This article is mentioned in:

Introduction

Colorectal carcinoma (CRC), which is prone to metastasis and recurrence, is a cancer with a high lethality rate worldwide. More than 50% of patients will develop metastasis and recurrence (1,2). Multiple factors account for metastasis and recurrence, including tumor stage, cancer subtypes and cancer stem cells (CSCs). CSCs are a small population of tumor-initiating cells that have the ability to self-renew and differentiate in tumors in vivo. CSCs are involved in various processes during tumor formation, progression, and angiogenesis and are considered an important target for novel cancer treatment strategies (3). Several specific surface markers are expressed on CSCs, including CD133, CD44 and aldehyde dehydrogenase 1 (ALDH1) (4). CD133 (also known as prominin-1) is a 5-transmembrane glycoprotein of 865 amino acids with a total molecular weight of 120 kDa. CD133 is a CSC marker in colon carcinoma. CD133-positive cells correlate strongly with poor prognosis and synchronous liver metastasis (5). Cancer cell populations with high expression of CD133 are much more aggressive in terms of metastases compared with those with low expression of CD133, suggesting that CD133 may be a marker of increased tumorigenesis ability. CD133-positive cells from clinical biopsy-derived cultures have been demonstrated to possess multilineage differentiation potential and are capable of tumor initiation in vivo. CD133-positive CRC cells are more resistant to chemoradiotherapy, and CD133 expression is associated with poor prognosis (6,7). However, the regulation of CD133 expression has not been fully elucidated.

The present study demonstrated that CD133 expression was associated with the tumor protein p53 (p53) expression in an HCT116 p53+/+ cell line. Of note, CD133-negative cells were detected in the colon cancer cell line HCT116 in a previous report by Kai et al (8). Although the p53 status of the HCT116 cell line was not mentioned in that previous study (8), it was speculated that an association of CD133 expression with p53 may be possible. Therefore, the present study focused on CD133 in HCT116 cell lines exhibiting different p53 expression status.

Wild-type p53 functions as a bona fide tumor suppressor gene that is involved in transcription, DNA replication and repair, cell cycle arrest, proliferation, apoptosis, angiogenesis inhibition, and cellular stress responses. Various types of cancer harbor p53 mutations. In specific, >50% of colon cancers contain p53 mutations (9,10). p53 is known to regulate the balance of asymmetric and symmetric divisions of stem cells. A broken balance of asymmetric and symmetric cell division leads to either tumor suppression or tumor expansion.

In the present study, CSC subpopulation distributions, marked by CD133 and CD44 expression, were significantly different in HCT116 p53+/+ and HCT116 p53−/− cell lines. Therefore, the hypothesis that there may be a functional interaction between the CSC biomarker CD133 and p53 was examined.

Materials and methods

Cell culture

The human colon cancer cell lines HCT116 p53+/+ and HCT116 p53−/− were well-established cell lines (11), kindly provided by Professor Xingzhi Xu (College of Life Sciences, Capital Normal University, Beijing, China) and maintained in our laboratory. All HCT116 cells were cultured in McCoy's 5A medium (HyClone; GE Healthcare Life Sciences, Logan, UT, USA). The human embryo kidney epithelial cell line 393T (cat. no. CL00022; Fengh Bio, Changsha, China) was cultured in Dulbecco's Modified Essential Medium (HyClone; GE Healthcare Life Sciences), supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences), 100 U/ml penicillin and 100 µg/ml streptomycin (both from Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a humidified atmosphere with 5% CO2 and incubated at 37°C.

Flow cytometric analysis

To harvest the cell samples, the cultured cells were incubated with 0.25% trypsin for 90 sec, collected and washed with cold PBS. The cell suspension was centrifuged at 300 × g for 10 min at room temperature, and the supernatant was discarded. The cells were resuspended in buffer containing PBS (pH 7.2), 0.5% bovine serum albumin (BSA), and 2 mM EDTA. Next, 10 µl of the CD133/1 (AC133)-fluorescein isothiocyanate (FITC) antibody (clone, 393C3, cat. no. 130-104-322) and 10 µl of the CD44-phycoerythrin (PE) antibody (clone DB105, cat. no. 130-098-108) (both from Miltenyi Biotec, GmbH, Bergisch, Germany) were added, mixed well and incubated for 10 min in the dark at 4°C. Then, the cells were washed with 1–2 ml buffer and centrifuged at 300 × g for 10 min at room temperature. Finally, the cell pellets were resuspended in 1% triformol for analysis by flow cytometry using the BD FACSDiva software version 7.0 (BD Biosciences, Franklin Lakes, NJ, USA).

Western blot analysis

Cells were harvested at different times, from 0 to 24 h. After the medium was discarded, cells were washed with ice-cold PBS twice and trypsinized on ice for 30 min. Cells lysates were prepared with M-PER™ cell lysis buffer (cat. no. 78501; Thermo Fisher Scientific, Waltham, MA, USA) at 4°C for 30 min, and then centrifuged at 11,500 × g for 15 min at 4°C. The protein concentration was measured by bicinchoninic acid protein assay, and A280 absorption was measured using a NanoDrop 2000c/2000 (Thermo Fisher Scientific, Inc.). A total of 40 µg protein extract was loaded onto a 10% SDS polyacrylamide gel. Following electrophoresis, proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and incubated with the indicated primary antibodies: Mouse anti-p53 (cat. no. ab1101, Abcam; Cambridge, UK) or mouse anti-GAPDH (cat. no. ab9485; Abcam) at a dilution of 1:1,000 at 4°C overnight. Then, the blots were incubated with a secondary horseradish peroxidase-conjugated goat anti-mouse antibody (dilution 1:2,000; cat. no. sc-2005; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at room temperature for 1 h. The protein signal was visualized using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Inc.).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

For detecting the CD133 mRNA expression levels in HCT116 p53+/+ cells and HCT116 p53−/− cells, total RNA was isolated with the TRIzol regent and treated with RNase-free DNase (both from Thermo Fisher Scientific, Inc.), and reverse transcribed into cDNA using ReverTraAce®qPCR RTMaster (Toyobo Life Science, Osaka, Japan). qPCR was performed using a DyNAmo ColorFlash SYBR Green qPCR kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The primers used were as follows: CD133 forward, 5′-GATTCATACTGGTGGCTGGGTGG-3′ and reverse, 5′-GCAGGTGAAGAGTGCCGTAAGT-3′; and β-actin forward, 5′-TTGAAGGTAGTTTCGTGGAT-3′ and reverse, 5′-ATCACCATTGGCAATGAGCG-3′. The thermocycling conditions for the qPCR were as follows: 95°C for 2 min, followed by 39 cycles of 95°C for 30 sec and 60°C for 30 sec, and finally 1 min at 68°C. Relative fold changes in mRNA expression were calculated using the formula 2−ΔΔCq (12).

CD133 promoter analysis

The CD133 promoter sequence (sequence ID, AY275524; obtained from http://www.genecopoeia.com/; target gene accession: NM_006017) was analyzed using a web-based prediction tool (http://tfbind.hgc.jp/). p53 was identified as one transcription factor that may interact with the CD133 promoter sequence.

siRNA and plasmid transfection

p53 siRNA oligonucleotides were from Taihe Biotechnology Co., Ltd. (Beijing, China) with a sense strand sequence of: 5′ATGGATCCGTGACACGCTTCCCTGGATTG3′. The control siRNA (cat. no. B01001) was purchased from GenePharma Co., Ltd. (Shanghai, China) and Flag-cmv2-p53 (GenePharma Co., Ltd., Shanghai, China) transfections, 1×106 HCT116 p53+/+ or HCT116 p53−/− cells, respectively, were plated in 60 mm dishes for transfection the following day. After 24 h, cells were transfected with 660 pmol p53 siRNA or 2 µg Flag-cmv2-p53 plasmid or its negative control Flag-cmv2 plasmid, using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.), following the manufacturer's instructions.

Dual-luciferase reporter assay

To measure the effect of p53 on the CD133 promoter activity, the Promega dual-luciferase reporter assay system (cat. no. E1910; Promega Corporation, Madison, WI, USA) was used, according to the manufacturer's instructions. HCT116 p53+/+ cells were co-transfected with 0.8 µg pGL3-pCD133 reporter vector or pGL3-basic control and 8 ng pRL-CMV vector, and simultaneously transfected with 660 pmol p53 siRNA or control siRNA. HCT116 p53−/− cells were co-transfected with 0.8 µg pGL3-pCD133 reporter vector or pGL3-basic control and 8 ng pRL-CMV vector, and simultaneously transfected with 1 µg Flag-cmv2-p53 vector or control. Expression of p53 protein and CD133 promoter activity were analyzed 24 h post-transfection. 293T cells were transfected exactly as described for the HCT116 cells. Transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.), according to manufacturer's instructions. Cells were harvested 24 h post-transfection and plated in 96-well plates. Then, firefly luciferase and Renilla luciferase activity were measured.

Statistical analysis

The graphs were plotted and analyzed using t-test or one-way analysis of variance in GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated at least three independent times. The data are presented as the mean ± standard deviation (SD).

Results

Distribution of the CD133-positive subpopulation in HCT116 p53+/+ and HCT116 p53−/− cell lines

After the p53 status was confirmed in both cell lines (Fig. 1A), flow cytometry was used to analyze CD133/CD44 expression in HCT116 cells. As illustrated in Fig. 1B, the CD133+/CD44+ subpopulation in the HCT116 p53+/+ cell line was 84.84±0.05% of total cells, while in the HCT116 p53−/− it was 4.13±0.02% of total cells. The difference in the CD133-positive CSC subpopulations between the two cell lines was statistically significant (P<0.001; Fig. 1C). However, there was no significant difference in the % of CD44-positive cell populations between these two cell lines (Fig. 1C). The CD133 mRNA expression levels, as detected by RT-qPCR (Fig. 1D), and the protein expression levels, as detected by western blot analysis (Fig. 1E), were also significantly reduced in HCT116 p53−/− cells compared with HCT116 p53+/+ cells.

Figure 1. Differential expression of the CSC surface marker CD133 in p53+/+ and p53−/− HCT116 cell lines. (A) Western blot analysis of p53 expression in HCT116 cell lines. (B) Flow cytometric analysis of CD133 and CD44 expression in p53+/+ and p53−/− HCT116 cell lines. (C) Quantification of flow cytometry results for CD133 and CD44 expression in the two HCT116 cell lines. *P<0.01, with comparisons indicated by brackets. (D) CD133 mRNA expression levels in p53+/+ and p53−/− HCT116 cell lines were detected by reverse transcription-quantitative polymerase chain reaction. *P<0.01 for p53+/+ vs. p53−/− HCT116 cells. (E) Western blot analysis of CD133 protein expression. CSC, cancer stem cell; PE, phycoerythrin; FITC, fluorescein isothiocyanate.

p53 activates CD133 expression

To examine whether p53 could regulate CD133 expression, p53-specific siRNA was used to abrogate p53 expression in HCT116 p53+/+ cells. The western blot analysis and qPCR results confirmed that expression of p53 protein (Fig. 2A) and mRNA (Fig. 2B) was significantly reduced in the HCT116 p53+/+ cells following transfection with the p53-specific siRNA compared with cells transfected with a negative control siRNA. p21 protein expression was simultaneously decreased following siRNA transfection (Fig. 2A). Knockdown of p53 by siRNA resulted in a significant decrease in CD133-positive cells, from 84.27% in the control-transfected cells to 5.94% in the p53-siRNA-transfected HCT116 p53+/+ cells (Fig. 2C). In addition, the CD133 mRNA levels were also decreased following p53 siRNA knockdown (Fig. 2D). These results suggested that p53 might transcriptionally regulate CD133 mRNA expression.

Figure 2. Effect of p53 silencing on CD133 expression in p53+/+ HCT116 cells. p53+/+ HCT116 cells were transfected with either a p53-specific siRNA or a negative control siRNA (NC). (A) Western blot analysis for p53 and p21 protein expression levels. (B) RT-qPCR analysis for p53 mRNA expression. *P<0.01. (C) Representative results of flow cytometric analysis for expression of the cancer stem cell marker CD113. siRNA-mediated p53 silencing resulted in a decreased % of CD113-positive cells in the p53+/+ HCT116 cell line. (D) RT-qPCR analysis for CD133 mRNA expression. siRNA-mediated p53 silencing resulted in decreased mRNA levels of CD133 in the p53+/+ HCT116 cell line. *P<0.01. si, small interfering; NC, negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Next, the Flag-cmv2-p53 plasmid was transiently transfected into HCT116 p53−/− cells in order to overexpress p53 in these cells, while the empty Flag-cmv2 vector was used as control. Western blot analysis demonstrated increased levels of p53 and p21 protein at 24 and 48 h following transfection (Fig. 3A). One-half of the same transfected sample was then used for flow cytometric detection of the CSC surface biomarker CD133. The % of CD133-positive cells increased from 4.19 to 5.13% at 24 h and to 7.25% at 48 h following p53 overexpression (Fig. 3B). Although the increase in overall % is relatively small, the change is statistically significant (Fig. 3C). In addition, the qPCR results indicated that CD133 mRNA levels were significantly increased in HCT116 p53−/− cells following p53 overexpression (Fig. 3D).

Figure 3. Effect of p53 overexpression on CD133 expression in p53−/− HCT116 cells. p53−/− HCT116 cells were transfected with either a p53-overexpressing plasmid (Flag-cmv2-p53) or the empty vector control (Flag-cmv2). (A) Western blot analysis for p53 and p21 protein expression levels. (B) Representative results of flow cytometric analysis for expression of the cancer stem cell marker CD113. (C) Quantitative analysis of the flow cytometry results for the % of CD113-positive cells in total. #P<0.05 and *P<0.01 compared with the control. (D) Reverse transcription-quantitative polymerase chain reaction analysis for CD133 mRNA expression. p53 overexpression resulted in increased CD133 mRNA levels in p53−/− HCT116 cells. *P<0.01 compared with the control.

Prediction of p53 response elements in the CD133 promoter

DNA binding is necessary for p53 transcription factor activity. p53 modulates the transcription of target genes mainly through its direct binding to a specific responsive element (RE), usually within the promoter region of its target genes. The consensus sequence of the p53 binding site is 5′-RRRCWWGYYY-3′, where R is a purine, Y is a pyrimidine, and W is either adenine (A) or (thymine) T (13). Fig. 4A displays the consensus p53 RE sequence Model logo MA0106 generated using the LogoMat-M software (http://www.sanger.ac.uk/science/tools/logomat-m) (14). The Multi-genome Analysis of Positions and Patterns of Elements of Regulation (MAPPER) Search Engine (15) was used to identify the putative p53 binding sites/REs in the promoter of the human CD133/PROM1 gene. Using the MAPPER Search Engine, the promoter sequence of the human CD133 gene from the National Center for Biotechnology Information (NCBI) GenBank genome database (NCBI reference sequence: NG_011696.1) was queried. Indeed, the sequence alignment revealed three potential p53 REs at −1222/-1213, −387/-368 and −285/-266 within the 1.5 kb region of the CD133 gene promoter (Fig. 4B).

Figure 4. Prediction of p53 REs in the CD133 promoter. (A) Model logo MA0106 of the consensus p53 RE sequence generated using the LogoMat-M software. (B) Positions and sequences of the predicted p53 REs within the CD133 promoter. The location of each p53 RE in the promoter is labeled relative to the transcription start site. (C) Schematic for the construct pGL3-pCD133 promoter-Luc reporter vector that was generated for the present study. The firefly luciferase gene expression is driven by the 1,313 bp CD133 promoter fragment containing the predicted p53 REs. RE, response element.

p53 transactivates the CD133 promoter

To investigate whether p53 transactivates the CD133 promoter, the sequence 1,313 bp upstream of the CD133 promoter, containing these three potential p53 REs, was cloned into a luciferase reporter plasmid (pGL3-pCD133), thereby producing a plasmid where the firefly luciferase gene expression is driven by the CD133 promoter (Fig. 4C). The cells were co-transfected with the firefly luciferase reporter pGL3-pCD133 plasmid, the pRL-CMV plasmid (which expresses Renilla luciferase as the internal control), and other plasmids as indicated. The empty pGL3-basic vector was transfected as a control. As presented in Fig. 5A and B, siRNA-mediated silencing of p53 resulted in a significant decrease in firefly luciferase activity in p53+/+ HCT116 cells. By contrast, overexpression of 53 by co-transfection of the p53-expressing vector pCMV2-p53 significantly increased the firefly luciferase activity in p53−/− HCT116 cells (Fig. 5C and D). These results suggest that p53 transactivates the CD133 promoter region containing the p53 REs. Similarly, in 293T cells, siRNA-mediated silencing of p53 significantly decreased luciferase activity, while overexpression of exogenous p53 significantly increased luciferase activity driven from the CD133 promoter, in a concentration-dependent manner (Fig. 5E and F). Therefore, the present results demonstrated that p53 may activate the CD133 promoter.

Figure 5. p53 transactivates the CD133 promoter. (A) Western blot analysis of p53 protein expression following p53-specific siRNA knockdown in p53+/+ HCT116 cells. (B) p53 knockdown suppressed the activity of the CD133 promoter in p53+/+ HCT116 cells, as measured by a dual-luciferase reporter assay. CD133 promoter activity was expressed as the ratio of firefly/Renilla luciferase activity. *P<0.01 compared with control. (C) Western blot analysis of p53 expression following transfection of p53−/− HCT116 cells with either a p53-overexpressing plasmid (Flag-cmv2-p53) or the empty vector control (Flag-cmv2). (D) p53 overexpression increased the activity of the CD133 promoter in p53+/+ HCT116 cells, as measured by a dual-luciferase reporter assay. CD133 promoter activity was expressed as the ratio of firefly/Renilla luciferase activity. *P<0.01 compared with control. (E and F) 293T cells were co-transfected with the indicated plasmids and (E) expression of p53 protein and (F) activity of the CD133 promoter were analyzed 24 post-transfection, as described earlier. #P<0.05 and *P<0.01, compared with control. si, small interfering; NC, negative control.

Discussion

The present study reported the role of p53 in transcriptionally activating the expression of the cancer stem cell marker CD133. A significant difference in the ratio of CD133-positive cell populations was demonstrated between the HCT116 p53+/+ and p53−/− cell lines. Silencing or overexpression of p53 decreased or restored CD133 expression, respectively. Informatics analysis predicted that a 1,313 bp fragment upstream of the CD133 transcriptional start site contained putative p53 binding REs and a dual-luciferase reporter assay demonstrated that p53 effectively activated transcription from the CD133 promoter region.

CD133 has been reported by several studies as a putative colon cancer stem cell marker (16,17). It has been demonstrated that CD133-positive cells are more resistant to radiation and conventional chemotherapy compared with CD133-negative cells (18). CD133-positive cells exhibit all the traits of stemness, including the ability to self-renew, differentiate and form tumors in immunodeficient mice (19). The expression of CD133 in different colorectal cancer cell lines varies. Chen et al (20) and Yang et al (21) also found that highly enriched CD133-positive cells existed in the HCT116 cell line and that these cells had characteristics of stem cells. Their findings are in accordance with the present results, in which a high population of CD133+/CD44+ cells were present in the HCT116 p53+/+ cell line, which is poorly differentiated (22). Multiple studies have reported that different transcription factors are involved in the regulation of CD133 expression, including Notch1, signal transducer and activator of transcription 3, and hypoxia inducible factor (23–30). DNA methylation and epigenetic factors are also involved in CD133 expression regulation (31). However, little is known about how CD133 is regulated in colon cancer.

Surprisingly, the present results demonstrated that CD133 expression was almost abolished in the HCT116 p53−/− cells. p53 is one of the central regulators involved in various biological activities, such as transcription, DNA damage response, metabolism and stem cell maintenance (32). Although several studies have indicated that p53 may be involved in the regulation of colon cancer stem cells (33,34), the precise mechanisms are relatively unclear. The present study demonstrated that wild-type p53 transactivated the promoter of the CD133 gene, indicating that the CD133 gene may be a novel target of p53 in colorectal cancer. Although it was previously reported that p53 transcriptionally suppressed CD133 expression (35), p53 may function with different transcription factors in the context of colorectal cancer to maintain the stem cell properties of HCT116 cells, which may be independent of the tumor suppressor role of p53 in other types of cancer. The specificity and robustness of CD133 as a colorectal CSC marker may also need further investigation (36,37). The combinatorial use of other markers, such as CD44 and ALDH1, in colorectal cancers may better clarify CSC features and how p53 may affect stem cell characteristics of colorectal cancer (38).

It is well-acknowledged that p53 transactivates its target genes through binding to a consensus RE (39–44). However, the mechanism by which p53 elicits cell-type specific responses is not fully understood. A previous study has examined the different binding modes of p53 between HCT116 and IMR90 cells (45). It will be interesting to identify other binding sites of p53 in addition to the 1,313 bp fragment upstream of the CD133 promoter. In the present findings, overexpression of p53 in HCT116 p53−/− cells increased the % of CD133-positive cells only moderately, suggesting that other epigenetic machinery may also be involved in the transactivation of CD133 expression by p53 (31,46).

In summary, the present study identified CD133 as a target gene of p53 in colorectal cancer cells. The clinical significance of CD133 in other types of cancer cells is already well established (47–52). Large-scale detection of CD133 expression in clinical colorectal cancer specimens may further evaluate the prognostic value of CD133. The identification of positive regulation of CD133 by p53 may provide new clues for the study of CSC in specific colorectal cancer subtypes.

Acknowledgements

This study was supported by the National Key Basic Research Program (973 Program) of MOST, China (grant no. 2015CB910601), and the National Natural Science Foundation of China (grant no. U1432248).

References