Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma

  • Authors:
    • Hong Cui
    • Tie‑Ling Li
    • Hai‑Feng Guo
    • Jia‑Liang Wang
    • Ping Xue
    • Ying Zhang
    • Jing‑Hui Fan
    • Zhi‑Ping Li
    • Yue‑Juan Gao
  • View Affiliations / Copyright

    Affiliations: Department of Pharmacy, The Red Flag Hospital of Mudanjiang Medical College, Mudanjiang, Heilongjiang 157011, P.R. China, Department of Pathology, Mudanjiang Medical College, Mudanjiang, Heilongjiang 157011, P.R. China, Department of General Surgery, The Red Flag Hospital of Mudanjiang Medical College, Mudanjiang, Heilongjiang 157011, P.R. China, Department of Respiration, The Red Flag Hospital of Mudanjiang Medical College, Mudanjiang, Heilongjiang 157011, P.R. China, Department of Pharmacy, Mudanjiang Medical College, Mudanjiang, Heilongjiang 157011, P.R. China
    Copyright: © Cui et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 885-892
    |
    Published online on: November 15, 2017
       https://doi.org/10.3892/ol.2017.7425
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

A novel module‑search algorithm method was used to screen for potential signatures and investigate the molecular mechanisms of inhibiting hepatocellular carcinoma (HCC) growth following treatment with silymarin (SM). The modules algorithm was used to identify the modules via three major steps: i) Seed gene selection; ii) module search by seed expansion and entropy minimization; and iii) module refinement. The statistical significance of modules was computed to select the differential modules (DMs), followed by the identification of core modules using the attract method. Pathway analysis for core modules was implemented to identify the biological functions associated with the disease. Subsequently, results were verified in an independent sample set using reverse transcription polymerase chain reaction (RT‑PCR). In total, 18 seed genes and 12 DMs (modules 1‑12) were identified. The core modules were isolated using gene expression data. Overall, there were 4 core modules (modules 11, 5, 6 and 12). Additionally, DNA topoisomerase 2‑binding protein 1 (TOPBP1), non‑structural maintenance of chromosomes condensing I complex subunit H, nucleolar and spindle associated protein 1 (NUSAP1) and cell division cycle associated 3 (CDCA3) were the initial seed genes of module 11, 5, 6 and 12, respectively. Pathway results revealed that cell cycle signaling pathway was enriched by all core modules simultaneously. RT‑PCR results indicated that the level of CDCA3, TOPBP1 and NUSAP1 in SM‑treated HCC samples was markedly decreased compared with that in non‑SM‑treated HCC. No statistically significant difference between the transcriptional levels of CDCA3 in SM‑treated and non‑treated HCC groups was identified, although CDCA3 expression was increased in the treated group compared with the untreated group. Furthermore, although the expression level of TOPBP1 and NUSAP1 in the SM‑treated group was decreased compared with that in the normal group, no significant difference was observed. From the results of the present study it can be inferred that TOPBP1, NUSAP1 and CDCA3 of the core modules may serve notable functions in SM‑associated growth suppression of HCC.

Introduction

Currently, hepatocellular carcinoma (HCC) is the sixth most prevalent malignancy (1) and the second leading cause of cancer-associated mortality worldwide (2). Notably, ~50% of new cases globally were in China in 2012 (3). Despite evidence that the utilization of chemotherapeutic drugs has improved the clinical outcome of patients with HCC (4,5), the effects have been limited owing to drug resistance and toxicity. Thus, investigation of novel non-toxic therapeutic drugs with the ability to prevent HCC growth is urgently required.

Milk thistle extract is non-toxic and has been applied to protect against liver damage in clinical settings, as well as experimental models, for >2,000 years (6). Silymarin (SM), a complex mixture of flavonoids, is extracted from the seeds of the milk thistle (Silybum marianum). Notably, SM has been used as a complementary and alternative treatment for patients with cancer (7,8). Nevertheless, the molecular mechanisms of anti-HCC-associated effects of SM remain poorly understood.

Network biology has been demonstrated to be a powerful tool for analyzing complex molecular networks that exert important functions in the development and progression of disease (9,10). Previously, studies have applied dynamic changes in molecular networks to predict disease outcomes (11,12). Since transcriptome information is the most abundant form of omics data, co-expression networks have been employed in the majority of studies (13–15). However, a limitation of these previous studies was that networks were built using only co-expression data; this decreases the statistical power to screen pathways that are abnormal in diseased conditions (16). Selecting groups of genes that demonstrate coherent differential activities between healthy and diseased conditions is a more powerful approach. These gene groups directly capture the affected pathways. Thus, it is useful to identify coherent differentially expressed gene modules with common members, yet varied connectivity in differential co-expression networks (DCNs) (11).

The present study utilized a novel module-search algorithm method to screen for potential signatures and to investigate the molecular mechanisms underlying anti-HCC associated effects following SM treatment. First, gene expression data from SM-treated HCC and control samples, generated by Lovelace et al (17), were downloaded from the European Molecular Biology Laboratory-European Bioinformatics Institute (EMBL-EBI) database (www.ebi.ac.uk). Subsequently, the construction of DCN was implemented if two connected genes exhibited associated expression patterns across conditions and if the expression levels of these two genes were markedly different between the SM-treated HCC and control condition. Following that, the DCN was analyzed to identify modules through three major steps: i) Seed gene selection; ii) module search by seed expansion and entropy minimization; and iii) module refinement. The statistical significance of modules was then computed to select the differential modules (DMs); core modules were detected using the attract method (18), followed by pathway enrichment analysis for core modules. Finally, validation tests were implemented to verify the results. The present study aimed to contribute to the understanding of potential action mechanisms associated with SM inhibition of HCC growth.

Materials and methods

Microarray data

The gene expression profile dataset E-GEOD-50994, generated by Lovelace et al (17), was downloaded from the EMBL-EBI database (www.ebi.ac.uk/), based on the A-AFFY-141 platform of the Affymetrix Human Gene 1.0 ST Array (HuGene-1_0-st). Gene expression data of E-GEOD-50994, containing 10 human SM-treated HCC samples and 14 human dimethyl sulfoxide-treated HCC control group samples, were obtained and the probes were mapped to the gene symbols. A total of 12,227 genes were identified.

Protein-protein interaction network (PPIN)

The PPIN ensemble (the network constructed by all PPI interactions) containing 787,896 interactions and 16,730 genes was obtained from the String database (string.embl.de; accessed June, 2016). Subsequently, the 12,227 genes identified from the aforementioned microarray data were mapped to the PPIN and a novel PPIN was created.

DCN construction

DCN construction comprised two steps. First, a binary co-expression network was constructed prior to assignment of edge weight based on differential gene expression between the SM-treated-HCC and control groups. To construct the binary gene co-expression network, edges were selected according to the absolute value of the Pearson's correlation coefficient (PCC) of the expression profiles of two genes. Briefly, after obtaining gene expression values between the SM-treated-HCC and control groups, the PCC of the interactions of a novel PPIN in different conditions were computed (SM-treated HCC and control samples), determined as A1 and A2. Similarly, the absolute value of the difference of PCC between two groups, marked as δ-values, was also computed. In an attempt to eliminate indirect correlation due to a third gene, the utilization of the first order partial PCC was implemented, as previously described (19). Only edges with correlations greater than the pre-defined threshold δ-values were chosen. In the current study, the δ-value was set at 0.9, such that the maximal number of genes was connected in the DCN to be constructed.

Subsequently, edge weights were assigned in the binary co-expression network based on the P-value of differential gene expression in SM-treated HCC and control conditions. In the present study, a one-sided Student's t-test was applied to identify differential gene expression for microarray data. The weight wi, j on edge (i, j) in the DCN was defined as follows:

wi,j={(logpi+logpj)1/2(2*0,max1∈V|logP1|)1/2,ifcor(i,j)≥δ,ifcor(i,j)<δ,

where pi and pj were respective P-values of differential expression for genei and genej. V denoted the number of nodes in the DCN, and cor(i,j) represented the absolute value of PCC between genei and genej based on their expression profiles. Under the weighting scheme, genes that were co-expressed and demonstrated marked differential expression were assigned higher weights.

Identification of modules in DCN

Module search is used to screen gene modules with common members but varied connectivity across multiple molecular interaction networks (11). The identification of modules comprises three stages: i) Seed prioritization; ii) module identification by seed expansion; and iii) entropy minimization and refinement of candidate modules.

Seed prioritization

Seed prioritization sorted genes in the DCN using the topological measurement (degree) analysis. In brief, for DCN, Gk=(V, Ek) (1≤k≤M) with an adjacency matrix Ak=(aijk)nxn, a function was constructed to compute the importance of vertex i as follows: g(i)=∑j∈nk(i) A'ijkg(j), where Gk refers to DCN, aijk denoted the weight on the edge(i,j), wi,j, in network Gk, V refers to the count of nodes in the DCN Gk, g(i) stands for the importance of vertex i in the DCN, Nk(i) was the set of neighbors of gene i in Gk; Akrepresented the degree normalized weighted adjacency matrix that was calculated as A'k=D−1/2 Ak D1/2 where D was the diagonal matrix.

For each gene, DCN rank was acquired, marked as g=[g(1), …, g(M)], then a z-score was computed for each rank g(l). Subsequently, the rank was obtained for that gene in the DCN by averaging the z-scores. The top 1% of genes was extracted as the seed genes.

Module search

Module search repeatedly included genes whose addition caused the maximum decrease in the graph entropy-based objective function until there was no decrease in the objective function. For a given seed gene v ε V, V was treated as a module C={v}. For each vertex, u, in its neighborhood in the DCN, N(v) was defined as N(v)=UiNi(v), where Ni(v) was the neighbor set in Gi as the candidate for module C. For each u ε N(v), the entropy decrease was computed between the novel module C'=CU{v} and C, that was to say, ΔH (C', C)=H(C)-H(C'). If ΔH (C', C) was >0; this meant the addition of vertex u improved the connectivity of the module C. The vertex u whose addition maximizes ΔH was added to module C. If there were more than one vertex contained at each stage, one was randomly selected. The expansion stage stopped when no additional vertex could further decrease the entropy of the evolving module.

Refinement of candidate modules

In the refinement stage, the modules with node sizes <5 were removed. Jaccard index (11), the ratio of intersection over union for two sets, was utilized to merge the overlapping modules. In the present study, a Jaccard index not <0.5 was used.

Statistical significance of modules

The statistical significance of modules was computed on the basis of the null score distribution of modules produced by randomized networks. In the present study, the networks with the same size of interactions in DCN that were extracted from the novel PPIN were determined as randomized networks. Each network was completely randomized 100 times through degree-preserved edge shuffling. In an attempt to obtain the null distribution of module scores, a module search was performed on the randomized networks. Next, the empirical P-value of a module was computed as the probability of the module having a smaller score by chance based on the following formula: P=∑(count (HR)> count (HDCN))/count (HR), Where the count (HR) was the number of modules generated by randomized networks, count (HDCN) denoted the number of modules produced by DCN.

After obtaining P-values, the false discovery rate (FDR) was used to adjust the P-values, which was computed using the Benjamini & Hochberg method (20). In the present study, FDR≤0.05 was regarded as significant. To select activated core modules whose expression distinguished control and SM-treated HCC samples, the attract method (18) was used. Modules with a FDR≤0.05 were considered as core modules.

Pathway enrichment analysis for genes of core modules

Kyoto Encyclopedia of Genes and Genomes (KEGG) is a reference knowledge database for comprehending biological processes through pathway aligning to map genes to reference pathways to deduce cell behaviors (21). In the present study, to understand the biological functions of core modules further, the Database for Annotation, Visualization and Integrated Discovery (DAVID; https://david.ncifcrf.gov/home.jsp) (22) was utilized to perform pathway enrichment analysis for the genes in core modules to identify significant pathways. Significant pathways were extracted when the FDR was set as 0.01.

Validation test of effects of SM on key genes
Patient subjects

In total, 40 patients with HCC and 20 healthy volunteers were enrolled in the present study. Among these 40 patients, 20 subjects were treated with SM, whereas the remaining 20 cases were not. Furthermore, 20 healthy volunteers were included as the normal control group. No significant differences were observed in sex, age, case history or regional distribution. Among these 40 patients, there were 23 females and 17 males. The average age was 48.34±5.14 years (range, 42–56 years). All participates were recruited between May 2014 and May 2015 in The Red Flag Hospital (Mudanjiang, China). The experimental protocol was approved by the Human Research Ethics Committee and the Confidentiality of Health Information Committee of The Red Flag Hospital. Written informed consent was obtained from all participants. HCC tissues were obtained from the SM-treated and untreated HCC groups, and liver tissues was obtained from the normal control samples to conduct the subsequent experiments.

RT-PCR analysis

A TRIzol RNA extraction kit (cat. no. 15596-026; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) to extract total RNA from the HCC tissues. Next, SuperScript II RNase H reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.) was used to synthesize cDNA. The cDNAs were sub-packaged and stored at −20°C. Subsequently, synthesized cDNAs were utilized as templates for PCR amplification and β-actin was used as an internal control gene to check the consistency of RT. The sequences of primers of selected genes for PCR amplification are listed in Table I. PCR amplification was conducted by means of the following experimental protocol: 10 µl 10X PCR buffer (Eurogentec Ltd., Seraign, Belgium), 1 µl TaqDNA polymerase (Eurogentec Ltd.; 5 U/µl), 3 µl upstream primers, 3 µl downstream primers and 8 µl dNTPs. Table II presented the amplification thermocycling conditions. PCR products were run on a 1.5% agarose gel at 100 mV for 30 min, stained with ethidium bromide (5 µl/100 ml), visualized using a UV transilluminator, and analyzed using Quantity One software (v.4.2, Bio-Rad Laboratories, Hercules, CA, USA). The experiment was repeated three times and plotted as the mean ± standard deviation.

Table I.

Sequence of primers of the selected genes.

Table I.

Sequence of primers of the selected genes.

GenePrimer sequence, 5′-3′
TOPBP1
  Forward GAACTTGCCCCCTAGTGGTGAACTCTTACT
  Reverse ATCACGGAAGCCACGTCCTCTCGGCGTCAA
CDCA3
  Forward GAATTCGGTTGAGATGGGCTCAGCCAA
  Reverse TCTAGAGCCCTGGGTGACTGCATTGCT
NUSAP1
  Forward AAACTTACAAACAACCCCATCTCC
  Reverse GTTTCTTCGGTTGCTCTTCCTTT
β-actin
  Forward CTCCATCCTGGCCTCGCTGT
  Reverse GCTGTCACCTTCACCGTTCC

[i] TOPBP1, DNA topoisomerase 2-binding protein 1; CDCA3, cell division cycle associated 3; NUSAP1, nucleolar and spindle associated protein 1.

Table II.

Polymerase chain reaction amplification conditions.

Table II.

Polymerase chain reaction amplification conditions.

GeneResponse conditions
TOPBP1Pre-degeneration at 95°C for 2 min, degeneration at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec for 40 cycles and extension at 72°C for 10 min.
CDCA3Pre-degeneration at 95°C for 2 min, degeneration at 94°C for 1 min, annealing at 62°C for 30 sec, extension at 68°C for 1 min for 45 cycles and extension at 72°C for 7 min.
NUSAP1Pre-degeneration at 95°C for 5 min, degeneration at 95°C for 20 sec, annealing at 56°C for 30 sec, extension at 72°C for 30 sec for 40 cycles and extension at 72°C for 7 min.
β-actinPre-degeneration at 94°C for 3 min, degeneration at 94°C for 60 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec for 40 cycles and extension at 72°C for 7 min.

[i] TOPBP1, DNA topoisomerase 2-binding protein 1; CDCA3, cell division cycle associated 3; NUSAP1, nucleolar and spindle associated protein 1.

Statistical analysis

Feature Extraction software (version 10.7; Agilent Technologies, Inc., Santa Clara, CA, USA) was used to analyze the statistical significance of the microarray results. The original data were normalized based on the Quantile Normalization Algorithm (Agilent Technologies, Inc.). Quantile normalization was conducted using function ‘normalize.quantiles’ from an R package (23). PCC was used to calculate the edge weight. One-sided Student's t-test was applied to identify differential gene expression for microarray data between two groups. One-way analysis of variance, followed by Student-Newman-Keuls post hoc test, was used to assess the changes of the key genes in verification test across more than two conditions. The FDR was calculated to correct the raw P-values. The threshold value applied to designate core module was FDR≤0.05, and the cut-off criteria for significant pathways was FDR<0.01. P<0.05 was considered to indicate a statistically significant difference. In the present study, SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis.

Results

Overview of the module-search algorithm for screening shared co-expression modules in DCN

In an attempt to measure the dynamics of pathway connectivity, a novel method, module-search algorithm, was utilized to identify shared sub-networks in the DCN. These sub-networks were modules that comprised the same set of genes yet potentially different connectivity among the gene members. By means of this algorithm, the dynamic changes in module connectivity were quantified. Coupled with network topological measurements, the prior probabilities were utilized to sort and select seed genes. Module identification problems were transformed into minimum entropy problems by adding a graph-entropy-based objective function to the modules. Empirical P-values of candidate modules were determined through randomized networks.

Construction of DCN

The genes from the microarray data were aligned to the ensemble PPIN, a novel PPIN including 10,859 genes and 351,047 interactions was obtained. To construct a gene co-expression network, edges were selected according to the absolute value of PCC of the expression profiles of two genes. With δ>0.9, a total of 3,395 edges and 1,876 nodes were selected to construct the DCN.

Identification of modules in DCN

On the basis of the z-score distribution of 1,876 nodes in DCN, 18 genes possessed a top 1% z-score value and were selectively termed as seed genes (Table III). Among these 18 seed genes, the z-score values of 4 genes were >270, for example: Geminin, DNA replication inhibitor (z-score, 329.58); non-SMC condensin I complex, subunit G (z-score, 290.38); kinesin family member 11 (z-score, 284.85); and cyclin B1 (z-score, 272.13). Subsequently, a module search was performed by taking the 18 seed genes as initial genes, according to entropy decrease, to identify candidate modules. Following the removal of modules with <5 nodes, the modules were merged based on a Jaccard index ≥0.5, and 12 modules (modules 1–12) were identified.

Table III.

Seed genes and the distribution of z-scores.

Table III.

Seed genes and the distribution of z-scores.

RowGeneZ-score
  1GMNN329.58
  2NCAPG290.38
  3KIF11284.85
  4CCNB1272.13
  5NCAPH234.93
  6NUSAP1227.92
  7DLGAP5226.55
  8ECT2214.57
  9NUP107208.83
10NDC80201.93
11ANLN201.44
12KIF20A189.95
13TOPBP1187.53
14GINS1182.10
15CDCA3180.81
16 ARHGAP11A169.74
17ASPM167.06
18KIF2C166.63
Identification of DMs

On the basis of the FDR distribution, it was revealed that the FDR values of the aforementioned 12 modules were <0.05, indicating significance. Using gene expression data from SM-treated-HCC and control samples, the core modules whose differential expression distinguished between the treated and control samples were isolated using the attract method. On the basis of the criteria, 4 core modules were observed including module 11 (FDR, 6.96×10−5), module 5 (FDR, 1.01×10−3), module 6 (FDR, 1.13×10−2) and module 12 (FDR, 1.13×10−2), as presented in Table IV. Among these, there were 73 nodes and 420 edges in module 11 (Fig. 1). Furthermore, out of the 73 nodes, 16 genes were seed genes and the initial gene was DNA topoisomerase 2-binding protein 1 (TOPBP1). As presented in Fig. 2, there were 74 nodes and 553 edges in module 5, involving 18 seed genes. Notably, the initial seed gene was non-SMC condensing I complex, subunit H (NCAPH). Fig. 3 demonstrates that there were 86 nodes and 634 edges in module 6, which was also involved in 18 seed genes. In addition, nucleolar and spindle-associated protein 1 (NUSAP1) was the initial seed gene. As presented in Fig. 4, module 12 comprised 46 nodes and 315 edges; furthermore, there were 16 seed genes and cell division cycle associated 3 (CDCA3) was the initial seed gene.

Figure 1.

Differential module 11 identified in the differential co-expression network between human hepatocellular carcinoma treated with silymarin and control samples, which included 73 nodes and 420 edges. Pink node, initial seed gene; yellow nodes, seed genes; green nodes, genes interacted with seed genes.

Figure 2.

Differential module 5 identified in the differential co-expression network between human hepatocellular carcinoma treated with silymarin and control samples, which included 74 nodes and 553 edges. Pink node, initial seed gene; yellow nodes, seed genes; green nodes, genes interacted with seed genes.

Figure 3.

Differential module 6 identified in the differential co-expression network between human hepatocellular carcinoma treated with silymarin and control samples, which included 86 nodes and 634 edges Pink node, initial seed gene; yellow nodes, seed genes; green nodes, genes interacted with seed genes.

Figure 4.

Differential module 12 identified in the differential co-expression network between human hepatocellular carcinoma treated with silymarin and control samples, which included 46 nodes and 315 edges. Pink node, initial seed gene; yellow nodes, seed genes; green nodes, genes interacted with seed genes.

Table IV.

Core modules and initial seed genes.

Table IV.

Core modules and initial seed genes.

ModuleFDRInitial seed genes
11 6.96×10−5TOPBP1
  51.01×10-3NCAPH
  6 1.13×10−2NUSAP1
121.13×10-2CDCA3

[i] TOPBP1, DNA topoisomerase 2-binding protein 1; CDCA3, cell division cycle associated 3; NUSAP1, nucleolar and spindle associated protein 1; NCAPH, non-SMC condensing I complex, subunit H; FDR, false discovery rate.

Pathway enrichment analysis for genes in the core modules

Using DAVID and KEGG, pathway enrichment analysis of genes in the core modules was conducted. When the threshold criteria of FDR<0.05 was applied, two pathways for module 12 were identified (cell cycle and progesterone-mediated oocyte maturation). Module 11 was primarily enriched in two biological process terms; cell cycle and RNA transport. Module 5 was only involved in one pathway (cell cycle). Module 6 was involved in two pathways, including cell cycle and RNA transport. Notably, the cell cycle pathway was simultaneously enriched by all core modules. Specific information is presented in Table V.

Table V.

Significant pathways for core modules based on FDR<0.05.

Table V.

Significant pathways for core modules based on FDR<0.05.

ModuleCategoryTermFDR
11KEGG_PATHWAYCell cycle 1.56×10−4
RNA transport4.63×10-2
  5KEGG_PATHWAYCell cycle 4.02×10−4
  6KEGG_PATHWAYCell cycle3.95×10-2
RNA transport 2.66×10−2
12KEGG_PATHWAYCell cycle4.57×10-4
Progesterone-mediated oocyte maturation 2.54×10−3

[i] FDR, false discovery rate; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Validation test

In the present study, PCR was employed to verify the mRNA expression levels of key genes (TOPBP1, CDCA3 and NUSAP1) identified from bioinformatic analysis. The relative expression level of these genes examined by PCR is presented in Fig. 5. The expression level of TOPBP1, CDCA3 and NUSAP1 were significantly increased in the non-treated HCC group compared with that in normal group (P<0.05). Furthermore, following SM treatment in HCC samples, the expression levels of CDCA3 (P<0.05), TOPBP1 (P<0.001) and NUSAP1 (P<0.001) were significantly decreased compared with untreated HCC. Furthermore, although the expression level of TOPBP1 and NUSAP1 in SM-treated HCC group was decreased compared to that in normal group, no statistical difference was observed (P>0.05). In addition, there was no difference in the expression level of CDCA3 between the normal and SM-treated HCC group (P>0.05), despite CDCA3 being increased in the SM-treated HCC group compared with that in normal.

Figure 5.

The expression of (A) CDCA3, (B) TOPBP1 and (C) NUSAP1 in normal liver cells, untreated HCC cells and SM-treated HCC cells were investigated using polymerase chain reaction. *P<0.05, **P<0.001 vs. HCC group. HCC, hepatocellular carcinoma; SM, silymarin; CDCA3, cell division cycle associated 3; TOPBP1, DNA topoisomerase 2-binding protein 1; NUSAP1, nucleolar and spindle associated protein 1.

Discussion

The utilization of SM has previously been recommended for the treatment of liver conditions, including toxin-induced liver damage, and as a supportive treatment for chronic inflammatory liver conditions (24). Nevertheless, the underlying molecular mechanisms of SM on HCC remain not fully understood. In the present study, novel gene modules for investigating the mechanisms of anti-HCC effects of SM were analyzed using the module-search algorithm. The results of the present study demonstrated that a total of 12 DMs were selected. Among these DMs, modules 11, 5, 6 and 12 were core modules with initial seed genes TOPBP1, NCAPH, NUSAP1 and CDCA3, respectively. Notably, it was revealed that the cell cycle pathway was simultaneously enriched by all core modules. Furthermore, the expression verification of TOPBP1, NUSAP1 and CDCA3 using RT-PCR identified that SM was able to inhibit the progression of HCC by decreasing the expression of these key genes.

TOPBP1, which interacts with topoisomerase IIβ, has been demonstrated to be necessary for mitotic progression (25). Evidence has demonstrated that TOPBP1 co-localizes with breast cancer type 1 susceptibility protein at dysregulated replication forks and exerts important functions in the DNA damage response and DNA replication (26). Generally, DNA damage response disrupts the cell cycle by triggering checkpoint mechanisms; the inability to control a normal DNA damage response results in genomic instability is a hallmark of the majority of different types of cancer (27,28). Notably, a previous study demonstrated that SM is able to decrease DNA damage in skin cancer (29). In light of these aforementioned studies, it may be inferred that the inhibitory effect of SM on HCC development, by regulating TOPBP1, highlights the potential use of SM in controlling the DNA damage response in HCC.

NUSAP1, a significant mitotic regulator, is crucial for numerous cellular events during mitosis including spindle assembly and cytokinesis (30). Furthermore, the deregulation of mitosis is a common characterization of the majority of different types of cancer (31,32). In previous studies, NUSAP1 has been demonstrated to be upregulated in several malignant types of cancer, including breast cancer (33) and HCC (34). Notably, deletion of NUSAP1 has been revealed to arrest the cell cycle in G2-M phase (30). A previous study demonstrated that SM treatment markedly reduced the formation of the mitotic spindle in fumonisin B1-induced hepatotoxicity (35). Therefore, it was speculated that the anti-HCC effects of SM may downregulate NUSAP1 to further induce cell-cycle arrest.

Cancer is characterized by uncontrolled cellular proliferation caused by the dysregulation of the cell cycle (36). CDCA3, a component of Skp1-cullin-F-box, is a regulator of mitosis (37). Notably, kinesin family member 18B and CDCA3 have been demonstrated to exert crucial functions in HCC by inducing cell cycle progression (38). Deep et al (39) suggested that SM suppresses cellular proliferation and induces G1 and G2-M phase cell cycle arrest in human prostate cancer. Furthermore, another study demonstrated that SM promotes cell cycle arrest in ovarian cancer (40). Hence, the suppression effects of SM on HCC progression may be attributed to the induction of cell cycle arrest, partially via regulating the expression of CDCA3.

On the basis of the PCR results, it was identified that the expression levels of TOPBP1, CDCA3 and NUSAP1 were significantly increased in untreated HCC compared with that in the normal group. Furthermore, following SM treatment in HCC samples, the level of CDCA3, TOPBP1 and NUSAP1 was significantly decreased compared with that in the untreated HCC group. These results further demonstrated that patients with HCC may benefit from SM treatment based on the expression of these key genes.

Although several significant gene modules were obtained in the present study, certain limitations must be taken into consideration. First, the sample size was limited. Additionally, the study implemented bioinformatic analysis based on published datasets and the results were validated using the samples obtained in the present study; however, no microarray or next-generation sequencing (NGS) analysis was performed on this this data. Therefore, further investigation is required to investigate the molecular mechanisms underlying the anti-HCC effects of SM based on microarray or NGS analysis of the primary data acquired in the present study.

In summary, the results of the present study may provide a theoretical basis of the underlying molecular mechanisms involved in anti-HCC effect of SM treatment. TOPBP1, NUSAP1 and CDCA3 of the core modules may serve important functions in the suppression of HCC by SM. The aforementioned results may assist in the understanding of molecular mechanism of HCC development.

References

1 

Romaguera D, Vergnaud AC, Peeters PH, van Gils CH, Chan DS, Ferrari P, Romieu I, Jenab M, Slimani N, Clavel-Chapelon F, et al: Is concordance with world cancer research fund/American institute for cancer research guidelines for cancer prevention related to subsequent risk of cancer? Results from the EPIC study. Am J Clin Nutr. 96:150–163. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Wang YC, Wei LJ, Liu JT, Li SX and Wang QS: Comparison of cancer incidence between China and the USA. Cancer Biol Med. 9:128–132. 2012.PubMed/NCBI

4 

Khan M, Li T, Ahmad Khan MK, Rasul A, Nawaz F, Sun M, Zheng Y and Ma T: Alantolactone induces apoptosis in HepG2 cells through GSH depletion, inhibition of STAT3 activation, and mitochondrial dysfunction. Biomed Res Int. 2013:7198582013. View Article : Google Scholar : PubMed/NCBI

5 

Kojima S, Okuno M, Matsushima-Nishiwaki R, Friedman SL and Moriwaki H: Acyclic retinoid in the chemoprevention of hepatocellular carcinoma (Review). Int J Oncol. 24:797–805. 2004.PubMed/NCBI

6 

Deep G, Gangar SC, Rajamanickam S, Raina K, Gu M, Agarwal C, Oberlies NH and Agarwal R: Angiopreventive efficacy of pure flavonolignans from milk thistle extract against prostate cancer: Targeting VEGF-VEGFR signaling. PLoS One. 7:e346302012. View Article : Google Scholar : PubMed/NCBI

7 

Yurtcu E, Kasapoğlu E and Şahin Fİ: Protective effects of β-carotene and silymarin on human lymphocytes. Turk J Biol. 36:47–52. 2012.

8 

Ramasamy K and Agarwal R: Multitargeted therapy of cancer by silymarin. Cancer Lett. 269:352–362. 2008. View Article : Google Scholar : PubMed/NCBI

9 

He D, Liu ZP, Honda M, Kaneko S and Chen L: Coexpression network analysis in chronic hepatitis B and C hepatic lesions reveals distinct patterns of disease progression to hepatocellular carcinoma. J Mol Cell Biol. 4:140–152. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Liu ZP, Wang Y, Zhang XS and Chen L: Network-based analysis of complex diseases. IET Syst Biol. 6:22–33. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Ma X, Gao L and Tan K: Modeling disease progression using dynamics of pathway connectivity. Bioinformatics. 30:2343–2350. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Ma S, Calhoun VD, Phlypo R and Adalı T: Dynamic changes of spatial functional network connectivity in healthy individuals and schizophrenia patients using independent vector analysis. Neuroimage. 90:196–206. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Ruan J, Dean AK and Zhang W: A general co-expression network-based approach to gene expression analysis: Comparison and applications. BMC Syst Biol. 4:82010. View Article : Google Scholar : PubMed/NCBI

14 

Mao L, Van Hemert JL, Dash S and Dickerson JA: Arabidopsis gene co-expression network and its functional modules. BMC Bioinformatics. 10:3462009. View Article : Google Scholar : PubMed/NCBI

15 

Yang Y, Han L, Yuan Y, Li J, Hei N and Liang H: Gene co-expression network analysis reveals common system-level properties of prognostic genes across cancer types. Nat Commun. 5:32312014.PubMed/NCBI

16 

Ma X, Gao L, Karamanlidis G, Gao P, Lee CF, Garcia-Menendez L, Tian R and Tan K: Revealing pathway dynamics in heart diseases by analyzing multiple differential networks. PLoS Comput Biol. 11:e10043322015. View Article : Google Scholar : PubMed/NCBI

17 

Lovelace ES, Wagoner J, MacDonald J, Bammler T, Bruckner J, Brownell J, Beyer RP, Zink EM, Kim YM, Kyle JE, et al: Silymarin suppresses cellular inflammation by inducing reparative stress signaling. J Nat Prod. 78:1990–2000. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Mar JC, Matigian NA, Quackenbush J and Wells CA: Attract: A method for identifying core pathways that define cellular phenotypes. PLoS One. 6:e254452011. View Article : Google Scholar : PubMed/NCBI

19 

Watson-Haigh NS, Kadarmideen HN and Reverter A: PCIT: An R package for weighted gene co-expression networks based on partial correlation and information theory approaches. Bioinformatics. 26:411–413. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Benjamini Y, Drai D, Elmer G, Kafkafi N and Golani I: Controlling the false discovery rate in behavior genetics research. Behav Brain Res. 125:279–284. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T and Yamanishi Y: KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36(Database issue): D480–D484. 2008.PubMed/NCBI

22 

Huang da W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44–57. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Bolstad BM, Irizarry RA, Astrand M and Speed TP: A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics. 19:185–193. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Post-White J, Ladas EJ and Kelly KM: Advances in the use of milk thistle (Silybum marianum). Integr Cancer Ther. 6:104–109. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Bang SW, Ko MJ, Kang S, Kim GS, Kang D, Lee J and Hwang DS: Human TopBP1 localization to the mitotic centrosome mediates mitotic progression. Exp Cell Res. 317:994–1004. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Lee Y, Katyal S, Downing SM, Zhao J, Russell HR and Mckinnon PJ: Neurogenesis requires TopBP1 to prevent catastrophic replicative DNA damage in early progenitors. Nat Neurosci. 15:819–826. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Negrini S, Gorgoulis VG and Halazonetis TD: Genomic instability-an evolving hallmark of cancer. Nat Rev Mol Cell Biol. 11:220–228. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Katiyar SK, Mantena SK and Meeran SM: Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism. PLoS One. 6:e214102011. View Article : Google Scholar : PubMed/NCBI

30 

Iyer J, Moghe S, Furukawa M and Tsai MY: What's Nu (SAP) in mitosis and cancer? Cell Signal. 23:991–998. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Lu J, Tan M, Huang W C, Li P, Guo H, Tseng LM, Su XH, Yang WT, Treekitkarnmongkol W, Andreeff M, et al: Mitotic deregulation by survivin in ErbB2-overexpressing breast cancer cells contributes to Taxol resistance. Clin Cancer Res. 15:1326–1334. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Mita AC, Mita MM, Nawrocki ST and Giles FJ: Survivin: Key regulator of mitosis and apoptosis and novel target for cancer therapeutics. Clin Cancer Res. 14:5000–5005. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Chen DT, Nasir A, Culhane A, Venkataramu C, Fulp W, Rubio R, Wang T, Agrawal D, McCarthy SM, Gruidl M, et al: Proliferative genes dominate malignancy-risk gene signature in histologically-normal breast tissue. Breast Cancer Res Treat. 119:335–346. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Satow R, Shitashige M, Kanai Y, Takeshita F, Ojima H, Jigami T, Honda K, Kosuge T, Ochiya T, Hirohashi S and Yamada T: Combined functional genome survey of therapeutic targets for hepatocellular carcinoma. Clin Cancer Res. 16:2518–2528. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Sozmen M, Devrim AK, Tunca R, Bayezit M, Dag S and Essiz D: Protective effects of silymarin on fumonisin B1-induced hepatotoxicity in mice. J Vet Sci. 15:51–60. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Urrego D, Tomczak AP, Zahed F, Stuhmer W and Pardo LA: Potassium channels in cell cycle and cell proliferation. Philos Trans R Soc Lond B Biol Sci. 369:201300942014. View Article : Google Scholar : PubMed/NCBI

37 

Smith A, Simanski S, Fallahi M and Ayad NG: Redundant ubiquitin ligase activities regulate wee1 degradation and mitotic entry. Cell Cycle. 6:2795–2799. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Itzel T, Scholz P, Maass T, et al: Translating bioinformatics in oncology: Guilt-by-profiling analysis and identification of KIF18B and CDCA3 as novel driver genes in carcinogenesis. Bioinformatics. 31:216–224. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Deep G, Singh R, Agarwal C, Kroll D and Agarwal R: Silymarin and silibinin cause G1 and G2-M cell cycle arrest via distinct circuitries in human prostate cancer PC3 cells: A comparison of flavanone silibinin with flavanolignan mixture silymarin. Oncogene. 25:1053–1069. 2006. View Article : Google Scholar : PubMed/NCBI

40 

Fan L, Ma Y, Liu Y, Zheng D and Huang G: Silymarin induces cell cycle arrest and apoptosis in ovarian cancer cells. Eur J Pharmacol. 743:79–88. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cui H, Li TL, Guo HF, Wang JL, Xue P, Zhang Y, Fan JH, Li ZP and Gao YJ: Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma. Oncol Lett 15: 885-892, 2018.
APA
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y. ... Gao, Y. (2018). Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma. Oncology Letters, 15, 885-892. https://doi.org/10.3892/ol.2017.7425
MLA
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y., Fan, J., Li, Z., Gao, Y."Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma". Oncology Letters 15.1 (2018): 885-892.
Chicago
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y., Fan, J., Li, Z., Gao, Y."Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma". Oncology Letters 15, no. 1 (2018): 885-892. https://doi.org/10.3892/ol.2017.7425
Copy and paste a formatted citation
x
Spandidos Publications style
Cui H, Li TL, Guo HF, Wang JL, Xue P, Zhang Y, Fan JH, Li ZP and Gao YJ: Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma. Oncol Lett 15: 885-892, 2018.
APA
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y. ... Gao, Y. (2018). Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma. Oncology Letters, 15, 885-892. https://doi.org/10.3892/ol.2017.7425
MLA
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y., Fan, J., Li, Z., Gao, Y."Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma". Oncology Letters 15.1 (2018): 885-892.
Chicago
Cui, H., Li, T., Guo, H., Wang, J., Xue, P., Zhang, Y., Fan, J., Li, Z., Gao, Y."Silymarin‑mediated regulation of the cell cycle and DNA damage response exerts antitumor activity in human hepatocellular carcinoma". Oncology Letters 15, no. 1 (2018): 885-892. https://doi.org/10.3892/ol.2017.7425
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team