 mg/ml, all P<0.001 vs. control; at 10 mg/ml, P<0.001, P=0.003 and P=0.007 vs. 5 mg/ml for MMP-2, MMP-9 and Bcl-2, respectively), while the expression of Fas and caspase-3 was upregulated (at 5 mg/ml, P=0.326 and P=0.100 vs. control for Fas and caspase-3, respectively; at 10 mg/ml, P<0.001 and P=0.020 vs. control, and P=0.017 and P=0.028 vs. 5 mg/ml for Fas and caspase-3, respectively) (Table III). The regulation was dose-dependent.

Table III.

Expression changes in MMP-2, MMP-9, Bcl-2, Fas and caspase-3 genes induced by Trametes robiniophila in the MKN-45 cell line.

Table III.

Expression changes in MMP-2, MMP-9, Bcl-2, Fas and caspase-3 genes induced by Trametes robiniophila in the MKN-45 cell line.

MKN-45

GeneControl5 mg/ml10 mg/ml
MMP-20.64±0.02 0.49±0.01a 0.36±0.02a,b
MMP-90.71±0.01 0.54±0.02a 0.47±0.02a
Bcl-21.20±0.06 0.83±0.05a 0.64±0.05a,b
Fas0.67±0.06 0.83±0.06a 0.90±0.04a
Caspase-30.65±0.01 0.70±0.03a 0.99±0.08a,b

a P<0.05 vs. the control group

b P<0.05 vs. cells treated with 5 mg/ml Trametes robiniophila. MMP, matrix metalloproteinase; Bcl, B-cell lymphoma.

Trametes robiniophila significantly influences the protein expression of Bcl-2, Fas and caspase-3

The production of Fas and caspase-3 was enhanced following treatment with Trametes robiniophila in the MKN-45 cell line; however, the synthesis of Bcl-2 decreased. These results were consistent with the pattern of RT-PCR validation. The regulation was dose-dependent (Fig. 3).

Discussion

Generally, treatments for GC patients include surgery, radiotherapy and chemotherapy (17). Certain alternative treatments such as gene therapy and targeted therapy have also been proposed as optional treatment methods (18,19). However, these therapies are usually costly for the majority of patients and have limited curative effect and serious side effects (20). In the past years, TCM, which has been widely used in China for thousands of years, has shown an anticancer potential effect (21). TCM has been demonstrated to reduce toxic side effects, improve the quality of life of patients, enhance the immune function, and prevent recurrence and metastasis in cancer patients, with few side effects (22). In the current study, AO/EB staining, flow cytometry and RT-PCR were conducted to detect the effect of Trametes robiniophila on the apoptosis and metastasis of the human GC cell line MKN-45. The results indicated that Trametes robiniophila changed the morphology and number of regular MKN-45 cells in a time- and dose-dependent manner, suggesting cell damage due to treatment with Trametes robiniophila (Figs. 1 and 2, Table II). Our results also demonstrated that Trametes robiniophila acts as an inducer of the apoptotic process in GC cells by influencing the expression of Fas, caspase-3 and Bcl-2 (Figs. 2 and 3, Table III). However, the effect was significantly different between 5 and 10 mg/ml. Considering the potential toxic effect of high doses of Trametes robiniophila on normal cells, 5 mg/ml should be taken as a reference for future clinical application.

Generally, apoptosis can be classified into two types: Apoptotic process mediated by the mitochondrial pathway and apoptotic process mediated by a membrane receptor signaling pathway (23). Caspase-3 is one of the key apoptosis executors, since the majority of factors that trigger apoptosis ultimately lead to apoptosis through the caspase-3-mediated signaling pathway (24,25). Bcl-2, which is mainly distributed in the mitochondrial membrane and the cytoplasm, is an intracellular anti-apoptotic factor that can stabilize the mitochondrial membrane, prevent mitochondrial caspase release and inhibit the oxygen free radical-induced apoptosis signaling pathway (26). Fas can initiate the apoptotic process mediated by a membrane receptor by binding to Fas ligand, and can also recruit caspase-3 to induce apoptosis (2730). Treatment with Trametes robiniophila suppressed Bcl-2 expression and increased caspase-3 expression, which suggested a mitochondrial-mediated apoptosis. Additionally, the expression of Fas was also upregulated, indicating activation of the death receptor pathway of apoptosis. The results in the present study demonstrated that Trametes robiniophila could induce the apoptosis of GC cells by different mechanisms, whereas previously, only apoptosis induced by Trametes robiniophila via the mitochondrial pathway was reported (11).

The apoptosis observed in the present study was associated with downregulation of the expression of MMP-2 and MMP-9. Members of the MMP family are an integral part of the extracellular matrix's enzymatic arsenal and have been regarded as major critical molecules that assist tumor cells during metastasis (31). The expression of various MMPs has been observed to be upregulated in almost every type of human cancer, and correlates with advanced stage, invasive and metastatic properties, and, in general, with poor prognosis (32). Upon treatment with Trametes robiniophila, the expression of MMP-2 and MMP-9 was suppressed. The effect was dose dependent. Ji and Mai have revealed that the expression level of MMP-2 and MMP-9 was positively correlated with the metastatic ability of GC cells (33). In addition, a previous study has reported the inhibition of metastasis of lung cancer via the suppression of MMP-2 and MMP-9 (22). Therefore, Trametes robiniophila has the potential to regulate MMPs and can be considered a promising target for the therapeutic intervention in human cancer. Similarly to the majority of TCMs, Trametes robiniophila also has the advantage of few side effects and low cost compared with surgery, radiotherapy and chemotherapy (34).

Based on the present study, treatment with Trametes robiniophila could markedly induce the apoptosis of the human GC cell line MKN-45. The effect acted through both the mitochondrial and the member receptor signaling pathways. In addition, Trametes robiniophila could also suppress the metastatic ability of GC cells via downregulating the expression of MMP-2 and MMP-9. In conclusion, we recommend that Trametes robiniophila is taken into consideration as a noninvasive therapy of GC in future clinical treatment.

References

1 

Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 55:74–108. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Jemal A, Siegel R, Xu J and Ward E: Cancer statistics, 2010. CA Cancer J Clin. 60:277–300. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Shahrokh I: Gastric cancer as a multifactorial disease. Ann Mil Health Sci Res. 11:157–164. 2013.

4 

Cunningham D, Allum WH, Stenning SP, Thompson JN, Van de Velde CJ, Nicolson M, Scarffe JH, Lofts FJ, Falk SJ, Iveson TJ, et al: MAGIC Trial Participants: Perioperative Chemotherapy versus surgery alone for resectable gastroesophageal cancer. New Engl J Med. 355:11–20. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Bang YJ, Kim YW, Yang HK, Chung HC, Park YK, Lee KH, Lee KW, Kim YH, Noh SI, Cho JY, et al: CLASSIC trial investigators: Adjuvant capecitabine and oxaliplatin for gastric cancer after D2 gastrectomy (CLASSIC): A phase 3 open-label, randomised controlled trial. Lancet. 379:315–321. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Monsuez JJ, Charniot JC, Vignat N and Artigou JY: Cardiac side-effects of cancer chemotherapy. Int J Cardiol. 144:3–15. 2010. View Article : Google Scholar : PubMed/NCBI

7 

D'Angelica M, Gonen M, Brennan MF, Turnbull AD, Bains M and Karpeh MS: Patterns of initial recurrence in completely resected gastric adenocarcinoma. Ann Surg. 240:808–816. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Sagar SM, Yance D and Wong R: Natural health products that inhibit angiogenesis: A potential source for investigational new agents to treat cancer-Part 1. Current Oncol. 13:14–26. 2006.

9 

Bhat TA and Singh RP: Tumor angiogenesis-a potential target in cancer chemoprevention. Food Chem. Toxicol. 46:1334–1345. 2008.

10 

Wu T, Chen W, Liu S, Lu H, Wang H, Kong D, Huang X, Kong Q, Ning Y and Lu Z: Huaier suppresses proliferation and induces apoptosis in human pulmonary cancer cells via upregulation of miR-26b-5p. FEBS Lett. 588:2107–2114. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Zhang F, Zhang Z and Liu Z: Effects of Huaier aqueous extract on proliferation and apoptosis in the melanoma cell line A875. Acta Histochem. 115:705–711. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Zhang T, Wang K, Zhang J, Wang X, Chen Z, Ni C, Qiu F and Huang J: Huaier aqueous extract inhibits colorectal cancer stem cell growth partially via downregulation of the Wnt/β-catenin pathway. Oncol Lett. 5:1171–1176. 2013.PubMed/NCBI

13 

Guo Y, Cheng P and Chen Y: Isolation and analysis of the polysaccharide of Huaier mycelium. Zhong Guo Sheng Hua Yao Wu Za Zhi. 63:56–59. 1993.(In Chinese).

14 

Guo Y, Cheng P and Chen Y: Studies on the constituents of polysaccharide from the hyphae of Trametes robiniophila (II)-identification of polysaccharide from the hyphae of Trametes robiniophila and determination of its molar ratio. Journal of China Pharmaceutical University. 23:155–157. 1992.

15 

Zhang F, Zhang ZY and Liu Z: Effects of Huaier aqueous extract on proliferation and apoptosis in the melanoma cell line A875. Acta Histochemica. 115:705–711. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Zhu J, Li X, Kong X, Moran MS, Su P, Haffty BG and Yang Q: Testin is a tumor suppressor and prognostic marker in breast cancer. Cancer Sci. 103:2092–2101. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Hartgrink HH, Jansen EP, van Grieken NC and van de Velde CJ: Gastric cancer. Lancet. 374:477–490. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Wu Y, Wang W, Chen Y, Huang K, Shuai X, Chen Q, Li X and Lian G: The investigation of polymer-siRNA nanoparticle for gene therapy of gastric cancer in vitro. Int J Nanomedicine. 5:129–136. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Wang TT, Qian XP and Liu BR: Survivin: Potential role in diagnosis, prognosis and targeted therapy of gastric cancer. World J Gastroenterol. 13:2784–2790. 2007.PubMed/NCBI

20 

Li HW, Yang JK and Zhao AG: Adjuvant therapy for gastric cancer. Shijie Huaren Xiaohua Zazhi. 22:4921–4927. 2014.(In Chinese).

21 

Song X, Li Y, Zhang H and Yang Q: The anticancer effect of Huaier (Review). Oncol Rep. 34:12–21. 2015.PubMed/NCBI

22 

Hu B, Du Q, Shen K and Xu L: Principles and scientific basis of traditional Chinese medicine in cancer treatment. J Bioanal Biomed. S6:22012.

23 

Salahudeen AK, Huang H, Joshi M, Moore NA and Jenkins JK: Involvement of the mitochondrial pathway in cold storage and rewarming-associated apoptosis of human renal proximal tubular cells. Am J Transplant. 3:273–280. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Rao RV, Hermel E, CastroObregon S, del Rio G, Ellerby LM, Ellerby HM and Bredesen DE: Coupling endoplasmic reticulum stress to the cell death program mechanism of caspase activation. J Biol Chem. 276:33869–33874. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Jin L, Amatya VJ, Takeshima Y, Shrestha L, Kushitani K and Inai K: Evaluation of apoptosis and immunohistochemical expression of the apoptosis-related proteins in mesothelioma. Hiroshima J Med Sci. 59:27–33. 2010.PubMed/NCBI

26 

Bagci E, Vodovotz Y, Billiar T, Ermentrout G and Bahar I: Bistability in apoptosis: Roles of bax, bcl-2 and mitochondrial permeability transition pores. Biophys J. 90:1546–1559. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Hu D, Wang S and Feng Y: Expression of matrix metalloproteinase-7 and Fas and their significances in gastric carcinoma. Shi Jie Hua Ren Xiao Hua Za Zhi. 14:32372006.(In Chinese).

28 

Morimoto Y, Hizuta A, Ding EX, Ishii T, Hongo T, Fujiwara T, Iwagaki H and Tanaka N: Functional expression of Fas and Fas ligand on human intestinal intraepithelial lymphocytes. Clin Exp Immunol. 116:84–89. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Wang L, Wang YR and Yang J: Significance of integrin β_3 expression in human hemangioma (J). Chinese Journal of Aesthetic Medicine. 5:0312009.

30 

Cai CF, Feng L, Wang L, Kong QZ and Zhao YF: Tetrazolium violet induces apoptosis via caspases-8, −9 activation and Fas/FasL up-regulation in Rat C6 glioma cells. Arch Pharm Res. 32:575–581. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Rucci N, Sanità P and Angelucci A: Roles of metalloproteases in metastatic niche. Curr Mol Med. 11:609–622. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Hesek D, Toth M, Meroueh SO, Brown S, Zhao H, Sakr W, Fridman R and Mobashery S: Design and characterization of a metalloproteinase inhibitor-tethered resin for the detection of active MMPs in biological samples. Chem Biol. 13:379–386. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Ji DL and Mai DH: Effect of huaier granule on immunity and quality of life in patients with gastric cancer undergoing postoperative concurrent radiochemotherapy. Zhong Guo Zhong Liu. 19:e62010.(In Chinese).

34 

Song XY, YingDong LI, Shi YP, Jin L and Chen J: Quality control of traditional Chinese medicines: A review. Chin J Nat Med. 11:596–607. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

February-2017
Volume 13 Issue 2

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ji X, Pan C, Li X, Gao Y, Xia L, Quan X, Lv J and Wang R: Trametes robiniophila may induce apoptosis and inhibit MMPs expression in the human gastric carcinoma cell line MKN‑45. Oncol Lett 13: 841-846, 2017
APA
Ji, X., Pan, C., Li, X., Gao, Y., Xia, L., Quan, X. ... Wang, R. (2017). Trametes robiniophila may induce apoptosis and inhibit MMPs expression in the human gastric carcinoma cell line MKN‑45. Oncology Letters, 13, 841-846. https://doi.org/10.3892/ol.2016.5517
MLA
Ji, X., Pan, C., Li, X., Gao, Y., Xia, L., Quan, X., Lv, J., Wang, R."Trametes robiniophila may induce apoptosis and inhibit MMPs expression in the human gastric carcinoma cell line MKN‑45". Oncology Letters 13.2 (2017): 841-846.
Chicago
Ji, X., Pan, C., Li, X., Gao, Y., Xia, L., Quan, X., Lv, J., Wang, R."Trametes robiniophila may induce apoptosis and inhibit MMPs expression in the human gastric carcinoma cell line MKN‑45". Oncology Letters 13, no. 2 (2017): 841-846. https://doi.org/10.3892/ol.2016.5517