Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer

  • Authors:
    • Li Yu
    • Bo Yin
    • Kaiying Qu
    • Jingjing Li
    • Qiao Jin
    • Ling Liu
    • Chunlan Liu
    • Yuxing Zhu
    • Qi Wang
    • Xiaowei Peng
    • Jianda Zhou
    • Peiguo Cao
    • Ke Cao
  • View Affiliations / Copyright

    Affiliations: Department of Oncology, Third Xiangya Hospital of Central South University, Changsha, Hunan 410013, P.R. China, Department of Plastic and Reconstructive Surgery, Third Xiangya Hospital of Central South University, Changsha, Hunan 410013, P.R. China, Department of Out‑patient Office, Third Xiangya Hospital of Central South University, Changsha, Hunan 410013, P.R. China, Department of Gynecology and Obstetrics, Third Xiangya Hospital of Central South University, Changsha, Hunan 410013, P.R. China, Department of Head and Neck Surgery and Oncology Plastic Surgery, The Affiliated Cancer Hospital of Xiangya Medical School, Central South University, Changsha, Hunan 410013, P.R. China
  • Pages: 9413-9419
    |
    Published online on: April 16, 2018
       https://doi.org/10.3892/ol.2018.8504
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the present study, hereditary non‑polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High‑throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non‑synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild‑type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1. The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild‑type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1.

Introduction

Hereditary non-polyposis colorectal cancer (HNPCC), also known as Lynch syndrome, is inherited as an autosomal dominant disease and is the most common hereditary colorectal cancer, accounting for ~50% of familial colorectal cancer and 3% of all colorectal cancer cases (1). Unlike with sporadic colorectal cancer, HNPCC is associated with specific genetic factors and significant clinicopathological features. These features are often associated with synchronous and metachronous colorectal cancer and cause a high incidence of extraintestinal malignant tumors, including endometrial, gastric, renal, pancreatic and ovarian cancer types (2). Inactivation of DNA mismatch repair (MMR) genes, including MLH1, MSH2, MSH6 and PMS2, is the molecular genetic basis of HNPCC pathogenesis. Mutation of MMR genes can result in loss of DNA MMR function, leading to aberrant DNA replication, increased spontaneous mutation frequency and microsatellite instability. This ultimately leads to the transformation of normal cells into malignant cells (3–5).

However, a previous study observed that certain HNPCC patients, diagnosed by the presence of MMR gene mutations, did not meet some of the clinical diagnostic criteria for HNPCC (6). Furthermore, in certain patients meeting the clinical diagnostic criteria for HNPCC, MMR gene mutations could not be detected (7,8). Bashyam et al (8) demonstrated that, among 48 patients with Lynch syndrome, only 58% had MMR gene expression defects, which indicated that other, as yet unidentified, causative genes may be involved in the pathogenesis of HNPCC.

Based upon this assumption, in the present study, whole exome sequencing was performed in 3 HNPCC patients from 1 family and unreported mutations were observed in 15 gene loci. Subsequently, peripheral blood was collected from control subjects, sporadic colorectal cancer patients and the aforementioned 3 HNPCC patients. Single nucleotide polymorphism (SNP) genotyping assays were also performed on the aforementioned 15 genes using the DNA MassARRAY Genetic Analysis system to further verify whether these genes were associated with HNPCC pathogenesis.

Materials and methods

Blood sample collection

All procedures in studies involving human participants were performed in accordance with the ethical standards of the institutional and/or national research committee and the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. All patients signed informed consent forms prior to participation in the study and the study was approved by the Third Xiangya Hospital Ethics Committee (Changsha, China).

Blood samples were collected from 96 subjects, including 12 control subjects, 81 sporadic colorectal cancer patients who were diagnosed by histopathology from January 2014 to December 2016 at the Third Xiangya Hospital of Central South University and 3 HNPCC patients from the aforementioned hospital who met the Amsterdam Criteria (9), which is outlined as follows: i) ≥3 colorectal cancer cases in the same family diagnosed by histopathology, one case being a first-degree relative (parent or sibling) of the other two cases; ii) ≥2 successive generations affected; iii) ≥1 case with onset prior to the age of 50 years; and iv) familial adenomatous polyposis in HNPCC patients should be excluded. In the HNPCC family investigated in the present study, the proband's father had colorectal cancer that was diagnosed by histopathology and the other 2 cases who provided samples were a sibling and a cousin of the proband. The 3 patients experienced changes in their stools and abdominal bloating prior to being hospitalized. Colorectal cancer was diagnosed by histopathology (all pathology diagnoses were confirmed by two deputy or chief director pathologists) following radical surgery (Table I). The pedigree of the HNPCC family is presented in Fig. 1.

Figure 1.

Pedigree of the HNPCC family. HNPCC, hereditary non-polyposis colorectal cancer.

Table I.

Clinical characteristics of 3 hereditary non-polyposis colorectal cancer patients.

Table I.

Clinical characteristics of 3 hereditary non-polyposis colorectal cancer patients.

Sample nameSexAge, yearsMain symptomsPathological types
LahMale47Stool changes for 1 year, abdominal bloating for 2 months Moderately-differentiated adenocarcinoma
LyhMale45Blood in stools, abdominal bloating, weight loss and stool changes for 2 years Moderately-differentiated adenocarcinoma
LylFemale42Abdominal bloating and pain, hypodynamia and stool changes for 3 months.Well-differentiated adenocarcinoma
Whole exome sequencing

DNA was extracted from the peripheral blood of 3 HNPCC cases and purified using a DNeasy Blood and Tissue kit (cat. no. 69506; Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocols. Exome sequences were subjected to DNA sequencing on the Illumina platform using Illumina PE Flow Cell v3-HS (Illumina, Inc., San Diego, CA, USA). In accordance with the manufacturer's protocols, genomic DNA fragments were processed by end repair, addition of adenosine (A) to 3′ ends, ligation, DNA enrichment and hybridization. DNA libraries from samples were constructed. The concentration, purity and size of the libraries were measured using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA) and a Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The hybridization of sequencing primers and the generation of clusters were performed using cBot (HiSeq 2500; Illumina, Inc.) following the cBot User Guide (Part #15006165; Rev. F; lllumina, Inc.). A paired-end sequencing was then performed on a cluster-containing flow cell following the manufacturer's protocols (HiSeq 2500; Illumina, Inc.). Data acquisition software (Illumina, Inc.) was used for quality control and data analysis. The quality control standards for sequencing results were as follows: The average coverage for an exon region was ~100 times; if the average coverage was <90 times, it was resequenced; and at 100 times coverage, ≥85% of exon regions were covered by ≥1 sequence (Table II). The Burrows-Wheeler Alignment software package (version 0.5.9; Shanghai Biotechnology, China) was used to map sequences using human hg19 as the reference genome. Potential PCR duplicates were removed using rmdup of Samtools-0.1.18 (Shanghai Biotechnology, China), and mapping statistics were generated using Samtools flagstat (Shanghai Biotechnology, China) (Table III). Capture-enrichment methods were used to determine the amount of fragment from the captured target region and the coverage and depth of the target region.

Table II.

Sequence quality control results for 3 hereditary non-polyposis colorectal cancer patients.

Table II.

Sequence quality control results for 3 hereditary non-polyposis colorectal cancer patients.

Sample nameOrientationTotal reads, nTotal bases, nQ20, %Depth1×, %Quality of sequencing results
Lah-1Forward48,356,7134,835,671,30098105.6999.95Good
Lah-2Reverse48,356,7134,835,671,30097 Good
Lyl-1Forward73,411,9527,341,195,20097149.8799.86Good
Lyl-2Reverse73,411,9527,341,195,20095 Good
Lyh-1Forward57,778,0315,777,803,10097120.2599.96Good
Lyh-2Reverse57,778,0315,777,803,10095 Good

[i] The Q20 value refers to the probability of error given to the identified base in the base calling process. If the mass value is Q20, the probability of error recognition is 1%, that is, the error rate is 1% or the correct rate is 99%. The 1× value refers to the likelihood that there is at least one read coverage in the genome sequence.

Table III.

Sequence mapping information for 3 hereditary non-polyposis colorectal cancer patients.

Table III.

Sequence mapping information for 3 hereditary non-polyposis colorectal cancer patients.

Sample nameFiltered reads, nMapped reads, nMap ratio, %Unique mapped reads, nUnique mapped ratio, %
Lyh107,719,930105,656,06998.0895,653,93288.80
Lyl136,284,036133,688,25598.10120,411,34888.35
Lah92,361,75891,224,39598.7783,257,84790.14

[i] Filtered reads, number of reads that pass filtering with sequenator; mapped reads, number of reads that map to each reference sequence; map ratio, ratio of mapped reads to filtered reads; unique mapped reads, number of reads that can map to each reference sequence after removing potential polymerase chain reaction duplicates using the Samtools rmdup tool; Unique Mapped Ratio, ratio of unique mapped reads to mapped reads.

SNP genotyping
DNA extraction

DNA was extracted from peripheral blood lymphocytes of the 96 samples using a DNeasy Blood and Tissue kit (Qiagen, Inc.), according to the manufacturer's protocols. DNA was quantified and assessed using a NanoDrop®ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and 0.8% agarose gel electrophoresis.

PCR amplification

PCR primer mixes were obtained from Invitrogen (Invitrogen, Thermo Fisher Scientific, Inc.) (Table IV). The Q-PCR Detection Kit was purchased from GeneCopoeia (Rockville, MD, USA). The First Strand cDNA Synthesis kit was purchased from Fermentas (Thermo Fisher Scientific, Inc.). Total PCR volume was 5 µl, including 1 µl template DNA, 1.8 µl ddH2O, 0.5 µl 10X PCR Buffer, 0.1 µl 25 mmol/l dNTPs, 0.4 µl 25 mmol/l MgCl2, 1 µl PCR Primer (0.5 mmol/l) and 0.2 µl Gold Tag PCR enzyme (Advanced Biotechnologies Inc., Eldersburg, MD, USA). PCR conditions were 95°C for 2 min, then 45 cycles of 95°C for 30 sec, 50°C for 30 sec, 72°C for 1 min and 72°C for 5 min.

Table IV.

Names and sequences of polymerase chain reaction primers.

Table IV.

Names and sequences of polymerase chain reaction primers.

Name of primerSequence of primer
BB14228-3chr1_112298707-F ACGTTGGATGACCGCTCAGGATCTCAGCAG
BB14228-3chr14_68264412-F ACGTTGGATGAGCAACCTTCCCGAAGATAC
BB14228-3chr1_46509382-F ACGTTGGATGATCCTTGGTTCAGCACAACG
BB14228-3chr6_35911730-F ACGTTGGATGCCCTCTGGTGAGTATGAATC
BB14228-3chr2_145156750-F ACGTTGGATGAATTTTCAGCAGTTCATCGG
BB14228-3chr8_95952304-F ACGTTGGATGCTGTTTACCGGCATCTCTTG
BB14228-3chr2_219249005-F ACGTTGGATGCCTGAAGATCTGACTCGATG
BB14228-3chr4_151827481-F ACGTTGGATGGAACTCAATTGCTATGCAGG
BB14228-3chr2_37439069-F ACGTTGGATGACATCCATGAATGTTCCTCC
BB14228-3chr2_67630823-F ACGTTGGATGGACAAATGCTTTGAAAGAGG
BB14228-3chr3_52474994-F ACGTTGGATGTCACCTAGCTGGTCAAAGTG
BB14228-3chr3_50325883-F ACGTTGGATGCAGAACAATGAGCTACTCCG
BB14228-3chr12_88514827-F ACGTTGGATGTGAGAGAACAGCTGAACTGG
BB14228-3chr4_187541196-F ACGTTGGATGAGTTATCGTTCCGATCACTG
BB14228-3chr10_124221227-F ACGTTGGATGAGAGTCGCCATGCAGATCC
BB14228-3chr1_112298707-R ACGTTGGATGAAAGCAGCAGTGACTCGAAG
BB14228-3chr14_68264412-R ACGTTGGATGAGCTCTTCAGATTACCTGCC
BB14228-3chr1_46509382-R ACGTTGGATGTATCTGCAAAGCGAGGGCAT
BB14228-3chr6_35911730-R ACGTTGGATGATCATCCGTCTATGGCTTCC
BB14228-3chr2_145156750-R ACGTTGGATGCCATCAACCCATACAAGGAC
BB14228-3chr8_95952304-R ACGTTGGATGTCTCCTCCATTGGACATGAC
BB14228-3chr2_219249005-R ACGTTGGATGTTCAGCCTGCGGAAGCTATG
BB14228-3chr4_151827481-R ACGTTGGATGACCTTTTCAAGGCTATATCC
BB14228-3chr2_37439069-R ACGTTGGATGACTTGGTAACCTGGATGACG
BB14228-3chr2_67630823-R ACGTTGGATGGAGAAGAAAGTGATCGTGGG
BB14228-3chr3_52474994-R ACGTTGGATGTGGAGCACTTTCCTCAAGGC
BB14228-3chr3_50325883-R ACGTTGGATGTCTCAAAGCGTGGAACCTTG
BB14228-3chr12_88514827-R ACGTTGGATGAACCTCTTCAGAGCCTCAAC
BB14228-3chr4_187541196-R ACGTTGGATGTCTCTGCAATCTCTGCACTG
BB14228-3chr10_124221227-R ACGTTGGATGAGCGGCCGGCCCGGGACAG
BB14228-3chr1_112298707-EX CCGCCAACAGCACATCC
BB14228-3chr14_68264412-EX GGCTCCTTCTTGTCCGA
BB14228-3chr1_46509382-EX TCTGTGCATGAACAGGG
BB14228-3chr6_35911730-EX TGGTCAGTGGAGAGGAGA
BB14228-3chr2_145156750-EX ACTATGCTATGAACATGGA
BB14228-3chr8_95952304-EX CCATTGGACATGACTCAAAC
BB14228-3chr2_219249005-EX AAGCTATGGGCCTTCACGGGG
BB14228-3chr4_151827481-EX CTATATCCTATTACCAAGAAGC
BB14228-3chr2_37439069-EX GATGAAGTTTCTTTAGGAAGTA
BB14228-3chr2_67630823-EX GAAAGTGATCGTGGGGTTTTAT
BB14228-3chr3_52474994-EX TCCTCAAGGCCAGGCTGGTCTGCT
BB14228-3chr3_50325883-EX TTGCAGGCCTTCAGGGCAGTGGCA
BB14228-3chr12_88514827-EX AGCCTCAACTAATTCTTTATCCTTTT
BB14228-3chr4_187541196-EX CTCTGCACTGTAGAAAGGTTTTTCAA
BB14228-3chr10_124221227-EX GGCCGGCCCGGGACAGCTGCGCCGAG
Shrimp alkaline phosphatase (SAP) purification

The total volume for the SAP purification reaction was 2 µl. This included 1.53 µl ddH2O, 0.17 µl SAP Buffer and 0.3 µl SAP enzyme (Sequenom, San Diego, CA, USA). Reaction conditions were 37°C for 40 min and 85°C for 5 min.

Extension reaction

The extension reaction was performed using a 9700 PCR instrument (Sequenom, Inc., San Diego, CA, USA) according to the manufacturer's protocol. The Complete iPLEX® Gold Genotyping Reagent Set was purchased from Sequenom. The total volume of the extension reaction was 2 µl and included 0.619 µl ddH2O, 0.2 µl iPLEX GOLD Buffer, 0.2 µl iPLEXTermination mix, 0.94 µl iPLEX Extension Primer mix and 0.041 µl iPLEX Enzyme. Extension reaction conditions were 40 cycles of 94°C for 30 sec and 94°C for 5 sec, and 5 cycles of 52°C for 5 sec and 80°C for 5 sec, followed by 1 cycle of 72°C for 3 min. The PCR products were purified using resin, were spotted onto a chip and were analyzed on the MassARRAY Platform SEQUENOM Analyzer 4 (Sequenom, Inc.).

Results

Whole exome sequencing generated 60.4 Gb of data from the 3 HNPCC patients. These data were screened as follows: i) Remove bases with low scores in accordance with the quality control specifications that require the sample coverage to be <5 and fraction variation in a single nucleotide to be <40; ii) filter and eliminate bases that do not fall in exonic regions; iii) filter and eliminate proven mutations in controls and common mutations carried by controls that are archived in public genetic mutation databases, namely HAPMAP (ftp://ftp.ncbi.nlm.nih.gov/hapmap/), 1,000 Genomes (http://www.internationalgenome.org/1000-genomes-project-publications) and dbSNP (https://www.ncbi.nlm.nih.gov/snp/); iv) reserve single nucleotide loci changes in non-synonymous mutations and filter out single nucleotide changes in synonymous mutations; and v) select the non-synonymous mutations that are common to the 3 cases. From this analysis the following mutations were identified in 15 genes (Table V): DDX20 (rs112298707), ZFYVE26 (rs68264412), PIK3R3 (rs46509382), SLC26A8 (rs35911730), ZEB2 (rs145156750), TP53INP1 (rs95952304), SLC11A1 (rs219249005), LRBA (rs151827481), CEBPZ (rs37439069), ETAA1 (rs67630823), SEMA3G (rs52474994), IFRD2 (rs50325883), FAT1 (rs18754119), CEP290 (rs88514827) and HTRA1 (rs124221227). SNP genotyping of these 15 genes was then performed in 96 subjects using the DNA MassARRAY Genetic Analysis system (Sequenom) (Table VI). Among the 96 samples, SNP genotyping was successful at all 15 loci in 92, but genotyping of HTRA1 (rs124221227C>T) failed in 4 of the sporadic colorectal cancer samples (Fig. 2). The genotype of CEP290 (rs88514827C>T) in all 12 control subjects was wild-type, while 1 of the 81 patients with sporadic colorectal cancer had a mutation in CEP290 (rs88514827C>T) (Fig. 2A). A total of 5/12 control subjects and 30/81 sporadic colorectal cancer patients had mutations in HTRA1 (rs124221227C>T). The genotypes of the other 13 genes in the 12 control subjects and 81 sporadic colorectal cancer patients were all wild-type, namely DDX20 (rs112298707G>T), ZFYVE26 (rs68264412C>T), PIK3R3 (rs46509382T>C), SLC26A8 (rs35911730G>A), ZEB2 (rs145156750C>A), TP53INP1 (rs95952304T>C), SLC11A1 (rs219249005C>G), LRBA (rs151827481C>T), CEBPZ (rs37439069A>G), ETAA1 (rs67630823A>G), SEMA3G (rs52474994G>A), IFRD2 (rs50325883 T>G) and FAT1 (rs187541196A>C) (two of these were selected as examples and are presented in Fig. 3). In all 3 HNPCC patients, all 15 genes carried the same mutations.

Figure 2.

DNA spectrums of (A) CEP290 and (B) HTRA1. b, T-base dissociation absorption peak; d, C-base dissociation absorption peak.

Figure 3.

DNA spectrums of (A) DDX20 and (B) SLC26A8. a, G-base dissociation absorption peak; b, T-base dissociation absorption peak; c, A-base dissociation absorption peak.

Table V.

15 single nucleotide mutations detected following integration.

Table V.

15 single nucleotide mutations detected following integration.

Gene nameChromosome numberPositionReference baseSequencing baseMutation typeGene position
DDX20chr1112298707GTNonsenseExon
ZFYVE26chr1468264412CTNonsenseExon
PIK3R3chr146509382TCNonsenseExon
SLC26A8chr635911730GANonsenseExon
ZEB2chr2145156750CANonsenseExon
TP53INP1chr895952304TCNonsenseExon
SLC11A1chr2219249005CGNonsenseExon
LRBAchr4151827481CTNonsenseExon
CEBPZchr237439069AGNonsenseExon
ETAA1chr267630823AGNonsenseExon
SEMA3Gchr352474994GANonsenseExon
IFRD2chr350325883TGNonsenseExon
FAT1chr4187541196ACNonsenseExon
CEP290chr1288514827CTNonsenseExon
HTRA1chr10124221227CTNonsenseExon

Table VI.

Single nucleotide polymorphism genotyping results at 15 gene loci.

Table VI.

Single nucleotide polymorphism genotyping results at 15 gene loci.

SNP genotype

Gene locusControl subjectsSporadic colorectal cancer patientsHNPCC family
DDX20 (rs112298707)GGGGGT
ZFYVE26 (rs68264412)CCCCCT
PIK3R3 (rs46509382)TTTTCT
SLC26A8 (rs35911730)GGGGGA
ZEB2 (rs145156750)CCCCCA
TP53INP1 (rs95952304)TTTTCT
SLC11A1 (rs219249005)CCCCCG
LRBA (rs151827481)CCCCCT
CEBPZ (rs37439069)AAAAGA
ETAA1 (rs67630823)AAAAGA
SEMA3G (rs52474994)GGGGGA
IFRD2 (rs50325883)TTTTGT
FAT1 (rs187541196)AAAACA
CEP290 (rs88514827)CCCC (80/81) CT (1/81)CT
HTRA1 (rs124221227)CC (7/12) TC (5/12)CC (47/81) TC (29/81) TT (1/81) not detected (4/81)TC

[i] SNP, single nucleotide polymorphism; HNPCC, hereditary non-polyposis colorectal cancer.

Discussion

HNPCC is the most common hereditary colorectal cancer and exhibits familial aggregation; it is often accompanied by synchronous and metachronous colorectal cancer. The incidence of extraintestinal malignant tumors in HNPCC patients was previously revealed to be significantly higher than that in normal subjects (2). MMR gene defects are the molecular genetic basis of HNPCC pathogenesis, and ~90% of MMR gene mutations occur in the hMSH2 and hMLHl genes (10). However, in certain patients who meet the clinical diagnostic criteria for HNPCC, MMR gene defects cannot be detected (11,12).

In the present study, 3 HNPCC cases underwent whole exome sequencing. Mutations were newly identified at 15 gene loci. These 15 genes were investigated using an SNP genotyping assay in 96 subjects, including HNPCC patients, sporadic colorectal cancer patients and control subjects. The 15 loci carried the same mutations in all 3 HNPCC patients. However, in the 12 control subjects and 81 sporadic colorectal cancer patients, genotypes were wild-type at 13 of the 15 gene loci, indicating that mutations in these 13 genes may be associated with HNPCC pathogenesis. A number of these 13 genes have been revealed to be associated with the development and progression of malignant tumors (13–28), autoimmune diseases, tuberculosis and other infectious diseases (28), and sperm differentiation (29). However, the consequences of mutations in these 13 genes have not previously been reported in the pathology of colorectal cancer.

The results of the present study revealed that certain sporadic colorectal cancer patients and control subjects carry mutations in the HTRA1 gene. The expression level of the HTRA1 gene is associated with the prognosis of various types of malignant cancer, including liver cancer, breast cancer and mesothelioma (30,31). Additionally, 1 of the 81 sporadic colorectal cancer patients in the present study carried a mutation in the CEP290 gene that was also present in colorectal cancer patients from the HNPCC family. However, there have been no reports of a correlation between CEP290 mutations and the pathogenesis of malignant tumors. Future studies will further verify whether HTRA1 and CEP290 are susceptibility genes for HNPCC by expanding sample sizes.

In the present study, 13 genes that may be susceptibility genes for HNPCC were identified by whole exome sequencing and SNP genotyping experiments. In the future, studies will focus on large-scale genetic screening and in vivo and in vitro experiments in order to investigate the mechanisms of the confirmed mutations in the development and progression of colorectal cancer. It is anticipated that more pathogenic genes will be discovered and that our understanding of the molecular genetic basis of HNPCC will be improved, thereby providing theoretical guidance for the diagnosis and treatment of HNPCC.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81572965) and the 125 Talent Project/New Xiangya Project of the Third Xiangya Hospital of Central South University.

References

1 

Kastrinos F and Stoffel EM: History, genetics, and strategies for cancer prevention in Lynch syndrome. Clin Gastroenterol Hepatol. 12:715–727; quiz e41-43. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Watson P and Riley B: The tumor spectrum in the Lynch syndrome. Fam Cancer. 4:245–248. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Fishel R, Lescoe MK, Rao MR, Copeland NG, Jenkins NA, Garber J, Kane M and Kolodner R: The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell. 75:1027–1038. 1993. View Article : Google Scholar : PubMed/NCBI

4 

Bronner CE, Baker SM, Morrison PT, Warren G, Smith LG, Lescoe MK, Kane M, Earabino C, Lipford J, Lindblom A, et al: Mutation in the DNA mismatch repair gene homologue hMLH1 is associated with hereditary non-polyposis colon cancer. Nature. 368:258–261. 1994. View Article : Google Scholar : PubMed/NCBI

5 

Whitehouse A, Meredith DM and Markham AF: DNA mismatch repair genes and their association with colorectal cancer (Review). Int J Mol Med. 1:469–474. 1998.PubMed/NCBI

6 

Hampel H, Frankel WL, Martin E, Arnold M, Khanduja K, Kuebler P, Nakagawa H, Sotamaa K, Prior TW, Westman J, et al: Screening for the Lynch syndrome (hereditary nonpolyposis colorectal cancer). N Engl J Med. 352:1851–1860. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Lynch HT and de la Chapelle A: Hereditary colorectal cancer. N Engl J Med. 348:919–932. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Bashyam MD, Kotapalli V, Raman R, Chaudhary AK, Yadav BK, Gowrishankar S, Uppin SG, Kongara R, Sastry RA, Vamsy M, et al: Evidence for presence of mismatch repair gene expression positive Lynch syndrome cases in India. Mol Carcinog. 54:1807–1814. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Vasen HF, Mecklin JP, Khan PM and Lynch HT: The International Collaborative Group on Hereditary Non-Polyposis Colorectal Cancer (ICG-HNPCC). Dis Colon Rectum. 34:424–425. 1991. View Article : Google Scholar : PubMed/NCBI

10 

Peltomäki P and Vasen H: Mutations associated with HNPCC predisposition-Update of ICG-HNPCC/INSiGHT mutation database. Dis Markers. 20:269–276. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Lindor NM: Familial colorectal cancer type X: The other half of hereditary nonpolyposis colon cancer syndrome. Surg Oncol Clin N Am. 18:637–645. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Nieminen TT, O'Donohue MF, Wu Y, Lohi H, Scherer SW, Paterson AD, Ellonen P, Abdel-Rahman WM, Valo S, Mecklin JP, et al: Germline mutation of RPS20, encoding a ribosomal protein, causes predisposition to hereditary nonpolyposis colorectal carcinoma without DNA mismatch repair deficiency. Gastroenterology. 147:595–598.e5. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Yang H, Dinney CP, Ye Y, Zhu Y, Grossman HB and Wu X: Evaluation of genetic variants in microRNA-related genes and risk of bladder cancer. Cancer Res. 68:2530–2537. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Shin EM, Hay HS, Lee MH, Goh JN, Tan TZ, Sen YP, Lim SW, Yousef EM, Ong HT, Thike AA, et al: DEAD-box helicase DP103 defines metastatic potential of human breast cancers. J Clin Invest. 124:3807–3824. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Sagona AP, Nezis IP, Bache KG, Haglund K, Bakken AC, Skotheim RI and Stenmark H: A tumor-associated mutation of FYVE-CENT prevents its interaction with Beclin 1 and interferes with cytokinesis. PLoS One. 6:e170862011. View Article : Google Scholar : PubMed/NCBI

16 

Wen JF BB, Zhang XB and Jiang-Ping XU: Expression and significance of ZFYVE26 in hepatocellular carcinoma. J Prac Med. 28:1939–1942. 2012.

17 

Cao G, Dong W, Meng X, Liu H, Liao H and Liu S: MiR-511 inhibits growth and metastasis of human hepatocellular carcinoma cells by targeting PIK3R3. Tumour Biol. 36:4453–4459. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Wang G, Yang X, Li C, Cao X, Luo X and Hu J: PIK3R3 induces epithelial-to-mesenchymal transition and promotes metastasis in colorectal cancer. Mol Cancer Ther. 13:1837–1847. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Wong TS, Gao W and Chan JY: Transcription regulation of E-cadherin by zinc finger E-box binding homeobox proteins in solid tumors. Biomed Res Int. 2014:9215642014. View Article : Google Scholar : PubMed/NCBI

20 

Shahbazi J, Lock R and Liu T: Tumor protein 53-induced nuclear protein 1 enhances p53 function and represses tumorigenesis. Front Genet. 4:802013. View Article : Google Scholar : PubMed/NCBI

21 

Zhou X, Ma L, Li J, Gu J, Shi Q and Yu R: Effects of SEMA3G on migration and invasion of glioma cells. Oncol Rep. 28:269–275. 2012.PubMed/NCBI

22 

Valletta D, Czech B, Spruss T, Ikenberg K, Wild P, Hartmann A, Weiss TS, Oefner PJ, Müller M, Bosserhoff AK and Hellerbrand C: Regulation and function of the atypical cadherin FAT1 in hepatocellular carcinoma. Carcinogenesis. 35:1407–1415. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Morris LG, Kaufman AM, Gong Y, Ramaswami D, Walsh LA, Turcan Ş, Eng S, Kannan K, Zou Y, Peng L, et al: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation. Nat Genet. 45:253–261. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Wang JW, Gamsby JJ, Highfill SL, Mora LB, Bloom GC, Yeatman TJ, Pan TC, Ramne AL, Chodosh LA, Cress WD, et al: Deregulated expression of LRBA facilitates cancer cell growth. Oncogene. 23:4089–4097. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Herold T, Metzeler KH, Vosberg S, Hartmann L, Röllig C, Stölzel F, Schneider S, Hubmann M, Zellmeier E, Ksienzyk B, et al: Isolated trisomy 13 defines a homogeneous AML subgroup with high frequency of mutations in spliceosome genes and poor prognosis. Blood. 124:1304–1311. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Wu DI, Liu L, Ren C, Kong D, Zhang P, Jin X, Wang T and Zhang G: Epithelial-mesenchymal interconversions and the regulatory function of the ZEB family during the development and progression of ovarian cancer. Oncol Lett. 11:1463–1468. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Childs EJ, Mocci E, Campa D, Bracci PM, Gallinger S, Goggins M, Li D, Neale RE, Olson SH, Scelo G, et al: Common variation at 2p13.3, 3q29, 7p13 and 17q25.1 associated with susceptibility to pancreatic cancer. Nat Genet. 47:911–916. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Archer NS, Nassif NT and O'Brien BA: Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: Systematic review and meta-analysis. Genes Immun. 16:275–283. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U, Markovich D and Kere J: Functional characterization of three novel tissue-specific anion exchangers SLC26A7, -A8 and -A9. J Biol Chem. 277:14246–14254. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Zhu F, Jin L, Luo TP, Luo GH, Tan Y and Qin XH: Serine protease HtrA1 expression in human hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int. 9:508–512. 2010.PubMed/NCBI

31 

Lehner A, Magdolen V, Schuster T, Kotzsch M, Kiechle M, Meindl A, Sweep FC, Span PN and Gross E: Downregulation of serine protease HTRA1 is associated with poor survival in breast cancer. PLoS One. 8:e603592013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu L, Yin B, Qu K, Li J, Jin Q, Liu L, Liu C, Zhu Y, Wang Q, Peng X, Peng X, et al: Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer. Oncol Lett 15: 9413-9419, 2018.
APA
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L. ... Cao, K. (2018). Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer. Oncology Letters, 15, 9413-9419. https://doi.org/10.3892/ol.2018.8504
MLA
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L., Liu, C., Zhu, Y., Wang, Q., Peng, X., Zhou, J., Cao, P., Cao, K."Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer". Oncology Letters 15.6 (2018): 9413-9419.
Chicago
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L., Liu, C., Zhu, Y., Wang, Q., Peng, X., Zhou, J., Cao, P., Cao, K."Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer". Oncology Letters 15, no. 6 (2018): 9413-9419. https://doi.org/10.3892/ol.2018.8504
Copy and paste a formatted citation
x
Spandidos Publications style
Yu L, Yin B, Qu K, Li J, Jin Q, Liu L, Liu C, Zhu Y, Wang Q, Peng X, Peng X, et al: Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer. Oncol Lett 15: 9413-9419, 2018.
APA
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L. ... Cao, K. (2018). Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer. Oncology Letters, 15, 9413-9419. https://doi.org/10.3892/ol.2018.8504
MLA
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L., Liu, C., Zhu, Y., Wang, Q., Peng, X., Zhou, J., Cao, P., Cao, K."Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer". Oncology Letters 15.6 (2018): 9413-9419.
Chicago
Yu, L., Yin, B., Qu, K., Li, J., Jin, Q., Liu, L., Liu, C., Zhu, Y., Wang, Q., Peng, X., Zhou, J., Cao, P., Cao, K."Screening for susceptibility genes in hereditary non‑polyposis colorectal cancer". Oncology Letters 15, no. 6 (2018): 9413-9419. https://doi.org/10.3892/ol.2018.8504
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team