Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February-2018 Volume 15 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2018 Volume 15 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China

  • Authors:
    • Fang Chen
    • Ling Wang
    • Min Wang
    • Yixin Xie
    • Xiaomeng Xia
    • Xianping Li
    • Yanhua Liu
    • Wei Cao
    • Tingting Zhang
    • Pengling Li
    • Min Yang
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China, Department of Obstetrics and Gynecology, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2305-2315
    |
    Published online on: December 13, 2017
       https://doi.org/10.3892/ol.2017.7600
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study aimed to develop a rational therapy based on the genetic epidemiology, molecular mechanism evaluation and in vitro antibiotic combinations activity in multidrug-resistant Acinetobacter baumannii (MDRAB). MDRAB was screened by the Kirby‑Bauer method. The random amplified polymorphic DNA technique was used to establish genetic fingerprinting, and a series of resistance genes were detected by polymerase chain reaction. Antimicrobial agents including amikacin (AK), cefoperazone/sulbactam (SCF I/II), meropenem (MEM), minocycline (MINO) and ciprofloxacin (CIP) were used to determine the minimum inhibitory concentrations (MICs) and interactions between antibiotics by the broth microdilution method and chequerboard assays. In total, 34 MDRAB strains were isolated and classified into 8 phenotypes A‑H, according to their general drug susceptibilities. A total of 4 major genotypes (I‑IV) were clustered at 60% a genotypic similarity threshold. High positive rates of β‑lactamase TEM‑1, topoisomerase IV, oxacillinase (OXA)‑23, AdeB family multidrug efflux RND transporter adeB, β‑lactamase AmpC, class 1 integrons (Int‑1), 16S rRNA methylase rmtA, phosphotransferase aph(3), 16S rRNA methyltransferase armA were presented to exceed 90%, acetylyltransferase aac(3)‑I, aac(6'‑I, ant(3'')‑I, 16S rRNA methylase rmtB, oxacillinase OXA‑24 and metallo‑β‑lactamase IMP‑5 genes demonstrated positive rates of 29.4‑85.29%, while adeRS two‑component system was not observed in any strain. MEM+SCF I or SCF II primarily exhibited synergistic effects. AK+SCF I, AK+SCF II, MINO+SCF I, MINO+SCF II, MINO+CIP and MINO+MEM primarily presented additive effects. AK+CIP demonstrated 70.59% antagonism. The antibacterial activity of SCF I was superior compared with that of SCF II. The results indicated the polyclonal genetic epidemiological trend of MDRAB in the Second Xiangya Hospital, and verified the complexity of genetic resistance. In addition, combinations suggested to be efficacious were MEM+SCF I and MEM+SCF II, which were more effective compared with other combinations for the management of MDRAB infection.

Introduction

Acinetobacter baumannii, a leading nosocomial pathogen, has been identified to induce serious infections and high mortality rates in intensive care units (ICUs) (1,2). Multidrug-resistant Acinetobacter baumannii (A. baumannii) (MDRAB), with resistance to at least three classes of antibiotics among cephalosporins, carbapenems, β-lactamases, aminoglycosides and quinolones (3), is only susceptible to certain agents such as tigecycline, and polymyxins due to intrinsic and acquired resistance (4,5). In addition, several pandrug-resistant (PDR) A. baumannii strains with resistance to almost all available antibiotics have been identified in previous decades (6,7).

Abuse of broad-spectrum antibiotics has been demonstrated to be a major cause for the development of drug resistance of A. baumannii. At present, a number of genes responsible for drug resistance have been identified though long-term studies on the mechanisms of bacterial resistance (7–10). Production of β-lactamase is suggested to be associated with the bacterial resistance to penicillin, cephalosporins and carbapenems (9). At present, four major categories have been available for the β-lactamase protein-encoding genes, including narrow-spectrum β-lactamase, extended-spectrum β-lactamase (ESBLs), metallo-β-lactamases (MBLs) and oxacillinase (OXA)-type carbapenemases (10). Bacterial resistance to aminoglycoside usually results in the production of aminoglycoside-modifying enzymes. Aminoglycoside resistance genes, including acetyltransferase (aac), phosphotransferase (aph) and adenylyltransferase (aad), have been frequently identified in MDRAB (11). For example, MDRAB has been demonstrated to acquire antimicrobial resistance genes via class 1 integrons (Int-1), which contain single or multiple gene cassettes (12). Carbapenemase and aminoglycoside resistance genes were localized within Int-1 (13). In addition, 16S rRNA methylases may confer resistance to aminoglycosides (14). The increased production of fluoroquinolone-resistant A. baumannii was demonstrated to be markedly associated with spontaneous mutations in the quinolone resistance-determining regions (QR-DRs) in DNA gyrase (gyrA) or topoisomerase IV (parC) (15).

MDRAB remains a challenge for the clinical management of life-threatening infections, including bacteremia, pneumonia and wound infections. At present, MDRAB is a lethal threat to public health due to the lack of effective antimicrobial agents available. Currently, combination therapy has been considered to be a promising method for the management of infection. Previous studies revealed that tigecycline and polymyxins were active against MDRAB (4,5), but their application is inhibited due to high toxicity and low commercial availability in China. Consequently, the effective combinations of clinical drugs may be an improved choice for treating MDRAB infection. In the present study, the genotypes and encoding resistance genes of MDRAB were determined. Based on the phenotypic analysis, the gene structure and molecular determinants that confer alternative MDRAB phenotypes were investigated. Furthermore, five drugs were used to evaluate the in vitro activity of various antibiotic combinations against MDRAB, in order to provide reliable data to support novel clinical combination therapies.

Materials and methods

Bacterial isolates

A total of 34 consecutive and non-repetitive MDRAB strains were identified using the MicroScan WalkAway-96 system (Siemens AG, Munich, Germany) from the Second Xiangya Hospital (Changsha, China) between February 2011 and May 2011. Kirby-Bauer antibiotic susceptibility testing (K-B test) was utilized to determine the susceptibility to several clinically significant antimicrobial agents. MDRAB was defined as the presence of resistance to at least three classes of antibiotics, including: Cephalosporins, carbapenems, β-lactamases, aminoglycosides and quinolones. In the present study, a total of 34 strains were collected (Table I), 30 of which were identified from sputum samples from patients with nosocomial pneumonia, referring to criteria for radiologically-confirmed pneumonia occurring ≥48 h after hospitalization in non-intubated patients (16), 3 were isolated from wound secretion and one was isolated from fluid drainage. The samples were primarily collected from the ICU Respiratory and Cardiothoracic Surgery departments. The interpretation of susceptibility test and breakpoints was performed according to the Clinical and Laboratory Standard Institute (CLSI) criteria (17). The present study was approved by the Ethics Committee of The Second Xiangya Hospital, Central South University (Changsha, China). Written informed consent was obtained from all patients.

Table I.

Characteristics of study isolates.

Table I.

Characteristics of study isolates.

Clinical antimicrobial susceptibility

NOxPTDate of strain separatedWardTZPCAZSCFATMIPMAKFEPMEMTIMCIPSXTCTXLEVCNSAM
1AI51M3/93RRRRRRRRRRRRRRR
2AI13M3/94RRRRRRRRRRRRRRR
3BI46M3/231RRIRRRRRRRRRRRR
4AI64M3/2210RRRRRRRRRRRRRRR
5AI34M3/118RRRRRRRRRRRRRRR
6BI1M3/173RRIRRRRRRRRRRRR
7CI65M3/121RRRRRRRRRRRRIRR
8AI7M5/144RRRRRRRRRRRRRRR
9DI88F3/316RRSRRRRRRRRRRRR
10BI33F3/283RRIRRRRRRRRRRRR
11BII25F3/303RRIRRRRRRRRRRRR
12BII48F3/281RRIRRRRRRRRRRRR
13BII30F3/281RRIRRRRRRRRRRRR
14BII47F4/22RRIRRRRRRRRRRRR
15BII55M4/213RRIRRRRRRRRRRRR
16BIV25M4/211RRIRRRRRRRRRRRR
17AII63M3/201RRRRRRRRRRRRRRR
18BI72F3/231RRIRRRRRRRRRRRR
19CI57M3/121RRRRRRRRRRRRIRR
20AI78M3/181RRRRRRRRRRRRRRR
21AII41M3/104RRRRRRRRRRRRRRR
22EII80F3/301RRIRRRRRRRRRRIR
23FI46M4/54RRIRRRIRRRRRRRR
24BII43M4/39RRIRRRRRRRRRRRR
25AII55M4/55RRRRRRRRRRRRRRR
26AII55M4/65RRRRRRRRRRRRRRR
27BII57F4/72RRIRRRRRRRRRRRR
28AI70F4/72RRRRRRRRRRRRRRR
29DII69M4/52RRSRRRRRRRRRRRR
30GII87F2/281RSRRRRRRRRRRRSS
31BIII56M2/281RRIRRRRRRRRRRRR
32BI6F2/287RRIRRRRRRRRRRRR
33BI27M3/41RRIRRRRRRRRRRRR
34HI79M2/281RSIRRRRRRRRRRRR

[i] PT, patient age and sex. Wards: 1, Intensive care unit; 2, Department of Respiratory; 3, Cardiothoracic surgery; 4, Orthopedics; 5, Neurology; 6, Geriatric Ward; 7, Department of Minimally Invasive Surgery; 8, Neurosurgery; 9, Urology; 10, Digestive system department. Antimicrobials: TZP, piperacillin/tazobactam; CAZ, ceftazidime; SCF, cefoperazone/sulbactam; ATM, aztreonam; IPM, imipenem; AK, amikacin; FEP, cefepime; MEM, meropenem; TIM, ticarcillin/clavulanic acid; CIP, ciprofloxacin; SXT, trimethoprim/sulfamethoxazole; CTX, cefotaxime; LEV, levofloxacin; CN, gentamicin; SAM, ampicillin/sulbactam. NOx: The isolates were classified into 8 phenotypes (A-H) according to their susceptibility to the tested clinical antimicrobials; A, resistant to all the aforementioned drugs; B, only intermediate to SCF; C, only intermediate to LEV; D, only susceptible to SCF; E, intermediate to SCF and CN; F, intermediate to SCF and FEP; G, susceptible to CAZ, CN and SAM; H, susceptible to CAZ and intermediate to SCF; R, resistance; I, intermediary; S, sensitivity.

Random amplified polymorphic DNA (RAPD) genotyping and detection of drug resistance genes by polymerase chain reaction (PCR)

Bacterial DNA was extracted and purified by using Tiangen UltraClean Microbial DNA Isolation kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. MDRAB genotyping was conducted using RAPD (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with an AP2 primer (5-GTTTCGCTCC-3) designed by Primers Express software (version 2.0; Applied Biosystems; Thermo Fisher Scientific, Inc.) and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), as previously described (18). The genes encoding resistance, including β-lactamase TEM-1, AmpC, metallo-β-lactamase IMP-5, oxacillinase (OXA)-23, OXA-24, acetylyltransferase aac(3)-I, aac(6′)-I, ant(3″)-I, 16S rRNA methyltransferase armA, 16S rRNA methylase rmtA, rmtB, phosphotransferase aph-(3), AdeB family multidrug efflux RND transporter adeB, adeRS two-component system, Int-1 and ParC genes, were detected by PCR. All primers were designed based on the sequences in GenBank (19) using Primer Express software v2.0 (Applied Biosystems; Thermo Fisher Scientific, Inc., Foster City, CA, USA) (Table II). The PCR total reaction volume of 20 µl, containing 10 µl 2X TaqMan PCR master mix, 1 µl forward and reverse primers (10 µmol/l), 7 µl ddH2O and 1 µl DNA template. The amplification conditions of the target genes were presented in Table III. Following amplification, 3 µl of products were electrophoresed on a 1.5% agarose gel (Oxoid; Thermo Fisher Scientific, Inc.) and visualized using ethidium bromide (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 20 min at a voltage of 150 V.

Table II.

Primers of resistance genes.

Table II.

Primers of resistance genes.

Primer sequences (5′-3′)

Target genesForwardReverseSize, bp
TEM-1 TTCGTGTCGCCCTTATTC ACGCTCGTCGTTTGGTAT512
IMP-5 CTACCGCAGCAGAGTCTTTG AACCAGTTTTGCCTTACCAT587
OXA-23 TGTCATAGTATTCGTCGTT TTCCCAAGCGGTAAA453
OXA-24 TTTGCCGATGACCTT TAGCTTGCTCCACCC175
AmpC CGACAGCAGGTGGAT GGTTAAGGTTGGCATG510
aac(3)-I ACCTACTCCCAACATCAGCC ATATAGATCTCACTACGCGC158
aac(6′)-I TATGAGTGGCTAAATCGA CCCGCTTTCTCGTAGCA395
ant(3″)-I TGATTTGCTGGTTACGGTGAC CGCTATGTTCTCTTGCTTTTG284
armA GGGGTCTTACTATTCTG TTCCCTTCTCCTTTC503
rmtA CCTAGCGTCCATCCTTTCCTC AGCGATATCCAACACACGATGG315
rmtB ATGAACATCAACGATGCCCTC TTATCCATTCTTTTTTATCAAGTATAT756
aph(3) ATACAGAGACCACCATACAGT GGACAATCAATAATAGCAAT234
adeB GTATGAATTGATGCTGC CACTCGTAGCCAATACC1,000
adeRS CTCAGACTCCCGTGATCATGTTG CGTAAGTCTTCGACTAAGTGAGA1,115
Int-1 GCACCGCCAACTTTC CCTTGATGTTACCCGAGA433
ParC CTGAACAGGCTTACTTGAA AAGTTATCTTGCCATTCG200

Table III.

Polymerase chain reaction conditions of target genes.

Table III.

Polymerase chain reaction conditions of target genes.

Amplification

Target genesInitialdenaturation (°C, min)Denaturation (°C, sec)Annealing (°C, sec)Extension (°C, sec)Cycles (n)Final extension (°C, min)
AP295, 695, 4533, 4572, 1204572, 10
TEM-194, 594, 6055, 6072, 503072, 7
IMP94, 594, 6055, 6072, 503072, 7
OXA-2394, 594, 3048, 3072, 353072, 10
OXA-2494, 594, 3048, 3072, 353072, 10
AmpC94, 594, 3050, 3072, 503072, 10
aac(3)-I94, 594, 3055, 3072, 303572, 10
aac(6′)-I94, 594, 3055, 3072, 303572, 10
ant(3″)-I94, 594, 3055, 3072, 303572, 10
rmtA93, 293, 2055, 3072, 303072, 5
aph (3)93, 293, 2055, 3072, 303072, 5
armA94, 594, 3047, 3072, 353072, 10
rmtB94, 594, 3055, 3072, 603072, 10
adeB95, 595, 3053, 6072, 603072, 7
adeRS95, 595, 3053, 4072, 603072, 7
Int-194, 594, 3053, 3072, 603072, 10
ParC94, 494, 3053, 3072, 403072, 7
Antimicrobial agents and minimum inhibitory concentration (MIC) assays

Antimicrobial agents used in the present study were amikacin (AK), cefoperazone/sulbactam [SCF, SCFI 1:1 (cefoperazone:sulbactam) and SCFII 2:1 (cefoperazone:sulbactam)], meropenem (MEM), minocycline (MINO) and ciprofloxacin (CIP). MIC assays were performed in 96-well microtiter plates by the broth microdilution method, according to the CLIS protocol (17). Bacteria were cultured in 10% horse blood agar (Oxoid; Thermo Fisher Scientific, Inc.) for 20–24 h until cells reached the exponential phase. The inoculums were adjusted with fresh Cationic adjustment of Mueller-Hinton Broth [Oxoid; Thermo Fisher Scientific, Inc.; CAMHB, containing Ca2+ (10–25 mg/l) and Mg2+ (10–12.5 mg/l)] to produce solutions with ~5×105 colony forming units (CFUs)/ml in a final volume of 100 µl. Subsequently, the bacteria were cultured using various concentrations of drugs: AK and SCF, 256, 128, 64, 32, 16, 8 µg/ml; MEM and MINO, 64, 32, 16, 8, 4, 2 µg/ml; CIP, 16, 8, 4, 2, 1, 0.5 µg/ml, for 18–20 h at 37°C. The average MIC (MICG), the concentration that inhibited 50% of growth (MIC50) or 90% of strains (MIC90) were calculated. All tests were performed in triplicate, and growth and sterility controls were conducted simultaneously.

Chequerboard assay

A chequerboard assay was used to determine the potential interactions between antibiotics. In each assay, a combination of two antibiotics randomly chosen from the total five was used, and the range of drug concentration was identical to the MIC assays. The drugs in the 96-well plates were diluted with CAMHB by checkerboard method as previously described (20). The broth microdilution plates were inoculated with each MDRAB isolate (initial concentration of bacteria was 0.5 McFarland) for 18–24 h at 37°C, to yield ~5×105 CFU/ml in a 100 µl volume. The effect of the combinations was analyzed through measuring the fractional inhibitory concentration index (FIC) with the following formula: FICA + FICB, where FICA was the ratio of MIC of drug A in combination compared with that of drug A used alone, and FICB was the ratio of MIC of drug B in combination compared with that of drug B used alone. The interaction was defined as synergy (FIC ≤0.5), addition (0.5< FIC ≤1), indifference (1< FIC ≤2) or antagonism (FIC >2), respectively.

Results

Antimicrobial susceptibility

The MDRAB phenotype was determined according to the susceptibility results. In total, 34 strains were isolated, among which 11 strains (29.41%) were PDR A. baumannii with resistance to almost all clinically significant agents. All the strains were resistant to piperacillin/tazobactam, imipenem, meropenem, amikacin, cefotaxime, ticarcillin/clavulanic acid and ciprofloxacin, while only 14 strains (41.18%) were resistant to cefoperazone/sulbactam. The isolates were also resistant to other tested drugs including ceftazidime (97.06%), aztreonam (97.06%), trimethoprim/sulfamethoxazole (97.06%), cefepime (94.12%), gentamicin (94.12%), ampicillin/sulbactam (94.12%) and levofloxacin (94.12%). The strains were classified into 8 phenotypes (A-H) based on the resistance to the aforementioned primary clinical drugs (Table I).

Genotypic diversity and molecular determinants for MDR

To detect the extent of genotypic diversity of the tested MDRAB, RAPD was performed and the fingerprint images were analyzed by NTsys 2.10e (Exeter Software; Exeter Publishing Ltd., East Setauket, NY, USA) using dice similarity index for cluster analysis and unweighted pair group average for dendrogram construction. The isolates were clustered into four major genotypes (I–IV) at 60% genotypic similarity threshold (Fig. 1).

Figure 1.

RAPD fingerprinting of MDRAB strains. The gel image displayed diversity RAPD genotyping pattern of each MDRAB isolates representing various phenotypes from different wards. The genotypic similarities were calculated by NTsys 2.10e using dice similarity index and UPGMA, presented in the left of the glue image with coefficients and lines. Four genotypes (I–IV) were formed at a 60% similarity level. RAPD, randomly amplified polymorphic DNA; MDRAB, multidrug resistant Acinetobacter baumannii; UPGMA, unweighted pair group average.

Table IV summarizes the distribution of resistance genes in the strains. TEM-1 and ParC were identified in all strains. A total of seven genes demonstrated high positive rates, including OXA-23 (97.06%), AdeB (97.06%), AmpC (94.12%), Int-1 (94.12%), rmtA (94.12%), aph(3) (91.18%) and armA (91.18%). The other genes, including aac(3)-I, aac(6′-I, ant(3″)-I, rmtB, OXA-24 and IMP-5, demonstrated positive rates of 29.41, 32.35, 76.47, 41.18, 85.29 and 64.71%, respectively.

Table IV.

Distribution of positivity of various resistance genes.

Table IV.

Distribution of positivity of various resistance genes.

No. aac(3)-I aac(6′)-I ant(3”)-IOXA-23OXA-24TEM-1IMP-5AmpCArmARmtARmtBAph(3)AdeRSAdeBInt1ParC
  1NNPPPPNPPPNPNPPP
  2NNPPPPPPNPPPNPPP
  3NNPPPPPPPPNPNPPP
  4NNPPPPPPPPNPNPPP
  5NNPPPPPPPPNPNPPP
  6NNPPPPPPPNNPNPPP
  7NNPPPPPPNPNPNPPP
  8NNPPPPPPPPPPNPPP
  9NNPPPPPPPPPPNPPP
10NNPPPPNPPPNNNPPP
11NNPPPPPPPPNPNPPP
12NNPPPPPPPPNPNPPP
13PNPPPPPPPPNPNPPP
14NNPPPPPPPPPPNPPP
15NNPPPPPPPPNPNPPP
16NNPPPPPPPPPPNPPP
17NNPPPPPPPPNPNPPP
18NNPPPPPPPPNPNPPP
19NNPPNPPPPPNPNPPP
20NPNPPPPPPPPPNPPP
21NNPPPPPPPPNPNPPP
22NNPPPPPPPPPPNPPP
23PPNPNPNPPPNPNPPP
24PPNPNPNPPPNPNPPP
25NNNNNPNPNPPPNPPP
26PNNPPPNNPPPPNPNP
27PPPPPPNPPPNPNPPP
28PPNPPPNPPPPPNPNP
29PPPPPPNPPPPPNPPP
30NPNPNPNNPPPNNPPP
31PPPPPPPPPPPPNPPP
32PPPPPPPPPPPPNPPP
33NPNPPPNPPPNPNPPP
34PPPPPPNPPPNNNNPP
P (%)29.4132.3576.4797.0685.29100.0064.7194.1291.1897.0641.1891.180.0097.0694.12100.00

[i] P (%), percentage of strains positive for each gene; P, positive; N, negative.

MIC and the interaction of drug combinations

The antibiotic susceptibility levels, expressed as MIC of AK, SCF I, SCF II, MEM, MINO and CIP, were preliminarily determined for the 34 MDRAB isolates. The distribution of MIC50, MIC90 and MICG are presented in Table V. The majority of isolates were resistant to CIP (91.18%), SCF II (91.18%), amikacin (85.29%), SCF I (82.35%) and MEM (73.53%), while less isolates (5.88%) were resistant to MINO.

Table V.

MIC parameters of drugs alone use or in combination.

Table V.

MIC parameters of drugs alone use or in combination.

Antibiotics usageMIC50 (µg/ml)MIC90 (µg/ml)MICG (µg/ml)
AK alone>256.00>256.00>222.24
SCF I alone64.00>256.00>90.83
SCF II alone128.00>256.00>130.35
MEM alone33.60>64.00>46.39
MINO alone3.50>25.00>5.50
CIP alone>16.00>16.00>14.13
AK/SCF I
  AK888
  SCF I3225629.88
AK/SCF II
  AK8>256>24.24
  SCF II64>256>57.41
MEM/SCF I
  MEM2322.82
  SCF I812817.18
MEM/SCF II
  MEM2>64>6.14
  SCF II8>256>26.12
CIP/SCF I
  CIP0.5>16>0.96
  SCF I32>256>48.24
CIP/SCF II
  CIP0.5>16>1.85
  SCF II64>256>87.76
MINO/SCF I
  MINO222
  SCF I888
MINO/SCF II
  MINO243.24
  SCF II888
AK/MEM
  AK88>37.18
  MEM16>64>89.82
AK/CIP
  AK>256>256>176.99
  CIP>16>16>12.25
CIP/MEM
  CIP>16>16>14.40
  MEM16>64>24.65
CIP/MINO
  CIP0.510.53
  MINO242.47
MEM/MINO
  MEM222
  MINO222

[i] MIC, minimum inhibitory concentration; MIC50, the concentration that inhibits the growing of 50% of strains; MIC90, the concentration that inhibits the growing of 90% of strains; MICG, the average MIC; AK, amikacin; SCF, SCFI 1:1 and SCFII 2:1, cefoperazone/sulbactam; MEM, meropenem; MINO, minocycline; CIP, ciprofloxacin; FIC, fractional inhibitory concentration index.

A chequerboard assay was performed with random combinations of two drugs (Table V). Fig. 2 demonstrates the percentage of isolates inhibited at various MIC of antibiotics when use alone or in combination. The majority of the drug combinations exhibited superior inhibitory effects compared with each used alone. All the combinations demonstrated synergism, with the exception of CIP with MINO. MEM in combination with SCF I or SCF II primarily demonstrated synergy, while the combination of AK+SCF I, AK+SCF II, MINO+SCF I, MINO+SCF II, MINO+CIP, and MINO+MEM primarily exhibited additive effects. Concurrently, the combination of AK+CIP demonstrated evidence of antagonism (Fig. 3).

Figure 2.

Cumulative percentages of MDRAB strains that were inhibited by increasing concentrations of various types of drugs used alone or combination. (A) AK+SCFI; (B) AK+SCFII; (C) AK+MEM; (D) AK+CIP; (E) MEM+SCFI; (F) MEM+SCFII; (G) CIP+SCFI; (H) CIP+SCFII; (I) MINO+SCFI; (J) MINO+SCFII; (K) CIP+MEM; (L) CIP+MINO; and (M) MEM+MINO. There were two cumulative percentage lines overlapped (to 100% bacteriostasis) in parts I and M of MINO combining with SCFI and MEM. AK, amikacin; SCF, SCFI 1:1 and SCFII 2:1, cefoperazone/sulbactam; MEM, meropenem; MINO, minocycline; CIP, ciprofloxacin.

Figure 3.

The distribution of FIC of various combinations of antimicrobial drugs. (A) AK+SCFI; (B) AK+SCFII; (C) AK+MEM; (D) AK+CIP; (E) MEM+SCFI; (F) MEM+SCFII; (G) CIP+SCFI; (H) CIP+SCFII; (I) MINO+SCFI; (J) MINO+SCFII; (K) CIP+MEM; (L) CIP+MINO; and (M) MEM+MINO. Synergy, FIC ≤0.5; addition, 0.5< FIC ≤1; indifference, 1< FIC ≤2; antagonism, FIC >2. AK, amikacin; SCF, SCFI 1:1 and SCFII 2:1, cefoperazone/sulbactam; MEM, meropenem; MINO, minocycline; CIP, ciprofloxacin; FIC, fractional inhibitory concentration index.

Discussion

Antibiotic resistance patterns observed in A. baumannii exhibits the capacity to cause an epidemic globally. MDRAB has been demonstrated to lead to serious hospital-acquired infection, as limited therapeutic options are available (20). In the present study, the features of 34 MDRAB strains isolated from the Second Xiangya Hospital were investigated, including antimicrobial susceptibility, genotypes, screening of antibiotic resistance genes, MIC assay and antibiotic interactions.

In the antimicrobial susceptibility study, eight phenotypes (A-H) were classified using the K-B test. The results of the drug susceptibility were in accordance with previous studies (21,22) that highlighted the efficiency of cefoperazone/sulbactam against MDRAB. However, the expression of characteristic bacterial phenotypes may be easily affected by various environmental factors. Therefore, only determining the phenotype was not sufficient for the complete epidemiological typing of various strains. Organism identification based on the genotype is considered to be more reliable, as the genotype of each organism is unique and invariable. In the present study, a AP2 primer known to be efficient in RAPD genotyping was used to amplify the genomic DNA of MDRAB strains (23). In total, four genotypes (I–IV) were formed at a 60% similarity level. The genotypic distribution was polyclonal, which was opposite to a previous study (24). In general, the ‘classic’ outbreaks of MDRAB may be more frequently induced by a single clone spread among people, whereas for the prevalence of polyclones in the Second Xiangya Hospital, it may be associated the existence of mobile genetic elements, for example integrons. The variety of patient wards and isolate origin was hypothesized to be responsible for the transmission of different subtypes. When comparing the phenotypes with diverse fingerprinting profiles, it is noteworthy to select isolates of the same phenotype with different genotypes, as it manifested that the environment may affect the discrepancy between genotype and phenotype.

To additionally investigate the resistant mechanisms of MDRAB, the expression of the genes associated with drug resistance was detected among the 34 isolates. Differences were observed in the genetic characteristics of β-lactam, aminoglycoside and quinolones resistance. Previously, the carbapenem resistance associated with class D β-lactamase genes had been suggested to cause serious therapeutic problems in clinical practice (25,26). The high positive rate of OXA-23 (33/34) in the present study was consistent with a previous study (27), while the proportion of OXA-24-positive strains (29/34) was increased compared with a previous study (28). The production of OXA-23 and OXA-24 β-lactamase may be the major cause for the selected MDRAB representing 100% resistance to imipenem and meropenem. Other β-lactamase genes, including TEM-1 (class A), IMP-5 (class B) and AmpC (class C) were also identified in the present study, which may be associated with the resistance of MDRAB to various types of β-lactams including aztreonam, ceftazidime, cefepime, and cefoperazone/sulbactam. At present, aminoglycoside-modifying enzymes and 16S rRNA methylases have been suggested to be the most important mechanism for bacterial resistance against aminoglycosides (14). In the present study, the co-existence of aph(3) (91.18%), ant(3″)-I (76.47%), aac(3)-I (29.41%), aac(6′)-I (32.35%), armA (91.18%), rmtA (94.12%) and rmtB (41.18%) resistance genes confers the high resistance to amikacin and gentamicin in MDRAB. Mutations in ParC were observed in all isolates, which may assist in explaining the 100% resistance to ciprofloxacin. The result was similar to a previous study (29). Among the isolates, the positive rates of Int1 and adeB were 94.1 and 97.1%, respectively, while the adeRS was completely negative. Integron and efflux pump genes are non-specific resistance genes. Concurrently, integrons are widely present in MDRAB, particularly Int-1, which provides A. baumannii with a gene capture system adapted to circumvent the challenges of multiple-antibiotic treatment regimens (30). The results of the present study demonstrated that Int1 serves a crucial role in multiple drug resistance. In addition, the identification of the co-existence of Int-1 and the majority of the β-lactamase and aminoglycoside genes was notable, which is in accordance with a previous study (31). This highlighted the importance of the roles of Int-1 in the horizontal spreading of antibiotic resistance genes, which may finally result in the polyclonal prevalence of MDRAB in the Second Xiangya Hospital. AdeB is a vital component of the AdeABC efflux pump, and the expression of adeABC is regulated by the adeRS two-component regulatory system (32). The sophisticated feedback between them may account for the high positive ratio of adeB and absolute absence of adeRS observed in the present study.

The results of the present study confirmed that several genes were associated with MDR. Abuse of antibiotic chemotherapeutics affords major challenges in treating MDRAB infections. At present, traditional therapy regimens are not efficient to manage these life-threatening infections. Tigecycline and polymyxins have been considered as the last resort for treating MDRAB infections (4,5). However, they are still widely used across mainland China due to the lack of any other qualified commercial products. On this basis, the present study aimed to identify an effective regimen to manage MDRAB infections through a combination of antibiotics that are frequently used in clinical practice. In the present study, 6 drugs (iAK, SCF I, SCF II, MEM, MINO and CIP) were selected to study the in vitro activity of drug combinations against MDRAB. The lower MIC of SCFI compared with SCF II demonstrated a comparatively increased rate of in vitro activity of SCF I against MDRAB, which was incompatible with previous studies (33,34). This discrepancy may arise from the geographical and biological evolutional differences. In addition, a high percentage (76.47%) of MDRAB was susceptible to minocycline, indicating the potential of this drug for the treatment of this fatal infection (35). The chequerboard assay indicated synergism for all the tested combinations, particularly the combination of MEM+SCF I, and MEM+SCF II, with the exception of CIP+MINO. Conversely, the combinations of MINO+SCF I, MINO+SCF II, CIP+MINO and MEM+MINO demonstrated additive effects. In summary, the combination of cefoperazone-sulbactam or meropenem-minocycline has been indicated to be more active compared with ciprofloxacin-amikacin, which is similar to the recent surveillance data (16,21). The present study also demonstrated that meropenem and cefoperazone-sulbactam were generally active in MDRAB. In a previous study, the combined utilization of meropenem and sulbactam was considered a therapeutic option for A. baumannii infection (36). However, only a small number of studies have been focused on the study of the efficiency of a MEM+SCF combination. The present study attempted to investigate the in vitro activity of two types of SCF (SCF I 1:1; SCF II 2:1) combined with MEM against 34 strains of MDRAB. The results indicated a marked synergistic interaction in the majority tested isolates. Although no significant differences were observed in the activity of cefoperazone-sulbactam combined with meropenem, it revealed a novel potential option for clinical combination therapy. Meropenem belongs to the family of β-lactam antibiotics, while cefoperazone-sulbactam is a type of the third-generation cephalosporin and β-lactamase inhibitor. When meropenem is combined with cefoperazone-sulbactam, they may bind to different types of penicillin bonding proteins, executing their bactericidal effects. Concurrently, sulbactam may irreversibly inhibit β-lactamase activity. This may be the most probable explanation for the synergism observed. MINO was active against MDRAB whenever it is used alone or combination. Although it is only a second-line antibiotic for the majority of clinical bacterial infections, its potential antibacterial activity against MDRAB should not be neglected. In the present study, the combination of AK+CIP produced an antagonism of 70.59%. Therefore, the combined use of these drugs should be avoided in clinical practice.

In conclusion, the identification of fingerprinting diversity highlights the issues with the polyclonal and horizontal spread of MDRAB in the Second Xiangya Hospital. Although the co-occurrence of numerous resistance-encoding genes presented a completely threaten for the active therapy, the determination of efficacious combinations among minocycline, meropenem and cefoperazone-sulbactam, particularly MEM+SCFI and MEM+SCFII, provides improved choices for the rational clinical combination therapy for MDRAB infections. Additionally, MINO may be the alternative choice to overcome the critical resistance of A. baumannii. The present study failed to depict the pharmacokinetics and pharmacodynamics of these drug combinations. Future studies should focus on updating these data and proceed to additionally identify the clinical effects of combination therapy.

Acknowledgements

The present study was supported by the China National Natural Scientific Foundation (grant no. 81470133), and the Science and Technology Planning Project of Hunan Province of China (grant no. 2015JC3035).

References

1 

Visca P, Seifert H and Towner KJ: Acinetobacter infection - an emerging threat to human health. IUBMB Life. 63:1048–1054. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Munoz-Price LS and Weinstein RA: Acinetobacter infection. N Engl J Med. 358:1271–1281. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Dent LL, Marshall DR, Pratap S and Hulette RB: Multidrug resistant Acinetobacter baumannii: A descriptive study in a city hospital. BMC Infect Dis. 10:1962010. View Article : Google Scholar : PubMed/NCBI

4 

Principe L, D'Arezzo S, Capone A, Petrosillo N and Visca P: In vitro activity of tigecycline in combination with various antimicrobials against multidrug resistant Acinetobacter baumannii. Ann Clin Microbiol Antimicrob. 8:182009. View Article : Google Scholar : PubMed/NCBI

5 

Lim TP, Tan TY, Lee W, Sasikala S, Tan TT, Hsu LY and Kwa AL: In-vitro activity of polymyxin B, rifampicin, tigecycline alone and in combination against carbapenem-resistant Acinetobacter baumannii in Singapore. PLoS One. 6:e184852011. View Article : Google Scholar : PubMed/NCBI

6 

Weng XB and Mi ZH: Phylogenetic analysis on pandrug-resistant Acinetobacter baumannii strains. Zhonghua Liu Xing Bing Xue Za Zhi. 32:948–949. 2011.(In Chinese). PubMed/NCBI

7 

Zhao WS, Liu GY, Mi ZH and Zhang F: Coexistence of blaOXA-23 with armA and novel gyrA mutation in a pandrug-resistant Acinetobacter baumannii isolate from the blood of a patient with haematological disease in China. J Hosp Infect. 77:278–279. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Wen Y, Ouyang Z, Yu Y, Zhou X, Pei Y, Devreese B, Higgins PG and Zheng F: Mechanistic insight into how multidrug resistant Acinetobacter baumannii response regulator AdeR recognizes an intercistronic region. Nucleic Acids Res. 45:9773–9787. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Yang H, Huang L, Barnie PA, Su Z, Mi Z, Chen J, Aparna V, Kumar D and Xu H: Characterization and distribution of drug resistance associated β-lactamase, membrane porin and efflux pump genes in MDR A. Baumannii isolated from Zhenjiang, China. Int J Clin Exp Med. 8:15393–15402. 2015.PubMed/NCBI

10 

Jiang W, Liu H, Zhong M, Yang YC, Xiao DW and Huang WF: Study on the resistant genes to carbapenems and epidemiological characterization of multidrug-resistant Acinetobacter baumannii isolates. Microb Drug Resist. 19:117–123. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Ramirez MS and Tolmasky ME: Aminoglycoside modifying enzymes. Drug Resist Updat. 13:151–171. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Petersen A, Guardabassi L, Dalsgaard A and Olsen JE: Class I integrons containing a dhfrl trimethoprim resistance gene cassette in aquatic Acinetobacter spp. FEMS Microbiol Lett. 182:73–76. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Azizi O, Shakibaie MR, Badmasti F, Modarresi F, Ramazanzadeh R, Mansouri S and Shahcheraghi F: Class 1 integrons in non-clonal multidrug-resistant Acinetobacter baumannii from Iran, description of the new blaIMP-55 allele in In1243. J Med Microbiol. 65:928–936. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Tada T, Miyoshi-Akiyama T, Kato Y, Ohmagari N, Takeshita N, Hung NV, Phuong DM, Thu TA, Binh NG, Anh NQ, et al: Emergence of 16S rRNA methylase-producing Acinetobacter baumannii and Pseudomonas aeruginosa isolates in hospitals in Vietnam. BMC Infect Dis. 13:2512013. View Article : Google Scholar : PubMed/NCBI

15 

Lee JK, Lee YS, Park YK and Kim BS: Mutations in the gyrA and parC genes in ciprofloxacin-resistant clinical isolates of Acinetobacter baumannii in Korea. Microbiol Immunol. 49:647–653. 2005. View Article : Google Scholar : PubMed/NCBI

16 

American Thoracic Society, . Infectious Diseases Society of America: Guidelines for the management of adults with hospital-acquired, ventilator-associated, and healthcare-associated pneumonia. Am J Respir Crit Care Med. 171:388–416. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Clinical and Laboratory Standards Institute: Performance standards for antimicrobial susceptibility testing: Twenty-second informational supplement M100-S21. CLSI. 31:64–65. 2011.

18 

Zhang T, Wang M, Xie Y, Li X, Dong Z, Liu Y, Wang L, Yang M, Song H, Cao H and Cao W: Active efflux pump adeB is involved in multidrug resistance of Acinetobacter baumannii induced by antibacterial agents. Exp Ther Med. 13:1538–1546. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J and Wheeler DL: GenBank. Nucleic Acids Res. 33:(Database Issue). D34–D38. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Daoud Z, Mansour N and Masri K: Synergistic combination of carbapenems and colistin against P. aeruginosa and A. baumannii. Open J Med Microbiol. 3:253–258. 2013. View Article : Google Scholar

21 

Huang J, Chen EZ, Qu HP, Mao EQ, Zhu ZG, Ni YX, Han LZ and Tang YQ: Sources of multidrug-resistant Acinetobacter baumannii and its role in respiratory tract colonization and nosocomial pneumonia in intensive care unit patients. Chin Med J (Engl). 126:1826–1831. 2013.PubMed/NCBI

22 

Xu T, Xia W, Rong G, Pan S, Huang P and Gu B: A 4-year surveillance of antimicrobial resistance patterns of Acinetobacter baumanni in a university-affiliated hospital in China. J Thorac Dis. 5:506–512. 2013.PubMed/NCBI

23 

Koeleman JG, Stoof J, Biesmans DJ, Savelkoul PH and Vandenbroucke-Grauls CM: Comparison of amplified ribosomal DNA restriction analysis, random amplified polymorphic DNA analysis, and amplified fragment length polymorphism fingerprinting for identification of Acinetobacter genomic species and typing of Acinetobacter baumannii. J Clin Microbiol. 36:2522–2529. 1998.PubMed/NCBI

24 

Fontana C, Favaro M, Minelli S, Bossa MC, Testore GP, Leonardis F, Natoli S and Favalli C: Acinetobacter baumannii in intensive care unit: A novel system to study clonal relationship among the isolates. BMC Infect Dis. 8:792008. View Article : Google Scholar : PubMed/NCBI

25 

Niranjan DK, Singh NP, Manchanda V, Rai S and Kaur IR: Multiple carbapenem hydrolyzing genes in clinical isolates of Acinetobacter baumannii. Indian J Med Microbiol. 31:237–241. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Feizabadi MM, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M, Soroush S and Mohammadi-Yegane S: Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis. 61:274–278. 2008.PubMed/NCBI

27 

Thapa B, Tribuddharat C, Srifuengfung S and Dhiraputra C: High prevalence of bla(OXA)-23 in oligoclonal carbapenem-resistant Acinetobacter baumannii from Siriraj Hospital, Mahidol University, Bangkok, Thailand. Southeast Asian J Trop Med Public Health. 41:625–635. 2010.PubMed/NCBI

28 

Chen Z, Liu W, Zhang Y, Li Y, Jian Z, Deng H, Zou M and Liu Y: Molecular epidemiology of carbapenem-resistant Acinetobacter spp. from XiangYa Hospital, in Hunan Province, China. J Basic Microbiol. 53:121–127. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Sung JY, Kwon KC, Cho HH and Koo SH: Antimicrobial resistance determinants in imipenem-nonsusceptible Acinetobacter calcoaceticus-baumannii complex isolated in Daejeon, Korea. Korean J Lab Med. 31:265–270. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Peymani A, Farajnia S, Nahaei MR, Sohrabi N, Abbasi L, Ansarin K and Azhari F: Prevalence of class 1 integron among multidrug-resistant Acinetobacter baumannii in Tabriz, northwest of Iran. Pol J Microbiol. 61:57–60. 2012.PubMed/NCBI

31 

Farajnia S, Azhari F, Alikhani MY, Hosseini MK, Peymani A and Sohrabi N: Prevalence of PER and VEB type extended spectrum betalactamases among multidrug resistant acinetobacter baumannii Isolates in North-West of Iran. Iran J Basic Med Sci. 16:751–755. 2013.PubMed/NCBI

32 

Yoon EJ, Courvalin P and Grillot-Courvalin C: RND-type efflux pumps in multidrug-resistant clinical isolates of Acinetobacter baumannii: Major role for AdeABC overexpression and AdeRS mutations. Antimicrob Agents Chemother. 57:2989–2995. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Jones RN, Barry AL, Packer RR, Gregory WW and Thornsberry C: In vitro antimicrobial spectrum, occurrence of synergy, and recommendations for dilution susceptibility testing concentrations of the cefoperazone-sulbactam combination. J Clin Microbiol. 25:1725–1729. 1987.PubMed/NCBI

34 

Barry AL and Jones RN: Criteria for disk susceptibility tests and quality control guidelines for the cefoperazone-sulbactam combination. J Clin Microbiol. 26:13–17. 1988.PubMed/NCBI

35 

Pei G, Mao Y and Sun Y: In vitro activity of minocycline alone and in combination with cefoperazone-sulbactam against carbapenem-resistant Acinetobacter baumannii. Microb Drug Resist. 18:574–577. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Deveci A, Coban AY, Acicbe O, Tanyel E, Yaman G and Durupinar B: In vitro effects of sulbactam combinations with different antibiotic groups against clinical Acinetobacter baumannii isolates. J Chemother. 24:247–252. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen F, Wang L, Wang M, Xie Y, Xia X, Li X, Liu Y, Cao W, Zhang T, Li P, Li P, et al: Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China. Oncol Lett 15: 2305-2315, 2018.
APA
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X. ... Yang, M. (2018). Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China. Oncology Letters, 15, 2305-2315. https://doi.org/10.3892/ol.2017.7600
MLA
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X., Liu, Y., Cao, W., Zhang, T., Li, P., Yang, M."Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China". Oncology Letters 15.2 (2018): 2305-2315.
Chicago
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X., Liu, Y., Cao, W., Zhang, T., Li, P., Yang, M."Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China". Oncology Letters 15, no. 2 (2018): 2305-2315. https://doi.org/10.3892/ol.2017.7600
Copy and paste a formatted citation
x
Spandidos Publications style
Chen F, Wang L, Wang M, Xie Y, Xia X, Li X, Liu Y, Cao W, Zhang T, Li P, Li P, et al: Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China. Oncol Lett 15: 2305-2315, 2018.
APA
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X. ... Yang, M. (2018). Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China. Oncology Letters, 15, 2305-2315. https://doi.org/10.3892/ol.2017.7600
MLA
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X., Liu, Y., Cao, W., Zhang, T., Li, P., Yang, M."Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China". Oncology Letters 15.2 (2018): 2305-2315.
Chicago
Chen, F., Wang, L., Wang, M., Xie, Y., Xia, X., Li, X., Liu, Y., Cao, W., Zhang, T., Li, P., Yang, M."Genetic characterization and in vitro activity of antimicrobial combinations of multidrug-resistant Acinetobacter baumannii from a general hospital in China". Oncology Letters 15, no. 2 (2018): 2305-2315. https://doi.org/10.3892/ol.2017.7600
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team