Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins

  • Authors:
    • Yateng Tie
    • Chong Chen
    • Yanli Yang
    • Zhen Qian
    • Hang Yuan
    • Huan Wang
    • Haili Tang
    • Yao Peng
    • Xilin Du
    • Bin Liu
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Lanzhou General Hospital of the People's Liberation Army, Lanzhou, Gansu 730050, P.R. China, Department of Neurosurgery, 451st Central Hospital of the People's Liberation Army, Xi'an, Shaanxi 710054, P.R. China, Department of Pathology, Tianjin Children's Hospital, Tianjin 300134, P.R. China, Department of General Surgery, Tangdu Hospital, The Fourth Military Medical University, Xi'an, Shaanxi 710032, P.R. China, Department of Gastroenterology, The First Affiliated Hospital of Sun Yat‑Sen University, Guangzhou, Guangdong 510080, P.R. China
  • Pages: 8695-8702
    |
    Published online on: April 2, 2018
       https://doi.org/10.3892/ol.2018.8410
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Colorectal cancer (CRC) is one of the most frequently occurring primary malignant tumors worldwide. Chemotherapeutic resistance is a major clinical problem in the treatment of CRC. Therefore, it is of great importance to investigate novel biomarkers that may predict chemoresistance and facilitate the development of individualized treatment for patients with CRC. The present study reported that let‑7f‑5p expression was elevated in chemotherapy‑resistant CRC tissues compared with chemotherapy‑sensitive tissues. Furthermore, upregulating let‑7f‑5p increased the expression levels of the anti‑apoptotic proteins, B‑cell lymphoma 2 (Bcl‑2) and B‑cell lymphoma‑extra large (Bcl‑xL), and decreased the activity of caspase‑3 and caspase‑9 in CRC cells. By contrast, downregulating let‑7f‑5p yielded the opposite effect. Notably, the results indicated that let‑7f‑5p promoted chemotherapeutic resistance by directly repressing the expression of several pro‑apoptotic proteins, including tumor protein p53, tumor protein p53‑inducible nuclear protein 1, tumor protein p53‑inducible nuclear protein 2 and caspase‑3. Therefore, a novel mechanism by which let‑7f‑5p enhances the resistance of CRC cells to chemotherapeutics has been revealed, indicating that silencing let‑7f‑5p may become an effective therapeutic strategy against CRC.

Introduction

Colorectal cancer (CRC) is one of the most prevalent causes of cancer-associated mortality worldwide (1,2). Clinically, 5-fluorouracil (5-FU)-based chemotherapy serves as the initial first-line chemotherapeutic drug of choice in patients with CRC; however, the response rates to 5-FU are ~15% in patients with advanced CRC (3). Although novel therapeutic approaches, including combination chemotherapy of 5-FU and oxaliplatin (FOLFOX) or irinotecan (FOLFIRI), have presented promising potential, the majority of the patients continue to exhibit inadequate responses (4,5). The failure of chemotherapy in CRC patients is primarily attributed to therapeutic resistance following a long period of treatment (6). These observations emphasize that chemotherapeutic resistance is a major obstacle in the treatment of CRC, and that the molecular mechanisms underlying this issue remain unclear.

Chemotherapeutic resistance poses a major challenge in cancer chemotherapy. Chemoresistance of tumor cells develops primarily due to acquired resistance de novo, following an initially sensitive response, and/or in combination with pre-established cell-intrinsic mechanisms (7). A number of well-established mechanisms are reported to be involved in cancer drug resistance, including failure of the drug to reach or enter the target cell, formation of efflux pumps on the surface of tumor cells, increased expression of anti-apoptotic proteins, induction of drug-detoxifying mechanisms and upregulation of DNA repair enzymes (8,9). However, there is an absence of integral understanding of acquired drug resistance in the context of CRC. Such insight may be crucial for the development of an effective therapeutic approach to overcome chemoresistance and to improve clinical therapeutic response in CRC.

MicroRNAs (miRNAs/miRs) are small non-coding RNAs composed of 19–25 nucleotides, which are involved in numerous biological processes, including survival, apoptosis, the cell cycle and gene regulation (10,11). miRNAs regulate downstream target gene expression at a post-transcriptional level by binding with specific sequences in the 3′-untranslated region (3′-UTR) of downstream target genes, leading to mRNA degradation and/or translational inhibition (12). Several lines of evidence have indicated that aberrant expression of miRNAs is involved in the progression and metastasis of different types of cancer (13–18). Furthermore, research has indicated that upregulation or downregulation of a certain miRNA (let-7a) was directly correlated with the response to chemotherapeutic agents (19). Emerging evidence has demonstrated that miRNAs are key regulators in the chemotherapeutic resistance of CRC. Ectopic expression of miR-125a/b restored paclitaxel sensitivity through downregulation of aldehyde dehydrogenase 1 in HT29 cells (20). Furthermore, Zhang et al (21) revealed that miR-587 promoted the resistance of CRC cells to 5-FU via inhibiting protein phosphatase 2 scaffold subunit Aβ. Notably, silencing miR-587 re-sensitized CRC cells to 5-FU. These observations indicated that miRNAs may function as tumor-suppressors or inducers in CRC.

The present study demonstrated that let-7f-5p expression was elevated in chemotherapy-resistant CRC tissues compared with chemotherapy-sensitive tissues. Furthermore, upregulating let-7f-5p increased the expression of the anti-apoptotic proteins, B-cell lymphoma 2 (Bcl-2) and B-cell lymphoma-extra large (Bcl-xL), and decreased the activity of caspase-3 and caspase-9 in CRC cells. Conversely, downregulating let-7f-5p decreased the expression of Bcl-2 and Bcl-xL, and increased the activity of caspase-3 and caspase-9 in CRC cells. Of note, the results of the present study indicated that let-7f-5p promotes chemotherapy-resistance via directly repressing the expression of several pro-apoptotic proteins, including tumor protein p53 (TP53), TP53-inducible nuclear protein 1, TP53-inducible nuclear protein 2 and caspase-3. Therefore, the present study identified a novel mechanism by which let-7f-5p enhances the resistance of CRC cells to chemotherapeutics, indicating that therapy targeting let-7f-5p in combination with chemotherapeutics may become an effective therapeutic strategy against CRC.

Materials and methods

The Cancer Genome Atlas (TCGA) analysis

The miRNA dataset of colorectal cancer was downloaded from the TCGA and obtained the expression value(s) of the corresponding genes from the Level 3 data of each sample. The unit of miRNA expression levels in TCGA is Reads per kilobase of exon model per million mapped reads (RKPM). Analysis of the log2 value of each sample was performed using Excel 2010 and GraphPad 5 (GraphPad Software, Inc., La Jolla, CA, USA). Furthermore, statistical analysis of the miRNA expression levels within colorectal cancer tissues was performed using paired t-test or unpaired t-test.

Cell lines and cell culture

The human CRC HCT116 and SW480 cell lines were obtained from Type Culture Collection Chinese Academy of Sciences (Shanghai, China) and were cultured in RPMI-1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with penicillin G (100 U/ml), streptomycin (100 mg/ml) and 10% fetal bovine serum (Thermo Fisher Scientific, Inc.). HCT116 and SW480 cells were incubated in 10 µmol/l 5-FU for 24 h, as previously described (22,23). The cells were incubated at 37°C in a humidified atmosphere with 5% CO2 and were routinely sub-cultured using 0.25% (w/v) trypsin-ethylenediaminetetraacetic acid solution (Thermo Fisher Scientific, Inc.).

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from cells using an RNA Isolation kit (Qiagen, Inc., Valencia, CA, USA), according to the manufacturer's protocol. mRNA and microRNA (miRNA) were reverse transcribed from total RNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. cDNA was amplified and quantified on the CFX96 system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using iQ SYBR-Green (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: 95°C for 3 min, then 35 cycles of 95°C for 5 sec, 60°C for 15 sec, and 72°C for 15 sec followed by 72°C for 10 min. The primer sequences are provided in Table I. Primers for U6 and let-7f-5p were synthesized and purified by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). U6 or GAPDH were used as endogenous controls. Relative fold expression was calculated using the 2−ΔΔCq method (24).

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction.

Primer Sequence (5′-3′)
TP53Forward GCTCGACGCTAGGATCTGAC
Reverse GCTTTCCACGACGGTGAC
TP53INP1Forward TATGCTGCCCCATTTCATTT
Reverse CTGTGCATAACTCCTGCCCT
TP53INP2Forward TGAAGAAGAGGCTGGAGAGG
Reverse CTCCCAGCTGTTTGGATCAC
Caspase-3Forward TCGCTTCCATGTATGATCTTTG
Reverse CTGCCTCTTCCCCCATTCT
Bcl-2Forward GTGGATGACTGAGTACCTGAACC
Reverse AGACAGCCAGGAGAAATCAAAC
Bcl-xLForward GGTATTGGTGAGTCGGATCG
Reverse TGCTGCATTGTTCCCATAGA
GAPDHForward ATTCCACCCATGGCAAATTC
Reverse TGGGATTTCCATTGATGACAAG

[i] TP53, tumor protein p53; TP53INP1, TP53-inducible nuclear protein 1; TP53INP2; TP53-inducible nuclear protein 2; Bcl-2, B-cell lymphoma 2; Bcl-xL, B-cell lymphoma-extra large.

Transfection

let-7f-5p mimics, inhibitors and respective control RNAs, including siRNA scramble and negative controls, (50 nmol/l) were synthesized and purified by Guangzhou RiboBio Co., Ltd. Transfection of miRNA, siRNAs and plasmids was performed using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), 48 h after transfection, cells were harvest and the indicated experiments were performed, according to the manufacturer's protocol.

Western blot analysis

Nuclear/cytoplasmic fractionation was performed using a Cell Fractionation kit (Cell Signaling Technology, Inc., Danvers, MA, USA) according to the manufacturer's protocol, and the whole cell lysates were extracted using radioimmunoprecipitation assay buffer (Cell Signaling Technology, Inc.). The cell lysates were loaded with 10% loading buffer (Beyotime Institute of Biotechnology, Haimen, China) and were heated for 5 min at 100°C. The protein concentrations were determined using the BCA Protein Assay kit (Invitrogen; Thermo Fisher Scientific, Inc.). Equal quantities of denatured protein samples (40 µl) were resolved on 10% SDS-polyacrylamide gels, prior to being transferred onto polyvinylidene difluoride membranes (Roche Diagnostics, Basel, Switzerland). Following 1 h blocking with 5% dry skimmed milk in Tris-buffered saline/0.05% Tween-20 at room temperature, membranes were incubated with primary antibodies against Bcl-2 at a dilution of 1:1,000 (cat. no. ab194583; Abcam, Cambridge, UK) or Bcl-xL at a dilution of 1:1,000 (cat. no. ab32370; Abcam), overnight at 4°C, followed by incubation with a horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Proteins were visualized using Pierce™ Fast Western Blot kit (Thermo Fisher Scientific, Inc.). The membranes were stripped and reprobed with an anti-α-tubulin antibody at a dilution of 1:1,000 overnight at 4°C (cat. no. T6199; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) as the loading control.

Caspase-9 or −3 activity assays

Activity of caspase-9 or −3 was analyzed by spectrophotometry using a caspase-9 colorimetric assay kit (cat. no. KGA403) or acaspase-3 colorimetric assay kit (cat. no. KGA202; Nanjing KeyGen Biotech, Co. Ltd., Nanjing, China), according to the manufacturer's protocol. In brief, 5×106 cells were washed with cold phosphate-buffered saline, re-suspended in Lysis Buffer (from the two kits) and incubated on ice for 30 min. The 50 µl cell suspension was mixed with 50 µl Reaction Buffer (from the two kits) and 5 µl caspase-3/-9 substrate, prior to being incubated at 37°C for 4 h. The absorbance was measured at 405 nm, and bicinchoninic acid protein quantitative analysis was used as the reference to normalize each of the experimental groups.

Flow cytometric analysis

Flow cytometric analysis of apoptosis was performed using the fluorescein isothiocyanate (FITC)-Annexin V Apoptosis Detection kit I (BD Biosciences, Franklin Lakes, NJ, USA), and was performed, according to the manufacturer's protocol. In brief, cells were dissociated with trypsin and were resuspended at 1×106 cells/ml in binding buffer (Thermo Fisher Scientific, Inc.) with 50 µl/ml FITC-Annexin V and 50 µl/ml propidium iodide (PI). The cells were subsequently incubated for 15 min at room temperature, prior to being analyzed using a Gallios flow cytometer (Beckman Coulter, Inc., Brea, CA, USA). The inner mitochondrial membrane potential (Δψm) of the cells was detected by flow cytometry using a MitoScreen JC-1 staining kit (cat no. 551302; BD Biosciences), according to the manufacturer's protocol. In brief, cells were dissociated with trypsin and resuspended at 1×106 cells/ml in assay buffer (BD Biosciences), prior to being incubated at 37°C for 15 min with 10 µl/ml JC-1. Prior to flow cytometric analysis, cells were washed twice in assay buffer (BD Biosciences), part of the MitoScreen JC-1 staining kit. Flow cytometry data were analyzed using FlowJo 7.6 software (FlowJo LLC, Ashland, OR, USA).

Luciferase assay

A total of 4×104 cells were seeded in triplicate onto 24-well plates and were cultured at 37°C for 24 h. Cells were transfected with 100 ng control pmirGLO, pmirGLO-TP53-3′UTR, -TP53INP1-3′UTR, -TP53INP2-3′UTR, or -caspase3-3′-UTR luciferase plasmid, plus 5 ng pRL-TK Renilla plasmid (Promega Corporation, Madison, WI, USA), using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Luciferase and Renilla signals were measured 36 h after transfection using a Dual Luciferase Reporter assay kit (Promega Corporation) at room temperature, according to the manufacturer's protocol.

Statistical analysis

All values are presented as the mean ± standard deviation. Significant differences were determined using GraphPad 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA). The Mann-Whitney U test and χ2 tests were used to determine statistical differences between two groups. One-way analysis of variance, followed by the Student-Newman-Keuls test, was used to determine statistical differences among multiple groups. P<0.05 was considered to indicate a statistically significant difference. All the experiments were repeated three times.

Results

let-7f-5p is upregulated in chemoresistant CRC

The miRNA sequencing datasets of CRC were analyzed using TCGA, which identified that let-7f-5p expression was elevated in chemoresistant CRC tissues, compared with chemosensitive tissues (Fig. 1A). Notably, the present study demonstrated that the expression level of let-7f-5p was upregulated in patients with CRC exhibiting poor chemotherapeutic response, compared with those with a positive chemotherapeutic response (Fig. 1B). These observations revealed that let-7f-5p may contribute toward chemoresistance in CRC.

Figure 1.

Upregulation of let-7f-5p is associated with poor chemotherapeutic response in CRC. (A) In the TCGA dataset, let-7f-5p expression levels were markedly higher in CRC patients with a poor chemotherapy response (CR) than those with a favorable chemotherapy response (CS). A Mann-Whitney U test was used to determine statistical differences between two groups. The data are presented as the median ± interquartile range. (B) Percentages and numbers of samples exhibiting high or low let-7f-5p expression with different chemotherapeutic responses in the TCGA dataset. The χ2 test was used to determine statistical differences between two groups. CRC, colorectal cancer; TCGA, The Cancer Genome Atlas; CR, chemoresistant; CS, chemosensitive.

Overexpression of let-7f-5p increases the expression of anti-apoptotic proteins Bcl-2 and Bcl-xL in CRC cells

The role of let-7f-5p in the chemoresistance of CRC was additionally examined following treatment with the first-line drug 5-FU. let-7f-5p was upregulated and downregulated following transfection with let-7f-5p mimics and inhibitors, respectively, in CRC HCT116 and SW480 cells (Fig. 2A). The effect of let-7f-5p on the expression of anti-apoptotic proteins, Bcl-2 and Bcl-xL, was further examined. The results demonstrated that upregulating let-7f-5p increased Bcl-2 and Bcl-xL expression, while downregulating let-7f-5p decreased their expression (Fig. 2B). Therefore, these results demonstrated that let-7f-5p promoted the chemoresistance of CRC cells by enhancing the expression of anti-apoptotic proteins, Bcl-2 and Bcl-xL.

Figure 2.

let-7f-5p increases the expression of the anti-apoptotic proteins, Bcl-2 and Bcl-xL, and decreases the activity of caspase-3 and caspase-9 in CRC cells. (A) Reverse transcription-quantitative polymerase chain reaction analysis of let-7f-5p expression in HCT116 and SW480 cells transfected with a let-7f-5p mimic or inhibitor, compared with controls. Transcript levels were normalized to U6 expression. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05. One-way ANOVA was used to determine statistical differences among multiple groups. (B) Western blot analysis of Bcl-2 and Bcl-xL in the indicated cells. The activities of (C) caspase-3 and (D) caspase-9 were detected by the cleaved forms of these two proteins. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05. One-way ANOVA was used to determine statistical differences among multiple groups. CRC, colorectal cancer; Bcl-2, B-cell lymphoma 2; Bcl-xL, B-cell lymphoma-extra large; ANOVA, analysis of variance.

Overexpression of let-7f-5p decreases the activity of caspase-3 and caspase-9 in CRC cells

The effect of let-7f-5p on the activity of caspase-3 and-9 was examined. As demonstrated in Fig. 2C and D, upregulating let-7f-5p decreased the activity of caspase-3, while silencing let-7f-5p had the opposite effect. Overexpression of let-7f-5p consistently repressed the activity of caspase-9, while silencing of let-7f-5p increased the activity of caspase-9. Therefore, these observations suggested that let-7f-5p promotes the chemoresistance of CRC cells by inhibiting the activity of caspase-3 and caspase-9 in CRC cells.

Overexpression of let-7f-5p decreases the apoptotic rate and increases the mitochondrial potential of CRC cells

Annexin V-FITC/PI staining demonstrated that overexpression of let-7f-5p decreased the apoptotic rate of HCT116 and SW480 cells treated with 5-FU, while silencing let-7f-5p had the opposite effect (Fig. 3A). Furthermore, the effect of let-7f-5p on the mitochondrial potential of CRC cells was examined, and the results indicated that upregulating let-7f-5p enhanced the mitochondrial potential of HCT116 and SW480 cells following treatment with 5-FU; however, silencing let-7f-5p exhibited the opposite effects on the mitochondrial potential of CRC cells (Fig. 3B). Therefore, these observations demonstrated that let-7f-5p promotes the chemoresistance of CRC cells to 5-FU by decreasing the apoptotic rate and increasing the mitochondrial potential of HCT116 and SW480 cells.

Figure 3.

let-7f-5p decreases the apoptotic rate and increases the mitochondrial potential of CRC cells. (A) Annexin V-FITC/PI staining of the indicated cells treated with 5-FU for 36 h. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05. One-way ANOVA was used to determine statistical differences among multiple groups. (B) The JC-1 staining revealed that upregulating let-7f-5p enhanced the mitochondrial potential of the CRC cells, while silencing let-7f-5p decreased the mitochondrial potential of these cells. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05. One-way ANOVA was used to determine statistical differences among multiple groups. CRC, colorectal cancer; FITC, fluorescein isothiocyanate; PI, propidium iodide; 5-FU, fluorouracil; ANOVA, analysis of variance.

let-7f-5p targets multiple pro-apoptotic proteins in CRC cells

Using the publicly available algorithms, TargetScan and miRanda, it was identified that multiple pro-apoptotic proteins, including TP53, TP53INP1, TP53INP2 and caspase-3, may be potential targets of let-7f-5p (Fig. 4). RT-qPCR analysis revealed that let-7f-5p overexpression reduced the mRNA expression levels of TP53, TP53INP1, TP53INP2 and caspase-3. By contrast, silencing of let-7f-5p increased the expression of TP53, TP53INP1, TP53INP2 and caspase-3, suggesting that let-7f-5p negatively regulated the mRNA expression levels of TP53, TP53INP1, TP53INP2 and caspase-3 (Fig. 5). Furthermore, a luciferase assay revealed that let-7f-5p overexpression decreased the reporter activity driven by the 3′-UTRs of these transcripts, while silencing let-7f-5p increased this activity (Fig. 6). Taken together, the results of the present study indicated that let-7f-5p directly targets TP53, TP53INP1, TP53INP2 and caspase-3, which further promotes chemotherapeutic resistance in CRC.

Figure 4.

let-7f-5p targets multiple pro-apoptotic proteins. Predicted let-7f-5p targeting sequence in 3′-UTRs of TP53, TP53INP1, TP53INP2 and caspase-3. TP53, tumor protein p53; TP53INP1, TP53-inducible nuclear protein 1; TP53INP2, TP53-inducible nuclear protein p53 2; UTR, untranslated region.

Figure 5.

let-7f-5p decreases the mRNA expression levels of TP53, TP53INP1, TP53INP2 and caspase-3. Reverse transcription-quantitative polymerase chain reaction analysis of TP53, TP53INP1, TP53INP2 and caspase-3 following transfection with a let-7f-5p mimic or inhibitor in (A) HCT116 and (B) SW480 cells. Transcript levels were normalized to U6 expression. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05. One-way analysis of variance was used to determine statistical differences among multiple groups. TP53, tumor protein p53; TP53INP1, TP53-inducible nuclear protein 1; TP53INP2, TP53-inducible nuclear protein p53 2; UTR, untranslated region.

Figure 6.

let-7f-5p decreases the luciferase activity of the 3′-UTRs of TP53, TP53INP1, TP53INP2 and caspase-3. Luciferase assay of cells transfected with pmiRGLO-3′UTR reporter of TP53, TP53INP1, TP53INP2 and caspase-3 in let-7f-5p-overexpressing and silenced (A) HCT116 and (B) SW480 cells. One-way analysis of variance was used to determine statistical differences among multiple groups. TP53, tumor protein p53; TP53INP1, TP53-inducible nuclear protein 1; TP53INP2, TP53-inducible nuclear protein p53 2; UTR, untranslated region. Error bars represent the mean ± standard deviation of three independent experiments. *P<0.05 vs. control cells.

Discussion

The results of the present study demonstrated that let-7f-5p expression was elevated in chemotherapy-resistant CRC tissues, compared with chemotherapy-sensitive tissues. Furthermore, upregulating let-7f-5p increased the expression of the anti-apoptotic proteins, Bcl-2 and Bcl-xL, and decreased the activity of caspase-3 and caspase-9 in CRC cells, while downregulating let-7f-5p had the opposite effect. Notably, the observations of the present study indicated that let-7f-5p promotes chemotherapy resistance via directly repressing the expression of a number of pro-apoptotic proteins, including TP53, TP53INP1, TP53INP2 and caspase-3. Therefore, the results of the present study indicate that overexpression of let-7f-5p exhibits an important function in the chemoresistance of CRC.

The transcription factor, p53 is the most characterized tumor suppressor gene and has been reported to be involved in the development and progression of several types of cancer via controlling cell cycle checkpoints, and promoting apoptosis and senescence (25,26). Loss or mutation of the p53 gene has been identified to be positively associated with the recurrent incidence of chemotherapeutic resistance in different types of cancer (27). In CRC, p53 is mutated in ~50% of patients and these mutations of are considered to be inactivating, leaving to TP53 being incapable of regularly exerting its functions, including its pro-apoptotic role (28,29). The present study identified that let-7f-5p decreased the apoptosis of CRC cells induced by 5-FU and conferred the resistance of these cells to 5-FU via inhibiting TP53 expression. Furthermore, the results further demonstrated that let-7f-5p simultaneously targets TP53INP1, TP53INP2 and caspase 3, which cooperatively attenuated the apoptosis induced by 5-FU and promoted chemoresistance in CRC cells. TP53INP1 and TP53INP2, which act as pro-apoptotic and anti-proliferative proteins, have been reported to positively regulate p53, and to stimulate its ability to induce apoptosis and to regulate the cell cycle (30). A previous study reported that miR-182 increased drug resistance in cisplatin-treated hepatocellular carcinoma cells via inhibiting TP53INP1 expression (31). Caspase-3 has been reported to be involved in the activation cascade of caspases responsible for apoptosis, and functions by cleaving and activating caspases-6, −7 and −9, which serve important roles in the chemoresistance of different types of cancer (32–34). Through the use of luciferase assays, the present study identified that let-7f-5p simultaneously repressed the activity of TPp53, TP53INP1, TP53INP2 and caspase-3 by binding to the 3′-UTRs of their mRNAs, resulting in a decrease in the apoptosis induced by 5-FU in CRC cells and the development of chemoresistance.

Members of the Let-7 family have been identified to function as tumor suppressors through regulating multiple oncogenic signals (35). For example, Di Fazio et al (36) reported that let-7b exhibited an important tumor-suppressive role via inhibiting the expression of high-mobility group AT-hook 2, a nuclear non-histone transcriptional co-factor with known oncogenic properties, in liver cancer cell lines. Furthermore, emerging evidence has demonstrated that members of the let-7 family of miRNAs are downregulated in a number of types of human cancer, and that low let-7 expression has been correlated with resistance to chemotherapeutics (37,38). Downregulation of let-7 was also associated with chemoresistance in breast cancer cells (39). In addition, Sugimura et al (38) reported that low expression of let-7b and let-7c was significantly associated with a poor response to chemotherapy in esophageal squamous cell carcinoma, and that transfection of let-7c restored sensitivity to cisplatin and increased the rate of apoptosis following exposure to cisplatin in vitro assays. Additionally, Tsang and Kwok (34) reported that induced expression of let-7a increased the resistance of human squamous carcinoma A431 cells to chemotherapeutic drugs, including interferon-γ, doxorubicin and paclitaxel. These observations revealed that the members of the let-7 family may function as oncomiRs and tumor-suppressive miRNAs, depending on the type of tumor. The present study reported that, as a member of the let-7 family, let-7f-5p was elevated in chemoresistant CRC tissues, compared with chemosensitive tissues. Upregulation of let-7f-5p decreased the apoptosis induced by 5-FU in vitro assays, while silencing let-7f-5p had the opposite effect. These results, in conjunction with those of other studies, indicated that the pro-cancer and anticancer roles of the let-7 family are environmentally and tumor-type dependent.

Previous studies have implicated the altered expression of let-7f-5p in several diseases, including major depression, myasthenia gravis, Alzheimer's disease (40–42), and neoplastic conditions, including laryngeal carcinoma, CRC and thyroid cancer (43,44). Notably, Pathak et al (45) reported that let-7f-5p was highly upregulated in the human colon cancer HCT116 and SN38 cell lines following radiation treatment in a p53-directed manner, indicating that let-7f-5p may contribute to the chemoresistance of CRC. However, the specific role of let-7f-5p in CRC remains unclear. The results of the present study also demonstrated that let-7f-5p expression was elevated in chemoresistant CRC tissues compared with chemosensitive tissues. Furthermore, ectopic expression of let-7f-5p had the effect of reducing the apoptosis induced by 5-FU, while silencing let-7f-5p enhanced the apoptosis induced by 5-FU. Additionally, silencing let-7f-5p enhanced sensitivity to 5-FU. Importantly, the results demonstrated that let-7f-5p overexpression promotes chemotherapeutic resistance in CRC via directly repressing the expression of several pro-apoptotic proteins, including TP53, TP53INP1, TP53INP2 and caspase-3.

In summary, the results of the present study revealed that let-7f-5p serves an important role in the chemotherapy resistance of CRC via directly repressing expression of TP53, TP53INP1, TP53INP2 and caspase-3. Therefore, improved understanding of the specific role of let-7f-5p in the pathogenesis of CRC would facilitate an increase in the available knowledge of CRC development, which will assist in the development of novel therapeutic measures against CRC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Natural Science Foundation of Gansu Province (Lanzhou, China; grant no. 096RJZA096).

Availability of data and materials

The datasets generated and analyzed in the present study are included in this published article.

Authors' contributions

YT and CC developed ideas and drafted the manuscript. HY and HW conducted the experiments and contributed to the analysis of data. HT and YP contributed to the analysis of data. BL and XD contributed to the analysis of data and revised the manuscript. YY and ZQ analysed and interpreted the data and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors contributed to revise the manuscript and approved the final version for publication.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that there are no competing interests.

References

1 

Jemal A, Siegel R, Ward E, Hao Y, Xu J and Thun MJ: Cancer statistics, 2009. CA Cancer J Clin. 59:225–249. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Ricci-Vitiani L, Fabrizi E, Palio E and De Maria R: Colon cancer stem cells. J Mol Med (Berl). 87:1097–1104. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Johnston PG and Kaye S: Capecitabine: A novel agent for the treatment of solid tumors. Anticancer Drugs. 12:639–646. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Giacchetti S, Perpoint B, Zidani R, Le Bail N, Faggiuolo R, Focan C, Chollet P, Llory JF, Letourneau Y, et al: Phase III multicenter randomized trial of oxaliplatin added to chronomodulated fluorouracil-leucovorin as first-line treatment of metastatic colorectal cancer. J Clin Oncol. 18:136–147. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Douillard JY, Cunningham D, Roth AD, Navarro M, James RD, Karasek P, Jandik P, Iveson T, Carmichael J, Alakl M, et al: Irinotecan combined with fluorouracil compared with fluorouracil alone as first-line treatment for metastatic colorectal cancer: A multicenter randomised trial. Lancet. 355:1041–1047. 2000. View Article : Google Scholar : PubMed/NCBI

6 

Longley DB and Johnston PG: Molecular mechanisms of drug resistance. J Pathol. 205:275–292. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Gonzalez-Angulo AM, Morales-Vasquez F and Hortobagyi GN: Overview of resistance to systemic therapy in patients with breast cancer. Adv Exp Med Biol. 608:1–22. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Gottesman MM: Mechanisms of cancer drug resistance. Annu Rev Med. 53:615–627. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Wu X and Xiao H: MiRNAs modulate the drug response of tumor cells. Sci China C Life Sci. 9:797–801. 2009. View Article : Google Scholar

10 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Calin GA and Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer. 6:857–866. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Ren D, Wang M, Guo W, Huang S, Wang Z, Zhao X, Du H, Song L and Peng X: Double-negative feedback loop between ZEB2 and miR-145 regulates epithelial-mesenchymal transition and stem cell properties in prostate cancer cells. Cell Tissue Res. 358:763–778. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Guo W, Ren D, Chen X, Tu X, Huang S, Wang M, Song L, Zou X and Peng X: HEF1 promotes epithelial mesenchymal transition and bone invasion in prostate cancer under the regulation of microRNA-145. J Cell Biochem. 114:1606–1615. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Simerzin A, Zorde-Khvalevsky E, Rivkin M, Adar R, Zucman-Rossi J, Couchy G, Roskams T, Govaere O, Oren M, Giladi H and Galun E: The liver-specific microRNA-122*, the complementary strand of microRNA-122, acts as a tumor suppressor by modulating the p53/mouse double minute 2 homolog circuitry. Hepatology. 64:1632–1636. 2016. View Article : Google Scholar

16 

Ren D, Wang M, Guo W, Zhao X, Tu X, Huang S, Zou X and Peng X: Wild-type p53 suppresses the epithelial-mesenchymal transition and stemness in PC-3 prostate cancer cells by modulating miR-145. Int J Oncol. 42:1473–1481. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Wang M, Ren D, Guo W, Wang Z, Huang S, Du H, Song L and Peng X: Loss of miR-100 enhances migration, invasion, epithelial-mesenchymal transition and stemness properties in prostate cancer cells through targeting Argonaute 2. Int J Oncol. 45:362–372. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Sahu N, Stephan JP, Cruz DD, Merchant M, Haley B, Bourgon R, Classon M and Settleman J: Functional screening implicates miR-371-3p and peroxiredoxin 6 in reversible tolerance to cancer drugs. Nat Commun. 7:123512016. View Article : Google Scholar : PubMed/NCBI

19 

Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, Guo J, Zhang Y, Chen J, Guo X, et al: Characterization of microRNAs in serum: A novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res. 18:997–1006. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Chen J, Chen Y and Chen Z: MiR-125a/b regulates the activation of cancer stem cells in paclitaxel-resistant colon cancer. Cancer Invest. 31:17–23. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Zhang Y, Talmon G and Wang J: MicroRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by regulating PPP2R1B expression in colorectal cancer. Cell Death Dis. 6:e18452015. View Article : Google Scholar : PubMed/NCBI

22 

Zhang X, Chen Y, Hao L, Hou A, Chen X, Li Y, Wang R, Luo P, Ruan Z, Ou J, et al: Macrophages induce resistance to 5-fluorouracil chemotherapy in colorectal cancer through the release of putrescine. Cancer Lett. 381:305–313. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Du C, Huang D, Peng Y, Yao Y, Zhao Y, Yang Y, Wang H, Cao L, Zhu WG and Gu J: 5-Fluorouracil targets histone acetyltransferases p300/CBP in the treatment of colorectal cancer. Cancer Lett. 400:183–193. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-(delta delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Vousden KH and Prives C: Blinded by the light: The growing complexity of p53. Cell. 137:413–431. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Goh AM, Coffill CR and Lane DP: The role of mutant p53 in human cancer. J Pathol. 223:116–126. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Alam SK, Yadav VK, Bajaj S, Datta A, Dutta SK, Bhattacharyya M, Bhattacharya S, Debnath S, Roy S, Boardman LA, et al: DNA damage-induced ephrin-B2 reverse signaling promotes chemoresistance and drives EMT in colorectal carcinoma harboring mutant p53. Cell Death Differ. 23:707–22. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Deschoemaeker S, Di Conza G, Lilla S, Martín-Pérez R, Mennerich D, Boon L, Hendrikx S, Maddocks OD, Marx C, Radhakrishnan P, et al: PHD1 regulates p53-mediated colorectal cancer chemoresistance. EMBO Mol Med. 7:1350–1365. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Muller PA and Vousden KH: p53 mutations in cancer. Nat Cell Biol. 15:2–8. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Okamura S, Arakawa H, Tanaka T, Nakanishi H, Ng CC, Taya Y, Monden M and Nakamura Y: p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis. Mol Cell. 8:85–94. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Qin J, Luo M, Qian H and Chen W: Upregulated miR-182 increases drug resistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene. 538:342–347. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Harrington HA, Ho KL, Ghosh S and Tung KC: Construction and analysis of a modular model of caspase activation in apoptosis. Theor Biol Med Model. 5:262008. View Article : Google Scholar : PubMed/NCBI

33 

Sidi S, Sanda T, Kennedy RD, Hagen AT, Jette CA, Hoffmans R, Pascual J, Imamura S, Kishi S, Amatruda JF, et al: Chk1 suppresses a caspase-2 apoptotic response to DNA damage that bypasses p53, Bcl-2, and caspase-3. Cell. 133:864–877. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Tsang WP and Kwok TT: Let-7a microRNA suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis. 13:1215–1222. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Chang CJ, Hsu CC, Chang CH, Tsai LL, Chang YC, Lu SW, Yu CH, Huang HS, Wang JJ, Tsai CH, et al: Let-7d functions as novel regulator of epithelial-mesenchymal transition and chemoresistant property in oral cancer. Oncol Rep. 26:1003–1010. 2011.PubMed/NCBI

36 

Di Fazio P, Montalbano R, Neureiter D, Alinger B, Schmidt A, Merkel AL, Quint K and Ocker M: Downregulation of HMGA2 by the pan-deacetylase inhibitor panobinostat is dependent on hsa-let-7b expression in liver cancer cell lines. Exp Cell Res. 318:1832–1843. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Xu C, Xie S, Song C, Huang L and Jiang Z: Lin28 mediates cancer chemotherapy resistance via regulation of miRNA signaling. Hepatogastroenterology. 61:1138–1141. 2014.PubMed/NCBI

38 

Sugimura K, Miyata H, Tanaka K, Hamano R, Takahashi T, Kurokawa Y, Yamasaki M, Nakajima K, Takiguchi S, Mori M and Doki Y: Let-7 expression is a significant determinant of response to chemotherapy through the regulation of IL-6/STAT3 pathway in esophageal squamous cell carcinoma. Clin Cancer Res. 18:5144–5153. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Wu J, Li S, Jia W, Deng H, Chen K, Zhu L, Yu F and Su F: Reduced Let-7a is associated with chemoresistance in primary breast cancer. PLoS One. 10:e01336432015. View Article : Google Scholar : PubMed/NCBI

40 

Maffioletti E, Cattaneo A, Rosso G, Maina G, Maj C, Gennarelli M, Tardito D and Bocchio-Chiavetto L: Peripheral whole blood microRNA alterations in major depression and bipolar disorder. J Affect Disord. 200:250–258. 2016. View Article : Google Scholar : PubMed/NCBI

41 

Punga T, Bartoccioni E, Lewandowska M, Damato V, Evoli A and Punga AR: Disease specific enrichment of circulating let-7 family microRNA in MuSK+ myasthenia gravis. J Neuroimmunol. 292:21–26. 2016. View Article : Google Scholar : PubMed/NCBI

42 

Satoh J, Kino Y and Niida S: MicroRNA-Seq data analysis pipeline to identify blood biomarkers for Alzheimer's disease from public data. Biomark Insights. 10:21–31. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Damanakis AI, Eckhardt S, Wunderlich A, Roth S, Wissniowski TT, Bartsch DK and Di Fazio P: MicroRNAs let7 expression in thyroid cancer: Correlation with their deputed targets HMGA2 and SLC5A5. J Cancer Res Clin Oncol. 142:1213–1220. 2016. View Article : Google Scholar : PubMed/NCBI

44 

Lu ZM, Lin YF, Jiang L, Chen LS, Luo XN, Song XH, Chen SH and Zhang SY: Micro-ribonucleic acid expression profiling and bioinformatic target gene analyses in laryngeal carcinoma. Onco Targets Ther. 7:525–533. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Pathak S, Meng WJ, Nandy SK, Ping J, Bisgin A, Helmfors L, Waldmann P and Sun XF: Radiation and SN38 treatments modulate the expression of microRNAs, cytokines and chemokines in colon cancer cells in a p53-directed manner. Oncotarget. 6:44758–44780. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tie Y, Chen C, Yang Y, Qian Z, Yuan H, Wang H, Tang H, Peng Y, Du X, Liu B, Liu B, et al: Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins. Oncol Lett 15: 8695-8702, 2018.
APA
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H. ... Liu, B. (2018). Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins. Oncology Letters, 15, 8695-8702. https://doi.org/10.3892/ol.2018.8410
MLA
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H., Tang, H., Peng, Y., Du, X., Liu, B."Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins". Oncology Letters 15.6 (2018): 8695-8702.
Chicago
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H., Tang, H., Peng, Y., Du, X., Liu, B."Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins". Oncology Letters 15, no. 6 (2018): 8695-8702. https://doi.org/10.3892/ol.2018.8410
Copy and paste a formatted citation
x
Spandidos Publications style
Tie Y, Chen C, Yang Y, Qian Z, Yuan H, Wang H, Tang H, Peng Y, Du X, Liu B, Liu B, et al: Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins. Oncol Lett 15: 8695-8702, 2018.
APA
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H. ... Liu, B. (2018). Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins. Oncology Letters, 15, 8695-8702. https://doi.org/10.3892/ol.2018.8410
MLA
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H., Tang, H., Peng, Y., Du, X., Liu, B."Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins". Oncology Letters 15.6 (2018): 8695-8702.
Chicago
Tie, Y., Chen, C., Yang, Y., Qian, Z., Yuan, H., Wang, H., Tang, H., Peng, Y., Du, X., Liu, B."Upregulation of let‑7f‑5p promotes chemotherapeutic resistance in colorectal cancer by directly repressing several pro‑apoptotic proteins". Oncology Letters 15, no. 6 (2018): 8695-8702. https://doi.org/10.3892/ol.2018.8410
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team