Electron microscopic analysis of different cell types in human pancreatic cancer spheres

Introduction

Despite advances in cancer treatments, pancreatic cancer remains one of the most lethal types of malignant tumor. Pancreatic ductal adenocarcinoma (PDAC) is a major histological subtype of pancreatic cancer, comprising 90% of all cases, and is associated with a high mortality rate owing to its aggressive growth and high metastatic rate (1). Surgical treatment offers the only possible cure for PDAC; however, 80% of PDAC patients are inoperable at diagnosis, and the most recently reported overall survival rate for patients with pancreatic cancer is 8% (2). Notably, by the year 2030, pancreatic cancer is expected to become the second-leading cause of cancer-related deaths in the United States, trailing only lung cancer (3).

A cancer stem cell (CSC) is defined as ‘a cell within a tumor that possesses the capacity to self-renew and to cause the heterogeneous lineages of cancer cells that comprise the tumor’ (4). CSCs constitute a small proportion of cancer cells and possess high tumorigenic potential in vivo (5). CSCs, located at the apex of the hierarchy, have the ability to undergo symmetric and asymmetric cell division, enabling them to both self-renew and give rise to the ‘differentiated’ tumor cell progeny that form the bulk of a tumor. The ‘stem cell theory’ of cancer implies that CSCs are responsible for tumor initiation, growth, and even metastasis (6). Because CSCs chiefly remain in the G0 phase of the cell cycle, they are less sensitive to radiation and chemotherapy than proliferating cells (5). As such, they are believed to be responsible for tumor recurrence after completion of adjuvant therapy. Researchers therefore regard CSCs as an important potential cancer therapeutic target (7,8).

Three major methods are employed to identify CSCs: Detection of CSC-specific markers, detection of side population (SP) cells, and the sphere formation assay. In the latter assay, the CSCs of PDAC cells form floating colonies when cultivated in ultra-low-attachment dishes (9–11). Notably, after transplantation to immunodeficient mice, sphere-forming cells show higher tumor formation rates than adherent cells (12). In a previous study, we reported that nestin, a pancreatic CSC marker, is more highly expressed in the spheres of three PDAC cell lines than in nonsphere cells (13). Moreover, pancreatic cancer cells derived from metastatic foci of immunodeficient mice form a greater number of spheres in low-attachment plates than do their primary tumor counterparts (14). These findings suggest that CSCs are enriched in the spheres and play an important role in the aggressiveness of PDAC. Nevertheless, a thorough study of CSCs and the differentiation of cells from CSCs within spheres has yet to be conducted at the ultramicroscopic level.

In the present study, we therefore analyzed the surface and cross-sections of spheres isolated from a human PDAC cell line, PANC-1, via scanning electron microscopy (SEM) and transmission electron microscopy (TEM). To our knowledge, this is the first report of the ultramicroscopic features of cancer spheres consisting of cells that exhibit varying surface morphologies.

Materials and methods

Human pancreatic cancer cell line

The human pancreatic cancer cell line PANC-1 was obtained from the Cell Resource Center for Biomedical Research Center at the Institute of Development, Aging, and Cancer of Tohoku University (Sendai, Japan). PANC-1 cells were grown in the RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere containing 5% CO2.

Sphere-forming assays

For sphere formation, PANC-1 cells (103/well) were seeded in 24-well ultra-low-attachment plates (Corning Inc., Kennebunk, ME, USA) in RPMI-1640 supplemented with 10% FBS. After 7 days, the spheres were photographed using a phase contrast microscope (Eclipse TS-100; Nikon Co., Ltd., Tokyo, Japan). The spheres were then aspirated using micropipettes and placed into microcentrifuge tubes.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from cells, using an RNeasy Plus Mini kit (Qiagen, Venlo, The Netherlands), and subsequently reverse-transcribed to cDNA, using a ReverTra Ace® qPCR RT kit (Toyobo, Osaka, Japan) according to the manufacturer's protocol. qPCR was performed using a Power SYBR® Green kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and a StepOnePlus™ real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Expression of β-actin was considered an internal control. The primer sets used for qPCR analyses are listed in Table I. Gene expression measurements were performed in triplicate.

Table I. List of primer sets for reverse transcription-quantitative polymerase chain reaction.

Table I.

List of primer sets for reverse transcription-quantitative polymerase chain reaction.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
Nestin	TCCTGCTGTAGATGCAGAGATCAG	ACCCTGTGTCTGGAGCAGAGA
Sox2	TGCGAGCGCTGCACAT	TCATGAGCGTCTTGGTTTTCC
CD44v9	AGCAGAGTAATTCTCAGAGCTT	TGCTTGATGTCAGAGTAGAAGT
β-actin	GGTCATCACCATTGGCAATGAG	TACAGGTCTTTGCGGATGTCC

[i] Sox2, sex determining region Y-box 2; CD44v9, CD44 containing variant exon 9.

TEM

Spheres from PANC-1 cells were fixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4), then postfixed for 1 h with 2% OsO4 dissolved in distilled water, dehydrated in a graded series of ethanol solutions, and embedded in Epon. Ultrathin sections were generated using an ultramicrotome and stained with uranyl acetate and lead citrate for examination under a transmission electron microscope (H-7500; Hitachi High-Technologies, Tokyo, Japan).

SEM

Spheres from PANC-1 cells were fixed for 1 h with 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) at room temperature and then incubated at 4°C overnight. The following day, the glutaraldehyde solution was removed and the spheres were washed with PBS. After complete dehydration via a graded ethanol series, sphere samples suspended in 100% ethanol were placed onto a Nanopercolator (JEOL Ltd., Tokyo, Japan) and air-dried, then coated with a platinum layer using an MSP-1S sputter coater (Shinku Device, Ibaraki, Japan) and examined and photographed using a Phenom Pro X desktop scanning electron microscope (Phenom-World BV, Eindhoven, The Netherlands) (15,16).

Statistical analysis

Quantitative data are presented as means ± standard deviations. Differences between two groups were analyzed by Student's t-test. P<0.05 was considered to indicate a statistically significant difference. Computations were performed using Microsoft Excel 2010 (Microsoft Corporation, Redmond, WA, USA).

Results

Spheres of PANC-1 cells in ultra-low-attachment plates

After 7 days of incubation in ultra-low-attachment dishes, we observed sphere formation in all 24-wells of each plate, with each well containing approximately 10 spheres (Fig. 1A). Moreover, the PANC-1 cells proliferated and formed irregular, oblong spheres. While certain individual cells could be seen clearly (Fig. 1B, middle to lower parts), others appeared grouped together, making their margins difficult to distinguish under the phase contrast microscope (Fig. 1B, upper part).

Figure 1. Spheres of the PANC-1 human pancreatic cancer cell line, in ultra-low-attachment plates. (A) Schematic of sphere formation by PANC-1 cells in the ultra-low-attachment plates. (B) A phase contrast image of a PANC-1 cell sphere. Magnification, ×200.

RT-qPCR

To confirm the stemness of the PANC-1 spheres, we screened the spheres for expression of CSC markers, including Oct4, sex determining region Y-box 2 (Sox2), nestin, CD24, and CD44v9 (7,17–19). Notably, the mRNA expression level of each of these markers was higher in PANC-1 spheres than in adherent cells (Fig. 2A-E). In particular, Sox2 was expressed at 4-fold higher levels in spheres than in adherent cells, which was the largest fold-difference observed.

Figure 2. Expression of cancer stem cell markers in adherent PANC-1 cells and spheres. Reverse transcription-quantitative polymerase chain reaction analysis was performed using cDNA derived from adherent and sphere cells to determine the expression of the stem cell markers, (A) Oct4, (B) Sox2, (C) Nestin, (D) CD24 and (E) CD44v9. The results were obtained following normalization against the values obtained for adherent cells (value=1). Results are presented as the mean ± standard deviations of three independent experiments. *P<0.05 vs. adherent cells. Oct4, octamer-binding transcription factor 4; Sox2, sex determining region Y-box 2; CD44v9, CD44 containing variant exon 9.

SEM analysis of spheres from PANC-1 cells

Low-magnification SEM imaging showed that the spheres of PANC-1 cells exhibited an oval to club-like appearance. The surface of the sphere was rugged, and some cells were fused. The center was smooth, while the periphery contained both smooth and protruding areas (Fig. 3A). Additionally, at high-magnification, the spheres had a grape-like appearance, with a mostly smooth surface and rough-surfaced PANC-1 cells (Fig. 3B). We observed a small hole in the surface of certain PANC-1 cells (arrow), and some sphere cells showed several irregular protrusions on their surfaces (Fig. 3C), while others appeared to be fused, with unclear margins.

Figure 3. SEM analysis of PANC-1 cell sphere. (A) Low-magnification SEM images of a PANC-1 cell sphere. The sphere has an oblong/club-like appearance; the center is smooth, while the periphery contains smooth and protruding areas. Scale bar=80 µm. (B) High-magnification SEM images of PANC-1 spheres. The cell spheres have a grape-like appearance, and cancer cells have a smooth or rough surface. The arrow indicates a small hole through the surface of the PANC-1 cells. Scale bar=20 µm. (C) Cells located on the outside of the sphere exhibit irregular protrusions at their surface. Scale bar=8 µm. SEM, scanning electron microscopy.

TEM analysis of spheres from PANC-1 cells

Low-magnification TEM indicated that PANC-1 cells formed spheres with irregular-shaped nuclei and nucleoli, and that the cell-to-cell border was not clear in some cells (Fig. 4). Additionally, there were small clefts or cavities between PANC-1 cells in each sphere, and several cells displayed irregular protrusions on their surface. The surface of the PANC-1 cells in spheres was classified into four types: Smooth surface (Fig. 5A), irregular large protrusions (Fig. 5B), protrusions and a small number of microvilli (Fig. 5C), and many microvilli located throughout the entire cell surface (Fig. 5D). Most of the cells with smooth surfaces were located inside the spheres and tightly attached to other cells. Conversely, those with protrusions and microvilli, as well as those exhibiting large numbers of microvilli throughout the surface (Fig. 5C and D), were located at the outside of the spheres, with loose adhesion to other cancer cells.

Figure 4. Low-magnification transmission electron microscopy analysis of PANC-1 spheres. Images showing PANC-1 cells that formed spheres with irregular-shaped nuclei and nucleoli, as well as PANC-1 cells with varying cell surfaces. Scale bar=10 µm.

Figure 5. High-magnification transmission electron microscopy analysis of PANC-1 spheres. Images depicting the distinct surface types of cancer cells within spheres, including (A) smooth surface, (B) surface with round protrusions, (C) surface containing protrusions with microvilli, and (D) microvilli located throughout the entire cell surface. Scale bars=2 µm.

Discussion

Spheres of PDAC cells represent round aggregates of fused cells formed during the early stage of culture in ultra-low-attachment plates, according to phase contrast microscopic examination. Subsequently, these spheres grow and form irregular, oblong to club-shaped floating colonies. There are several reports of the electron microscopic analysis of cancer spheres or spheroids, involving the hanging-drop method, culture on a scaffold, or culture in low-attachment plates (20,21). SEM images of PANC-1 cells in hanging-drop experiments show a ruffled surface and lightly packed cells with deep pore-like structures (22). The heterogeneous morphology of PDAC spheres consisting of cancer cells is similar to that of morphologically and functionally heterogeneous neurospheres (consisting of neural stem cells and their progeny), which can differentiate into glial cells, neurons, and oligodendrocytes (23,24). The most immature clonogenic cells are located in the core of the neurosphere, whereas progeny and differentiated cells are located at the periphery (25,26). In the present study, we found that the fused cell aggregates are located in the core region of the PDAC spheres, while clearly separated cancer cells exist around the spheres.

In this study, we used serum-containing medium because PANC-1 cells most rapidly form large spheres under these conditions. The spheres generated from these cells expressed high mRNA levels of CSC markers, suggesting that they contain CSCs (7,13,17–19). A previous study showed that PANC-1 cells grown in a serum-containing medium formed clusters that were heterogeneous for dye efflux, while cells grown in the serum-free medium with supplements commonly used to culture stem cells gave rise to colonies that varied in their ability to efflux dye and respond to verapamil (27). In neurospheres, mitotic cells were found at the periphery but not in the inner part of the spheres (23). Growth factors or serum added to the medium might therefore play important roles in the differentiation of the cancer cells on the outside of the spheres, as well as the growth of cells in the spheres.

Our EM analyses detected four types of cancer cells within PDAC spheres. Those with a smooth surface were located inside the spheres and were fused to each other. In contrast, the cells containing protrusions and/or microvilli on their surface were localized at the periphery of the spheres. In a healthy human pancreas, short microvilli are present on acinar cells and ductal epithelial cells (28). Furthermore, PDAC cells are comprised of epithelial cells that form lumens, apical mucin granules, intermediate filaments, tight junctions, and microvilli. In commonly used 2D culture, PANC-1 cells have microvilli on their cell surface (29). SEM and TEM analyses in the present study suggest that the cells with a smooth surface are CSCs of PANC-1, while those with large protrusions, with protrusions and some microvilli, and with large numbers of microvilli on their surfaces represent distinct stages of the differentiation process of pancreatic CSCs to non-CSCs. A recent study showed that lung adenocarcinoma cells can divide into two cell types: Tumor cells and support cells that form a part of a supporting microenvironment known as the niche (30). Further studies are needed to clarify the function of the different types of pancreatic cancer cells in the spheres that were observed in our study.

Here, we identified different types of cells present in spheres formed by a human pancreatic cancer cell line, via EM analysis. The cancer cells exhibited smooth surfaces, rounded protrusions on the cell surface, surfaces containing protrusions with a small number of microvilli, or the presence of large numbers of microvilli across the entire cell surface. These findings suggest that CSCs and differentiated non-CSCs have characteristic morphologies. However, further studies are needed to clarify correlations between cell surface features and cell types within pancreatic cancer spheres.

Acknowledgements

The authors would like to thank Ms. Sanae Furusho, Shoko Wada, Atsumi Ozaki and Mr. Hiroyuki Sugihara (Jasco International Co., Ltd., Tokyo, Japan) for their technical assistance with SEM. We thank Dr Seiichi Shinji (Nippon Medical School), Dr Kimimasa Takahashi, M.A. Yuuki Shichi (Nippon Veterinary and Life Science University), and Dr Naotaka Izumiyama-Shimomura (Tokyo Metropolitan Institute of Gerontology) for their helpful discussions. This study was supported in part by JSPS KAKENHI (grant no. JP16K10613) to Dr Toshiyuki Ishiwata.

References