This article is mentioned in:

Introduction

Hereditary non-polyposis colorectal cancer (HNPCC), also known as Lynch syndrome, is inherited as an autosomal dominant disease and is the most common hereditary colorectal cancer, accounting for ~50% of familial colorectal cancer and 3% of all colorectal cancer cases (1). Unlike with sporadic colorectal cancer, HNPCC is associated with specific genetic factors and significant clinicopathological features. These features are often associated with synchronous and metachronous colorectal cancer and cause a high incidence of extraintestinal malignant tumors, including endometrial, gastric, renal, pancreatic and ovarian cancer types (2). Inactivation of DNA mismatch repair (MMR) genes, including MLH1, MSH2, MSH6 and PMS2, is the molecular genetic basis of HNPCC pathogenesis. Mutation of MMR genes can result in loss of DNA MMR function, leading to aberrant DNA replication, increased spontaneous mutation frequency and microsatellite instability. This ultimately leads to the transformation of normal cells into malignant cells (3–5).

However, a previous study observed that certain HNPCC patients, diagnosed by the presence of MMR gene mutations, did not meet some of the clinical diagnostic criteria for HNPCC (6). Furthermore, in certain patients meeting the clinical diagnostic criteria for HNPCC, MMR gene mutations could not be detected (7,8). Bashyam et al (8) demonstrated that, among 48 patients with Lynch syndrome, only 58% had MMR gene expression defects, which indicated that other, as yet unidentified, causative genes may be involved in the pathogenesis of HNPCC.

Based upon this assumption, in the present study, whole exome sequencing was performed in 3 HNPCC patients from 1 family and unreported mutations were observed in 15 gene loci. Subsequently, peripheral blood was collected from control subjects, sporadic colorectal cancer patients and the aforementioned 3 HNPCC patients. Single nucleotide polymorphism (SNP) genotyping assays were also performed on the aforementioned 15 genes using the DNA MassARRAY Genetic Analysis system to further verify whether these genes were associated with HNPCC pathogenesis.

Materials and methods

Blood sample collection

All procedures in studies involving human participants were performed in accordance with the ethical standards of the institutional and/or national research committee and the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. All patients signed informed consent forms prior to participation in the study and the study was approved by the Third Xiangya Hospital Ethics Committee (Changsha, China).

Blood samples were collected from 96 subjects, including 12 control subjects, 81 sporadic colorectal cancer patients who were diagnosed by histopathology from January 2014 to December 2016 at the Third Xiangya Hospital of Central South University and 3 HNPCC patients from the aforementioned hospital who met the Amsterdam Criteria (9), which is outlined as follows: i) ≥3 colorectal cancer cases in the same family diagnosed by histopathology, one case being a first-degree relative (parent or sibling) of the other two cases; ii) ≥2 successive generations affected; iii) ≥1 case with onset prior to the age of 50 years; and iv) familial adenomatous polyposis in HNPCC patients should be excluded. In the HNPCC family investigated in the present study, the proband's father had colorectal cancer that was diagnosed by histopathology and the other 2 cases who provided samples were a sibling and a cousin of the proband. The 3 patients experienced changes in their stools and abdominal bloating prior to being hospitalized. Colorectal cancer was diagnosed by histopathology (all pathology diagnoses were confirmed by two deputy or chief director pathologists) following radical surgery (Table I). The pedigree of the HNPCC family is presented in Fig. 1.

Figure 1. Pedigree of the HNPCC family. HNPCC, hereditary non-polyposis colorectal cancer.

Table I. Clinical characteristics of 3 hereditary non-polyposis colorectal cancer patients.

Table I.

Clinical characteristics of 3 hereditary non-polyposis colorectal cancer patients.

Sample name	Sex	Age, years	Main symptoms	Pathological types
Lah	Male	47	Stool changes for 1 year, abdominal bloating for 2 months	Moderately-differentiated adenocarcinoma
Lyh	Male	45	Blood in stools, abdominal bloating, weight loss and stool changes for 2 years	Moderately-differentiated adenocarcinoma
Lyl	Female	42	Abdominal bloating and pain, hypodynamia and stool changes for 3 months.	Well-differentiated adenocarcinoma

Whole exome sequencing

DNA was extracted from the peripheral blood of 3 HNPCC cases and purified using a DNeasy Blood and Tissue kit (cat. no. 69506; Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocols. Exome sequences were subjected to DNA sequencing on the Illumina platform using Illumina PE Flow Cell v3-HS (Illumina, Inc., San Diego, CA, USA). In accordance with the manufacturer's protocols, genomic DNA fragments were processed by end repair, addition of adenosine (A) to 3′ ends, ligation, DNA enrichment and hybridization. DNA libraries from samples were constructed. The concentration, purity and size of the libraries were measured using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA) and a Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The hybridization of sequencing primers and the generation of clusters were performed using cBot (HiSeq 2500; Illumina, Inc.) following the cBot User Guide (Part #15006165; Rev. F; lllumina, Inc.). A paired-end sequencing was then performed on a cluster-containing flow cell following the manufacturer's protocols (HiSeq 2500; Illumina, Inc.). Data acquisition software (Illumina, Inc.) was used for quality control and data analysis. The quality control standards for sequencing results were as follows: The average coverage for an exon region was ~100 times; if the average coverage was <90 times, it was resequenced; and at 100 times coverage, ≥85% of exon regions were covered by ≥1 sequence (Table II). The Burrows-Wheeler Alignment software package (version 0.5.9; Shanghai Biotechnology, China) was used to map sequences using human hg19 as the reference genome. Potential PCR duplicates were removed using rmdup of Samtools-0.1.18 (Shanghai Biotechnology, China), and mapping statistics were generated using Samtools flagstat (Shanghai Biotechnology, China) (Table III). Capture-enrichment methods were used to determine the amount of fragment from the captured target region and the coverage and depth of the target region.

Table II. Sequence quality control results for 3 hereditary non-polyposis colorectal cancer patients.

Table II.

Sequence quality control results for 3 hereditary non-polyposis colorectal cancer patients.

Sample name	Orientation	Total reads, n	Total bases, n	Q20, %	Depth	1×, %	Quality of sequencing results
Lah-1	Forward	48,356,713	4,835,671,300	98	105.69	99.95	Good
Lah-2	Reverse	48,356,713	4,835,671,300	97			Good
Lyl-1	Forward	73,411,952	7,341,195,200	97	149.87	99.86	Good
Lyl-2	Reverse	73,411,952	7,341,195,200	95			Good
Lyh-1	Forward	57,778,031	5,777,803,100	97	120.25	99.96	Good
Lyh-2	Reverse	57,778,031	5,777,803,100	95			Good

[i] The Q20 value refers to the probability of error given to the identified base in the base calling process. If the mass value is Q20, the probability of error recognition is 1%, that is, the error rate is 1% or the correct rate is 99%. The 1× value refers to the likelihood that there is at least one read coverage in the genome sequence.

Table III. Sequence mapping information for 3 hereditary non-polyposis colorectal cancer patients.

Table III.

Sequence mapping information for 3 hereditary non-polyposis colorectal cancer patients.

Sample name	Filtered reads, n	Mapped reads, n	Map ratio, %	Unique mapped reads, n	Unique mapped ratio, %
Lyh	107,719,930	105,656,069	98.08	95,653,932	88.80
Lyl	136,284,036	133,688,255	98.10	120,411,348	88.35
Lah	92,361,758	91,224,395	98.77	83,257,847	90.14

[i] Filtered reads, number of reads that pass filtering with sequenator; mapped reads, number of reads that map to each reference sequence; map ratio, ratio of mapped reads to filtered reads; unique mapped reads, number of reads that can map to each reference sequence after removing potential polymerase chain reaction duplicates using the Samtools rmdup tool; Unique Mapped Ratio, ratio of unique mapped reads to mapped reads.

SNP genotyping

DNA extraction

DNA was extracted from peripheral blood lymphocytes of the 96 samples using a DNeasy Blood and Tissue kit (Qiagen, Inc.), according to the manufacturer's protocols. DNA was quantified and assessed using a NanoDrop®ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and 0.8% agarose gel electrophoresis.

PCR amplification

PCR primer mixes were obtained from Invitrogen (Invitrogen, Thermo Fisher Scientific, Inc.) (Table IV). The Q-PCR Detection Kit was purchased from GeneCopoeia (Rockville, MD, USA). The First Strand cDNA Synthesis kit was purchased from Fermentas (Thermo Fisher Scientific, Inc.). Total PCR volume was 5 µl, including 1 µl template DNA, 1.8 µl ddH2O, 0.5 µl 10X PCR Buffer, 0.1 µl 25 mmol/l dNTPs, 0.4 µl 25 mmol/l MgCl2, 1 µl PCR Primer (0.5 mmol/l) and 0.2 µl Gold Tag PCR enzyme (Advanced Biotechnologies Inc., Eldersburg, MD, USA). PCR conditions were 95°C for 2 min, then 45 cycles of 95°C for 30 sec, 50°C for 30 sec, 72°C for 1 min and 72°C for 5 min.

Table IV. Names and sequences of polymerase chain reaction primers.

Table IV.

Names and sequences of polymerase chain reaction primers.

Name of primer	Sequence of primer
BB14228-3chr1_112298707-F	ACGTTGGATGACCGCTCAGGATCTCAGCAG
BB14228-3chr14_68264412-F	ACGTTGGATGAGCAACCTTCCCGAAGATAC
BB14228-3chr1_46509382-F	ACGTTGGATGATCCTTGGTTCAGCACAACG
BB14228-3chr6_35911730-F	ACGTTGGATGCCCTCTGGTGAGTATGAATC
BB14228-3chr2_145156750-F	ACGTTGGATGAATTTTCAGCAGTTCATCGG
BB14228-3chr8_95952304-F	ACGTTGGATGCTGTTTACCGGCATCTCTTG
BB14228-3chr2_219249005-F	ACGTTGGATGCCTGAAGATCTGACTCGATG
BB14228-3chr4_151827481-F	ACGTTGGATGGAACTCAATTGCTATGCAGG
BB14228-3chr2_37439069-F	ACGTTGGATGACATCCATGAATGTTCCTCC
BB14228-3chr2_67630823-F	ACGTTGGATGGACAAATGCTTTGAAAGAGG
BB14228-3chr3_52474994-F	ACGTTGGATGTCACCTAGCTGGTCAAAGTG
BB14228-3chr3_50325883-F	ACGTTGGATGCAGAACAATGAGCTACTCCG
BB14228-3chr12_88514827-F	ACGTTGGATGTGAGAGAACAGCTGAACTGG
BB14228-3chr4_187541196-F	ACGTTGGATGAGTTATCGTTCCGATCACTG
BB14228-3chr10_124221227-F	ACGTTGGATGAGAGTCGCCATGCAGATCC
BB14228-3chr1_112298707-R	ACGTTGGATGAAAGCAGCAGTGACTCGAAG
BB14228-3chr14_68264412-R	ACGTTGGATGAGCTCTTCAGATTACCTGCC
BB14228-3chr1_46509382-R	ACGTTGGATGTATCTGCAAAGCGAGGGCAT
BB14228-3chr6_35911730-R	ACGTTGGATGATCATCCGTCTATGGCTTCC
BB14228-3chr2_145156750-R	ACGTTGGATGCCATCAACCCATACAAGGAC
BB14228-3chr8_95952304-R	ACGTTGGATGTCTCCTCCATTGGACATGAC
BB14228-3chr2_219249005-R	ACGTTGGATGTTCAGCCTGCGGAAGCTATG
BB14228-3chr4_151827481-R	ACGTTGGATGACCTTTTCAAGGCTATATCC
BB14228-3chr2_37439069-R	ACGTTGGATGACTTGGTAACCTGGATGACG
BB14228-3chr2_67630823-R	ACGTTGGATGGAGAAGAAAGTGATCGTGGG
BB14228-3chr3_52474994-R	ACGTTGGATGTGGAGCACTTTCCTCAAGGC
BB14228-3chr3_50325883-R	ACGTTGGATGTCTCAAAGCGTGGAACCTTG
BB14228-3chr12_88514827-R	ACGTTGGATGAACCTCTTCAGAGCCTCAAC
BB14228-3chr4_187541196-R	ACGTTGGATGTCTCTGCAATCTCTGCACTG
BB14228-3chr10_124221227-R	ACGTTGGATGAGCGGCCGGCCCGGGACAG
BB14228-3chr1_112298707-EX	CCGCCAACAGCACATCC
BB14228-3chr14_68264412-EX	GGCTCCTTCTTGTCCGA
BB14228-3chr1_46509382-EX	TCTGTGCATGAACAGGG
BB14228-3chr6_35911730-EX	TGGTCAGTGGAGAGGAGA
BB14228-3chr2_145156750-EX	ACTATGCTATGAACATGGA
BB14228-3chr8_95952304-EX	CCATTGGACATGACTCAAAC
BB14228-3chr2_219249005-EX	AAGCTATGGGCCTTCACGGGG
BB14228-3chr4_151827481-EX	CTATATCCTATTACCAAGAAGC
BB14228-3chr2_37439069-EX	GATGAAGTTTCTTTAGGAAGTA
BB14228-3chr2_67630823-EX	GAAAGTGATCGTGGGGTTTTAT
BB14228-3chr3_52474994-EX	TCCTCAAGGCCAGGCTGGTCTGCT
BB14228-3chr3_50325883-EX	TTGCAGGCCTTCAGGGCAGTGGCA
BB14228-3chr12_88514827-EX	AGCCTCAACTAATTCTTTATCCTTTT
BB14228-3chr4_187541196-EX	CTCTGCACTGTAGAAAGGTTTTTCAA
BB14228-3chr10_124221227-EX	GGCCGGCCCGGGACAGCTGCGCCGAG

Shrimp alkaline phosphatase (SAP) purification

The total volume for the SAP purification reaction was 2 µl. This included 1.53 µl ddH2O, 0.17 µl SAP Buffer and 0.3 µl SAP enzyme (Sequenom, San Diego, CA, USA). Reaction conditions were 37°C for 40 min and 85°C for 5 min.

Extension reaction

The extension reaction was performed using a 9700 PCR instrument (Sequenom, Inc., San Diego, CA, USA) according to the manufacturer's protocol. The Complete iPLEX® Gold Genotyping Reagent Set was purchased from Sequenom. The total volume of the extension reaction was 2 µl and included 0.619 µl ddH2O, 0.2 µl iPLEX GOLD Buffer, 0.2 µl iPLEXTermination mix, 0.94 µl iPLEX Extension Primer mix and 0.041 µl iPLEX Enzyme. Extension reaction conditions were 40 cycles of 94°C for 30 sec and 94°C for 5 sec, and 5 cycles of 52°C for 5 sec and 80°C for 5 sec, followed by 1 cycle of 72°C for 3 min. The PCR products were purified using resin, were spotted onto a chip and were analyzed on the MassARRAY Platform SEQUENOM Analyzer 4 (Sequenom, Inc.).

Results

Whole exome sequencing generated 60.4 Gb of data from the 3 HNPCC patients. These data were screened as follows: i) Remove bases with low scores in accordance with the quality control specifications that require the sample coverage to be <5 and fraction variation in a single nucleotide to be <40; ii) filter and eliminate bases that do not fall in exonic regions; iii) filter and eliminate proven mutations in controls and common mutations carried by controls that are archived in public genetic mutation databases, namely HAPMAP (ftp://ftp.ncbi.nlm.nih.gov/hapmap/), 1,000 Genomes (http://www.internationalgenome.org/1000-genomes-project-publications) and dbSNP (https://www.ncbi.nlm.nih.gov/snp/); iv) reserve single nucleotide loci changes in non-synonymous mutations and filter out single nucleotide changes in synonymous mutations; and v) select the non-synonymous mutations that are common to the 3 cases. From this analysis the following mutations were identified in 15 genes (Table V): DDX20 (rs112298707), ZFYVE26 (rs68264412), PIK3R3 (rs46509382), SLC26A8 (rs35911730), ZEB2 (rs145156750), TP53INP1 (rs95952304), SLC11A1 (rs219249005), LRBA (rs151827481), CEBPZ (rs37439069), ETAA1 (rs67630823), SEMA3G (rs52474994), IFRD2 (rs50325883), FAT1 (rs18754119), CEP290 (rs88514827) and HTRA1 (rs124221227). SNP genotyping of these 15 genes was then performed in 96 subjects using the DNA MassARRAY Genetic Analysis system (Sequenom) (Table VI). Among the 96 samples, SNP genotyping was successful at all 15 loci in 92, but genotyping of HTRA1 (rs124221227C>T) failed in 4 of the sporadic colorectal cancer samples (Fig. 2). The genotype of CEP290 (rs88514827C>T) in all 12 control subjects was wild-type, while 1 of the 81 patients with sporadic colorectal cancer had a mutation in CEP290 (rs88514827C>T) (Fig. 2A). A total of 5/12 control subjects and 30/81 sporadic colorectal cancer patients had mutations in HTRA1 (rs124221227C>T). The genotypes of the other 13 genes in the 12 control subjects and 81 sporadic colorectal cancer patients were all wild-type, namely DDX20 (rs112298707G>T), ZFYVE26 (rs68264412C>T), PIK3R3 (rs46509382T>C), SLC26A8 (rs35911730G>A), ZEB2 (rs145156750C>A), TP53INP1 (rs95952304T>C), SLC11A1 (rs219249005C>G), LRBA (rs151827481C>T), CEBPZ (rs37439069A>G), ETAA1 (rs67630823A>G), SEMA3G (rs52474994G>A), IFRD2 (rs50325883 T>G) and FAT1 (rs187541196A>C) (two of these were selected as examples and are presented in Fig. 3). In all 3 HNPCC patients, all 15 genes carried the same mutations.

Figure 2. DNA spectrums of (A) CEP290 and (B) HTRA1. b, T-base dissociation absorption peak; d, C-base dissociation absorption peak.

Figure 3. DNA spectrums of (A) DDX20 and (B) SLC26A8. a, G-base dissociation absorption peak; b, T-base dissociation absorption peak; c, A-base dissociation absorption peak.

Table V. 15 single nucleotide mutations detected following integration.

Table V.

15 single nucleotide mutations detected following integration.

Gene name	Chromosome number	Position	Reference base	Sequencing base	Mutation type	Gene position
DDX20	chr1	112298707	G	T	Nonsense	Exon
ZFYVE26	chr14	68264412	C	T	Nonsense	Exon
PIK3R3	chr1	46509382	T	C	Nonsense	Exon
SLC26A8	chr6	35911730	G	A	Nonsense	Exon
ZEB2	chr2	145156750	C	A	Nonsense	Exon
TP53INP1	chr8	95952304	T	C	Nonsense	Exon
SLC11A1	chr2	219249005	C	G	Nonsense	Exon
LRBA	chr4	151827481	C	T	Nonsense	Exon
CEBPZ	chr2	37439069	A	G	Nonsense	Exon
ETAA1	chr2	67630823	A	G	Nonsense	Exon
SEMA3G	chr3	52474994	G	A	Nonsense	Exon
IFRD2	chr3	50325883	T	G	Nonsense	Exon
FAT1	chr4	187541196	A	C	Nonsense	Exon
CEP290	chr12	88514827	C	T	Nonsense	Exon
HTRA1	chr10	124221227	C	T	Nonsense	Exon

Table VI. Single nucleotide polymorphism genotyping results at 15 gene loci.

Table VI.

Single nucleotide polymorphism genotyping results at 15 gene loci.

	SNP genotype
Gene locus	Control subjects	Sporadic colorectal cancer patients	HNPCC family
DDX20 (rs112298707)	GG	GG	GT
ZFYVE26 (rs68264412)	CC	CC	CT
PIK3R3 (rs46509382)	TT	TT	CT
SLC26A8 (rs35911730)	GG	GG	GA
ZEB2 (rs145156750)	CC	CC	CA
TP53INP1 (rs95952304)	TT	TT	CT
SLC11A1 (rs219249005)	CC	CC	CG
LRBA (rs151827481)	CC	CC	CT
CEBPZ (rs37439069)	AA	AA	GA
ETAA1 (rs67630823)	AA	AA	GA
SEMA3G (rs52474994)	GG	GG	GA
IFRD2 (rs50325883)	TT	TT	GT
FAT1 (rs187541196)	AA	AA	CA
CEP290 (rs88514827)	CC	CC (80/81) CT (1/81)	CT
HTRA1 (rs124221227)	CC (7/12) TC (5/12)	CC (47/81) TC (29/81) TT (1/81) not detected (4/81)	TC

[i] SNP, single nucleotide polymorphism; HNPCC, hereditary non-polyposis colorectal cancer.

Discussion

HNPCC is the most common hereditary colorectal cancer and exhibits familial aggregation; it is often accompanied by synchronous and metachronous colorectal cancer. The incidence of extraintestinal malignant tumors in HNPCC patients was previously revealed to be significantly higher than that in normal subjects (2). MMR gene defects are the molecular genetic basis of HNPCC pathogenesis, and ~90% of MMR gene mutations occur in the hMSH2 and hMLHl genes (10). However, in certain patients who meet the clinical diagnostic criteria for HNPCC, MMR gene defects cannot be detected (11,12).

In the present study, 3 HNPCC cases underwent whole exome sequencing. Mutations were newly identified at 15 gene loci. These 15 genes were investigated using an SNP genotyping assay in 96 subjects, including HNPCC patients, sporadic colorectal cancer patients and control subjects. The 15 loci carried the same mutations in all 3 HNPCC patients. However, in the 12 control subjects and 81 sporadic colorectal cancer patients, genotypes were wild-type at 13 of the 15 gene loci, indicating that mutations in these 13 genes may be associated with HNPCC pathogenesis. A number of these 13 genes have been revealed to be associated with the development and progression of malignant tumors (13–28), autoimmune diseases, tuberculosis and other infectious diseases (28), and sperm differentiation (29). However, the consequences of mutations in these 13 genes have not previously been reported in the pathology of colorectal cancer.

The results of the present study revealed that certain sporadic colorectal cancer patients and control subjects carry mutations in the HTRA1 gene. The expression level of the HTRA1 gene is associated with the prognosis of various types of malignant cancer, including liver cancer, breast cancer and mesothelioma (30,31). Additionally, 1 of the 81 sporadic colorectal cancer patients in the present study carried a mutation in the CEP290 gene that was also present in colorectal cancer patients from the HNPCC family. However, there have been no reports of a correlation between CEP290 mutations and the pathogenesis of malignant tumors. Future studies will further verify whether HTRA1 and CEP290 are susceptibility genes for HNPCC by expanding sample sizes.

In the present study, 13 genes that may be susceptibility genes for HNPCC were identified by whole exome sequencing and SNP genotyping experiments. In the future, studies will focus on large-scale genetic screening and in vivo and in vitro experiments in order to investigate the mechanisms of the confirmed mutations in the development and progression of colorectal cancer. It is anticipated that more pathogenic genes will be discovered and that our understanding of the molecular genetic basis of HNPCC will be improved, thereby providing theoretical guidance for the diagnosis and treatment of HNPCC.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81572965) and the 125 Talent Project/New Xiangya Project of the Third Xiangya Hospital of Central South University.

References