International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Esophageal squamous cell carcinoma (ESCC) is the most malignant lesion in China, particularly in Linzhou, Henan (1). Treatment of ESCC is largely useless due to the occurrence of invasion and metastasis in the early stage. However, the mechanism of invasion and metastasis of ESCC has been poorly elucidated (2).
Epithelial-to-mesenchymal transition (EMT) now is always viewed as a key event that occurs during cancer invasion and metastasis. However, current understanding of the alterations that give rise to the occurrence of EMT is limited. MicroRNAs (miRNA/miRs) are small non-coding RNA molecules that may directly regulate target gene expression by binding to their 3′-untranslated regions (3′-UTRs) (3,4). Furthermore, miRNAs have been demonstrated to serve notable functions in tumor invasion and metastasis by functioning as EMT suppressors or inducers (5,6). miR-106b is a type of miRNA transcribed from the miR-106b-25 cluster located on chromosome 7 (7). Yau et al (8) reported that miR-106b overexpressed in hepatocellular carcinoma cells and that the overexpression of miR-106b may promote cell migration and metastasis by activating the EMT process. Zhou et al (9) additionally demonstrated that miR-106b contributed as an EMT inducer in breast cancer. However, whether miR-106b participates in the invasion and metastasis process of ESCC by inducing EMT and the mechanism of how miR-106b induces EMT in ESCC had not been fully explored until now.
miRNAs participate in the occurrence and development of a cancer by regulating the post-transcriptional process of their target gene. Several genes have been verified to be the targets of miR-106b, including transforming growth factor-β type II receptor, cyclin dependent kinase inhibitor 1A, DLC-1 Rho GTPase activating protein, signal transducer and activator of transcription 3 and mitogen-activated protein kinase 14 (7,10–12). Phosphatase and tensin homolog (PTEN), a key negative regulator of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, is also a direct target of miR-106b (13). One previous study had reported that PTEN served as a tumor-suppressing gene in cancer invasion and metastasis (14). Additionally, PTEN is a key factor in inducing EMT (15). However, whether miR-106b regulates the expression and activity of PTEN in ESCC has never been previously elucidated, to the best of our knowledge.
In the present study, it was determined that the expression of miR-106b was substantially higher in ESCC tissues and cell lines compared with non-tumorous tissues and cells. Furthermore, it was demonstrated that the upregulation of miR-106b was significantly associated with ESCC tissues lymph node metastasis and that the reduction of miR-106b expression in ESCC cell lines may inhibit cell metastasis, invasion and proliferation. Further mechanism exploration revealed that PTEN was a direct target of miR-106b. Therefore, miR-106b may participate in the invasion and metastasis of ESCC via PTEN mediated EMT.
Samples of ESCC tissues and adjacent normal mucosa in paraffin-embedded blocks were collected from 32 patients who were undergoing an esophagectomy in the First Affiliated Hospital of Zhengzhou University (Henan, China). The mean age of the 32 patients (14 females and 18 males) was 60.7±8.1 years (range, 40–78). None of the patients had received radiation therapy or chemotherapy prior to surgery. All specimens were dissected, transferred and frozen immediately in liquid nitrogen at 196°C for RNA extraction. The present study was approved by the Ethics Committee of Zhengzhou University (Henan, China) and written informed consent was obtained from all patients prior to surgery.
Immoral embryonic esophageal epithelium cell line SHEE and the esophageal squamous cell carcinoma cell lines EC-1 and EC9706 were all maintained at 37°C and 5% CO2, in RPMI-1640 medium with 10% fetal calf serum (Hangzhou Sijiqing Bioengineering Material Co., Hangzhou, China), supplemented with 100 µg/ml streptomycin and 100 U/ml penicillin G. Transfection was generally performed on cells that were at ~65% density. miR-106b inhibitor purchased from GE Healthcare Dharmacon, Inc. (Lafayette, CO, USA) was transfected into EC-1 or EC9706 cells by using Lipofectamine® 2000 at room temperature for 6 h (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). EC-1 or EC9706 cells transfected with scrambled miRNA purchased from GE Healthcare Dharmacon, Inc., or blank EC-1 or EC9706 cells were used respectively as negative or blank controls. For mRNA and protein assays, cells were all collected after 48 h of transfection. PTEN siRNA designed and synthesized by Zhengzhou Chuangsheng Company Co., Ltd. (Zhengzhou, China) were transfected together with miR-106b inhibitor or scrambled miRNA into EC-1 or EC9706 cells by using Lipofectamine® 2000 at room temperature for 6 h. EC-1 or EC9706 cells transfected individually with PTEN siRNA or blank EC-1 cells were used as the control.
Total RNA was extracted using either an miRNeasy kit (Qiagen, Inc., Valencia, CA, USA) or TriReagent (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at room temperature for 10 min according to the manufacturer's protocols from tissues lysates or cell samples and reverse transcribed to cDNA with TaqMan® miRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) or tranScript First-strand cDNA Synthesis SuperMix kit (Qiagen, Inc.). The relative expression levels of miR-106b were determined using the TaqMan® MicroRNA Assay (Applied Biosystems; Thermo Fisher Scientific, Inc.) protocol specific for miR-106b and were normalized to that of internal control U6 by using the 2−ΔΔCq method (16) While the relative expression levels of PTEN were determined using the STBR Premix Ex Taq™ kit (Qiagen GmbH, Hilden, Germany) with the following primers: PTEN sense, ACTGGACCACCTAATTGCTGT and antisense, GCAAACTTTTACACTGGCAGC; E-cadherin forward, CTCAAAGCCCAGAATCCCCA and reverse, CGGTTTTCTGTGCACACCTG; vimentin forward, TCCGCACATTCGAGCAAAGA and reverse, ATTCAAGTCTCAGCGGGCTC. The relative amount of mRNA was normalized by using β-actin. Experiments were performed in triplicate. The thermal cycle for miRNA was: 94°C for 3 min; 95°C for 15 sec; 65°C 40 times for 40 sec; and 62°C for 40 sec. For others the thermal cycle was: 95°C for, 10 min; 94°C for 40 sec; 56°C for 35sec; 72°C 30 times for 60 sec; and 72°C for 10 min.
The protein contents of tissues or cell lysates were measured using a BCA kit (Beyotime Institute of Biotechnology, Shanghai, China). Then suitable amount of total protein of each sample (10–20 µg) was separated by 10% SDS-PAGE. Following vertical electrophoretic separation, proteins were shifted to polyvinylidene fluoride (PVDF) membranes by wet transfer. Subsequently, the PVDF membranes were blocked with 5% fat-free milk for 1 h at room temperature, and then incubated with rabbit anti-PTEN antibodies (dilution 1:1,000; cat no. AF1426) rabbit anti-E-cadherin (dilution 1:500; cat. no. AF0138) and rabbit anti-vimentin (dilution 1:1,000; cat. no. AF1975) (all from Beyotime Institute of Biotechnology) at 4°C overnight. Following washing the membranes for three times in tris-buffered saline with Tween-20 (TBST), the membranes were incubated with HRP-conjugated secondary antibody (dilution 1:5,000; cat. no. A0208; Beyotime Institute of Biotechnology) at room temperature for 1 h. Subsequent to washing three times with TBST again, exposure and development were performed using an ECL Chemiluminescence Detection kit (GE Healthcare Life Sciences, Little Chalfont, UK) and the densities were measured using the GS-900™ Calibrated Densitometer with ImageLab 4.1 software from Bio-Rad Laboratories, Inc. (Hercules, CA, USA). All of the assays were performed in triplicate.
A Boyden chamber invasion assay was performed as previously described (17). Briefly, the upper chamber was coated with Matrigel were filled with EC-1 or EC9706 cells suspended in serum-free RPMI-1640 medium, while the lower chamber was loaded with RPMI-1640 medium with 10% fetal calf serum. EC-1 or EC9706 cells were allowed to invade through the filter for 48 h at 37°C and the cells on the upper sides were removed using cotton swabs. The cells that invaded to the lower side were subjected to H&E staining at room temperature for 7 min and calculated in five random fields per membrane under inverted microscopy at ×200 magnification. Migration experiments were performed in triplicate.
EC-1 (5×105) or EC9706 cells (5×105) were plated into 12-well plates and grew to 70% confluence. Then, a constant wide wound (1 mm) was created using a plastic tip on monolayer cultured EC-1 or EC9706 cells. A total of 48 h after the migration of EC-1 or EC9706 cells, the average migrating distance was measured under an inverted microscope and photographed at ×200 magnification.
The proliferation ability of EC-1 or EC9706 cells was measured using a CCK-8 kit according to the manufacturer's instructions. In briefly, EC-1 or EC9706 cells were seeded into 96-well plates at a density of 5×103 cells/well and incubated for 48 h at room temperature. Subsequently, 10 µl CCK-8 solution was added to the well and cultured for another 1 h at room temperature. The optical density was calculated by measuring the absorbance at 450 nm. All of the experiments were performed in triplicate.
The prediction of the 3′UTR of PTEN as a binding target of miR-106b was checked by using PicTar (pictar.mdc-berlin.de) and Targetscan (www.targetscan.org).
Pmir-REPORT system (Promega Corporation, Madison, WI, USA) was used to determine whether PTEN was a direct target of miR-106b. 3′UTR of the PTEN gene was amplified, sub-cloned into the pmirGLO luciferase reporter vector and amplified in DH5α. The resulting reporter vector was designated as pmirGLO-PTEN-WT. A site-directed mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) was used to produce the mutant type of PTEN 3′UTR luciferase reporter vector (pmirGLO-PTEN-MUT), according to the manufacturer's protocol. The luciferase reporter vectors were verified by sequencing. miR-106b inhibitor or scrambled miRNA, 100 ng pmirGLO-PTEN-WT or pmirGLO-PTEN-MUT was co-transfected into EC-1 cells in 6-well plates using Lipofectamine® 2000 at room temperature. After 48 h, luciferase activity was measured using a Dual-Luciferase Reporter Assay system (Promega Corporation).
Statistical analysis was performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). Multi-group comparisons were performed using a one-way analysis of variance test with a least significant difference test used for post-hoc comparisons. P<0.05 was considered to indicate a statistically significant difference. And the data were presented as the mean ± the standard deviation.
To evaluate the expression levels of miR-106b in ESCC tissues and adjacent normal mucosa tissues, RT-qPCR was performed. The results revealed that the expression levels of miR-106b in ESCC tissues were significantly increased compared with those in adjacent normal mucosa tissue (P<0.01; Fig. 1A). miR-106b has been reported to serve a notable function in cancer invasion and metastasis, thus the association between miR-106b and the clinicopathological parameters of patients with ESCC was analyzed. As was expected, the upregulation of miR-106b was significantly associated with lymph node metastasis (P<0.05; Fig. 1B). Then, the expression levels of miR-106b were examined in ESCC cell lines EC-1 and EC9706. They were revealed to be significantly higher, compared with that in the immortal embryonic esophageal epithelium cell line SHEE (P<0.05). These findings suggest that miR-106b may promote tumorigenesis in ESCC (Fig. 1C).
To further elucidate the function of miR-106b in ESCC invasion and metastasis, miR-106b inhibitor was transfected into EC-1 or EC9076 cells to investigate the effects of the downregulation of miR-106 on the invasion and metastasis ability of ESCC cell lines. EC-1 cells transfected with scrambled miRNA and vacant EC-1 cells were used as negative and blank controls, respectively. The results of RT-qPCR revealed that miR-106b inhibitor significantly decreases miR-106b expression compared with those in control groups 48 h after transfection in EC-1 cells (P<0.01; Fig. 2A).
Then, the function of miR-106b in ESCC cells was evaluated by measuring the cell invasion and metastasis ability of EC-1 cells which were transfected with miR-106b inhibitor. EC-1 cells transfected with scrambled miRNA or vacant EC-1 cells were used as negative and blank controls, respectively. Compared with the control groups, the number of EC-1 cells transfected with miR-106b inhibitor that traversed the Matrigel were significantly lower (P<0.05; Fig. 2B). The results of a wound-healing assay further indicated the function of miR-106b in the invasion and metastasis of EC-1 cells. The wound healing ability of EC-1 cells transfected with miR-106b inhibitor was significantly decreased compared with those in control groups (P<0.01; Fig. 2C).
The increase of the invasion and metastasis ability of cancer cells is usually closely associated with an increase of the proliferation ability. Thus, the effects of miR-106b inhibitor on the proliferation ability of EC-1 cells were examined by using a CCK-8 assay. The results revealed that the downregulation of miR-106b inhibited cell proliferation significantly compared with control groups at 48 and 72 h (Fig. 2D), indicative that the expression change of miR-106b may alter the proliferation of ESCC cells.
Then similar results were obtained in EC9706 cells (Fig. 2E-H). Thus, it may be concluded that miR-106b is an important factor in the invasion and metastasis process of ESCC cells.
Previous evidence has reported that miRNAs promote invasion and metastasis through mediating EMT (18). In order to evaluate the function of miR-106b in inducing EMT in ESCC, we examined the mRNA and protein expression of the epithelial marker E-cadherin and the mesenchymal marker vimentin in EC-1 cells. As presented in Fig. 3A and B, with the downregulation of miR-106b in EC-1 cells, the mRNA and protein expression levels of E-cadherin were significantly increased compared with those in control groups (P<0.05), whilst the expression levels of vimentin were significantly decreased compared with the control groups (P<0.05). Additionally, similar results were revealed in EC9706 cells (Fig. 3C and D). Thus, miR-106b was concluded to be capable of advancing invasion and metastasis by regulating EMT in ESCC cells. Due to its predominant function in ESCC EMT, miR-106b may be used as a target to limit EMT-associated invasion and metastasis.
Although the major function of miR-106b in the occurrence and development of ESCC had already been elucidated, the mechanism by which miR-106b promoted invasion and metastasis had yet to be determined in ESCC cell lines. PTEN, a tumor suppressor, is known to be a negative regulator of the PI3K-Akt pathway. Loss or downregulation of PTEN has been identified in numerous different cancer types, including ESCC, and has been revealed to be associated with the invasive properties of cancer cells. By using PicTar and TargetScan software, miR-106b was revealed to have a putative biding site in the 3′-UTR of PTEN. In order to validate whether PTEN was a functional target of miR-106b, miR-106b inhibitor or scrambled miRNA was co-transfected with pmirGLO-PTEN-WT or pmirGLO-PTEN-MUT in ESCC cells. As presented in Fig. 4A, ESCC cells with miR-106b inhibitor and pmirGLO-PTEN-WT co-transfection presented a significant increase in reporter activity compared with ESCC cells with scrambled miRNA and pmirGLO-PTEN-WT co-transfection (P<0.05). Furthermore, ESCC cells co-transfected with miR-106b inhibitor and pmirGLO-PTEN-MUT or scrambled miRNA with pmirGLO-PTEN-MUT demonstrated no statistically significant change in reporter activity (Fig. 4A). Thus, the luciferase activity of the wild type PTEN-3′-UTR but not the mutated PTEN-3′-UTR reporter was reduced by miR-106b in ESCC cells. In order to further verify the regulatory effects of miR106b on PTEN, RT-qPCR and western blot analysis were used to check the expression levels of PTEN. The results revealed that with the downregulation of miR-106b in EC-1 or EC9706 cells, the mRNA and protein expression of PTEN were significantly increased (P<0.05; Fig. 4B-E). However, the mRNA and protein expression of PTEN in EC-1 or EC9706 cells transfected with scrambled miRNA demonstrated no significant difference compared with vacant EC-1 or EC9706 cells (Fig. 4B-E). These results indicate that miR-106b may regulate the expression of PTEN in ESCC cells.
PTEN has been reported to participate in invasion and metastasis (19). In order to evaluate whether miR-106b may participate in the invasion and metastasis of ESCC by regulating the expression of PTEN, PTEN siRNA was chemically synthesized and co-transfected into EC-1 or EC9706 cells with miR-106b inhibitor. PTEN siRNA co-transfected with scrambled miRNA, PTEN siRNA transfected into EC-1 or EC9706 cells alone and vacant EC-1 or EC9706 cells were used as the controls. In EC-1 cells, the expression levels of PTEN were significantly lower in the PTEN siRNA transfected group compared with the untransfected group (P<0.01; Fig. 5A). Additionally, the expression levels of PTEN were significantly lower in the PTEN siRNA and miR-106b inhibitor co-transfected group compared with the miR-106b inhibitor alone transfected group (P<0.05; Fig. 5A). A Boyden chamber invasion assay and a wound healing assay were used again to analyze the invasion and metastasis ability of EC-1 cells between different groups. A significant difference was identified in the PTEN siRNA and miR-106b inhibitor transfected group in EC-1 cells in invasion and metastasis, compared with the miR-106b inhibitor alone transfected group (P<0.05; Fig. 5B and C). In addition, the downregulation of PTEN may partially rescue the proliferation ability of EC-1 or EC9706 cells evaluated by using a CCK-8 assay, as a significant difference was identified in the PTEN siRNA transfected group (P<0.01) and the PTEN siRNA and miR-106b inhibitor transfected group (P<0.05) in EC-1 cells (Fig. 5D). In EC9706 cells, downregulation of PTEN also rescued the invasion and metastasis of EC9706 cells inhibited by miR-106b inhibitor, the only difference was that no significant difference was revealed in the proliferation ability of EC9706 cells (Fig. 5E-H). Altogether, miR-106b is potentially a key regulator in the occurrence and development process of ESCC that may occur via regulating the expression of PTEN.
miRNAs modulate EMT by impacting the expression of receptors, signaling pathways and specific ligands. PTEN serves a notable function in tumor invasion and migration, and its deletion and mutation is also present in numerous different cancer types and is associated with EMT. As had been previously suggested, miR-106b regulates the expression of PTEN by binding to its promoter. However, whether PTEN contributes to the EMT induced by miR-106b in ESCC had yet to be elucidated. In the present study, it was revealed that downregulation of PTEN in EC-1 or EC9706 cells partially rescued the EMT inhibited by decreased expression of miR-106b. The mRNA and protein expression levels of E-cadherin in EC-1 cells were significantly downregulated and levels of vimentin were significantly upregulated in cells transfected with PTEN siRNA alone compared with untransfected cells (P<0.01) and in cells transfected with PTEN siRNA and miR-106b inhibitor compared with cells transfected with miR-106b inhibitor alone (P<0.05; Fig. 6A and B). Identical results were revealed in EC9706 cells (Fig. 6C and D). Collectively, the results of the present study demonstrate that miR-106b induces EMT via suppressing the expression of PTEN.
miRNAs, small non-coding RNAs of ~22 nucleotides in length, have been demonstrated to be associated with the occurrence and development of human cancer types where they may function as tumor suppressors or oncogenes (3–6,20,21). Previous studies have demonstrated the abnormal expression of a number of types of miRNAs in ESCC (22,23). miR-106b is a member of the miR-106b-25 cluster and it has been demonstrated to be upregulated in a number of different types of cancer, including prostate cancer, hepatocellular cancer, gastric cancer, laryngeal carcinoma and breast cancer (24–28). However, its function and mechanism in ESCC have remained unclear.
In the present study, the expression levels of miR-106b in ESCC tissues were revealed to be significantly higher compared with in adjacent normal mucosa. Consistent with the data that was investigated in ESCC tissues, it was further verified that the expression levels of miR-106b in the ESCC cell lines EC-1 and EC9706 were also significantly higher compared with in the immoral embryonic esophageal epithelium cell line SHEE, suggesting that the upregulation of miR-106b may promote the occurrence of ESCC. Furthermore, significant associations were also identified between the expression levels of miR-106b and advanced stage and lymph node metastasis, indicating that the expression of miR-106b also served a notable function in ESCC invasion and metastasis.
To further elucidate the function of miR-106b in the occurrence and development of ESCC, a miR-106b inhibitor and scrambled miRNA were synthesized individually and transfected into EC-1 or EC9706 cells using Lipofectamine® 2000 for 48 h, and vacant EC-1 or EC9706 cells were used as the blank control. As expected, the expression levels of miR-106b decreased significantly in EC-1 or EC9706 cells transfected with miR-106b inhibitor compared with those transfected with scrambled miRNA or vacant EC-1 or EC9706 cells. With the drop of the expression of miR-106b, the invasion, metastasis and proliferation ability of EC-1 or EC9706 cells also dropped significantly compared with those transfected with scrambled miRNA and vacant EC-1 or EC9706 cells. These results further validate the hypothesis that miR-106b may function as an oncogene and serves an important function in the promotion of invasion, metastasis and proliferation in ESCC cells. EMT serves an integral function in cancer metastasis and emerging evidence reveals that miRNAs are involved in cancer metastasis by regulating EMT (29). In the present study, it was demonstrated that by the downregulation of miR-106b, the mRNA and protein expression of E-cadherin were increased significantly whilst the expression level of vimentin was decreased significantly. Therefore, it was concluded that miR-106b induces EMT in ESCC cells, and miR-106b potentially participates in the metastasis process of ESCC cells by inducing EMT.
PTEN, in previous years, has been widely viewed as a tumor suppressor gene, which regulates survival, growth, invasion, metastasis and proliferation (30,31). PTEN may regulate PI3K signaling by dephosphorylating the lipid signaling intermediate phosphatidylinositol (3,4,5)-trisphosphate, and a clear link between the PI3K pathway and cancer was established in the 1980s (32). miRNA always operated by binding to the 3′UTRs of their target genes and a number of previous reports have confirmed that miR-106b serves its part in colorectal cancer, gastric cancer and hepatocellular carcinoma (33,34). In the present study, it was demonstrated that miR-106b inhibition may result in the increased expression of PTEN in ESCC cells compared with those in control cells. Using cell transfection and luciferase reporter assay, it was additionally revealed that PTEN was a direct target of miR-106b. It was revealed that the depletion of PTEN by siRNA in EC-1 or EC9706 cells transfected with miR-106b inhibitor may partially reverse the effects on invasion, metastasis and proliferation caused by miR-106b downregulation. Furthermore, the depletion of PTEN partially rescued EMT inhibited by miR-106b inhibitor. These results further demonstrated that miR-106b promoted the occurrence and development of ESCC via targeting PTEN mediated EMT.
To conclude, the results of the present study suggest that miR-106b was upregulated in ESCC tissues and cell lines, particularly in ESCC tissues with lymph node metastasis. Furthermore, it was demonstrated that function of miR-106b in ESCC was dependent on regulating PTEN mediated EMT. miR-106b may be a potential therapeutic target for the treatment of ESCC.
The present study was supported by the Science and Technology Project of the Zhengzhou Municipal Science and Technology Bureau (grant no. 141PPTGG438).
|
Qi B, Lu JG, Yao WJ, Chang TM, Qin XG, Ji YH, Wang TY, Liu SG, Li HC, Liu YZ and Zhao BS: Downregulation of microRNA-382 is associated with poor outcome of esophageal squamous cell carcinoma. World J Gastroenterol. 21:6884–6891. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Wu Z, Mei Q, Li X, Guo M, Fu X and Han W: Long non-coding RNA HOTAIR, a driver of malignancy, predicts negative prognosis and exhibits oncogenic activity in oesophageal squamous cell carcinoma. Br J Cancer. 109:2266–2278. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Iorio MV and Croce CM: MicroRNA dysregulation in cancer: Diagnostics, monitoring and therapeutics. A comprehensive review. EMBO Mol Med. 4:143–159. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Schetter AJ, Okayama H and Harris CC: The Role of microRNAs in Colorectal Cancer. Cancer J. 18:244–252. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Tie J, Pan Y, Zhao L, Wu K, Liu J, Sun S, Guo X, Wang B, Gang Y, Zhang Y, et al: mir-218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1 receptor. PLoS Genet. 6:e10008792010. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Liu X, Xu W, Zhou P, Gao P, Jiang S, Lobie PE and Zhu T: c-MYC-regulated miR-23a/24-2/27a cluster promotes mammary carcinoma cell invasion and hepatic metastasis by targeting Sprouty2. J Biol Chem. 288:18121–18133. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang GJ, Li JS, Zhou H, Xiao HX, Li Y and Zhou T: MicroRNA-106b promotes colorectal cancer cell migration and invasion by directly targeting DLC1. J Exp Clin Cancer Res. 34:732015. View Article : Google Scholar : PubMed/NCBI | |
|
Yau WL, Lam CS, Ng L, Chow AK, Chan ST, Chan JY, Wo JY, Ng KT, Man K, Poon RT and Pang RW: Over-expression of miR-106b promotes cell migration and metastasis in hepatocellular carcinoma by activating epithelial-mesenchymal transition process. PLoS One. 8:e578822013. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou Y, Hu Y, Yang M, Jat P, Li K, Lombardo Y, Xiong D, Coombes RC, Raguz S and Yagüe E: The miR-106b~25 cluster promotes bypass of doxorubicin-induced senescence and increase in motility and invasion by targeting the E-cadherin transcriptional activator EP300. Cell Death Differ. 21:462–474. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wang H, Liu J, Zong Y, Xu Y, Deng W, Zhu H, Liu Y, Ma C, Huang L, Zhang L and Qin C: miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF-β type II receptor. Brain Res. 1357:166–174. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ivanovska I, Ball AS, Diaz RL, Magnus JF, Kibukawa M, Schelter JM, Kobayashi SV, Lim L, Burchard J, Jackson AL, et al: MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 28:2167–2174. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Dai F, Liu T, Zheng S, Liu Q, Yang C, Zhou J, Chen Y, Sheyhidin I and Lu X: miR-106b promotes migration and invasion through enhancing EMT via downregulation of Smad 7 in Kazakh's esophageal squamous cell carcinoma. Tumour Biol. 37:14595–14604. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng L, Zhang Y, Liu Y, Zhou M, Lu Y, Yuan L, Zhang C, Hong M, Wang S and Li X: miR-106b induces cell radioresistance via the PTEN/PI3K/AKT pathways and p21 in colorectal cancer. J Transl Med. 13:2522015. View Article : Google Scholar : PubMed/NCBI | |
|
Li Y, Cui J, Zhang CH, Yang DJ, Chen JH, Zan WH, Li B, Li Z and He YL: High-expression of DJ-1 and loss of PTEN associated with tumor metastasis and correlated with poor prognosis of gastric carcinoma. Int J Med Sci. 10:1689–1697. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yan T, Jiang X, Guo X, Chen W, Tang D, Zhang J, Zhang X, Zhang D, Zhang Q, Jia J and Huang Y: Electric field-induced suppression of PTEN drives epithelial-to-mesenchymal transition via mTORC1 activation. J Dermatol Sci. 85:96–105. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Wang T, Xuan X, Li M, Gao P, Zheng Y, Zang W and Zhao G: Astragalus saponins affect proliferation, invasion and apoptosis of gastric cancer BGC-823 cells. Diagn Pathol. 8:1792013. View Article : Google Scholar : PubMed/NCBI | |
|
Harazono Y, Muramatsu T, Endo H, Uzawa N, Kawano T, Harada K, Inazawa J and Kozaki K: miR-655 is an EMT-suppressive MicroRNA targeting ZEB1 and TGFBR2. PLoS One. 8:e627572013. View Article : Google Scholar : PubMed/NCBI | |
|
Qi Q, Ling Y, Zhu M, Zhou L, Wan M, Bao Y and Liu Y: Promoter region methylation and loss of protein expression of PTEN and significance in cervical cancer. Biomed Rep. 2:653–658. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wang W and Luo YP: MicroRNAs in breast cancer: Oncogene and tumor suppressors with clinical potential. J Zhejiang Univ Sci B. 16:18–31. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Xu M and Mo YY: The Akt-associated microRNAs. Cell Mol Life Sci. 69:3601–3612. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Mei LL, Qiu YT, Zhang B and Shi ZZ: MicroRNAs in esophageal squamous cell carcinoma: Potential biomarkers and therapeutic targets. Cancer Biomark. 19:1–9. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Sakai NS, Samia-Aly E, Barbera M and Fitzgerald RC: A review of the current understanding and clinical utility of miRNAs in esophageal cancer. Semin Cancer Biol. 23:512–521. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hudson RS, Yi M, Esposito D, Glynn SA, Starks AM, Yang Y, Schetter AJ, Watkins SK, Hurwitz AA, Dorsey TH, et al: MicroRNA-106b-25 cluster expression is associated with early disease recurrence and targets caspase-7 and focal adhesion in human prostate cancer. Oncogene. 32:4139–4147. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Li BK, Huang PZ, Qiu JL, Liao YD, Hong J and Yuan YF: Upregulation of microRNA-106b is associated with poor prognosis in hepatocellular carcinoma. Diagn Pathol. 9:2262014. View Article : Google Scholar : PubMed/NCBI | |
|
Yang Q, Zhang RW, Sui PC, He HT and Ding L: Dysregulation of non-coding RNAs in gastric cancer. World J Gastroenterol. 21:10956–10981. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Cai K, Wang Y and Bao X: miR-106b promotes cell proliferation via targeting RB in laryngeal carcinoma. J Exp Clin Cancer Res. 30:732011. View Article : Google Scholar : PubMed/NCBI | |
|
Ni X, Xia T, Zhao Y, Zhou W, Wu N, Liu X, Ding Q, Zha X, Sha J and Wang S: Downregulation of miR-106b induced breast cancer cell invasion and motility in association with overexpression of matrix metalloproteinase 2. Cancer Sci. 105:18–25. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Ma F, Li W, Liu C, Li W, Yu H, Lei B, Ren Y, Li Z, Pang D and Qian C: miR-23a promotes TGF-β1-induced EMT and tumor metastasis in breast cancer cells by directly targeting CDH1 and activating Wnt/β-catenin signaling. Oncotarget. 8:69538–69550. 2017.PubMed/NCBI | |
|
Xu W, Yang Z, Zhou SF and Lu N: Posttranslational regulation of phosphatase and tensin homolog (PTEN) and its functional impact on cancer behaviors. Drug Des Devel Ther. 8:1745–1751. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Madhunapantula SV and Robertson GP: The PTEN-AKT3 Signaling Cascade as a Therapeutic Target in Melanoma. Pigment Cell Melanoma Res. 22:400–419. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Georgescu MM: PTEN tumor suppressor network in PI3K-Akt pathway control. Genes Cancer. 1:1170–1177. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ren P, Gong F, Zhang Y, Jiang J and Zhang H: MicroRNA-92a promotes growth, metastasis, and chemoresistance in non-small cell lung cancer cells by targeting PTEN. Tumour Biol. 37:3215–25. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng X, Li J, Peng C, Zhao J, Chi J, Meng X, Yun X, Li D, Yu Y, Gao M and Li Y: MicroRNA-4 induces cisplatin resistance by targeting PTEN in human tongue squamous cell carcinoma. Oral Oncol. 51:998–1003. 2015. View Article : Google Scholar : PubMed/NCBI |