Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells

  • Authors:
    • Wenjing Jian
    • Xiaoli Zhang
    • Jiguo Wang
    • Yunlong Liu
    • Chuting Hu
    • Xianming Wang
    • Renbin Liu
  • View Affiliations / Copyright

    Affiliations: Department of Thyroid and Breast Surgery, The Third Affiliated Hospital, Sun Yat‑Sen University, Guangzhou, Guangdong 510630, P.R. China, Central Laboratory, The Second People's Hospital of Shenzhen, Shenzhen, Guangdong 518035, P.R. China, Department of Medical Oncology, Baoan District Traditional Chinese Medicine Hospital, Shenzhen, Guangdong 518133, P.R. China, Department of Thyroid and Breast Surgery, The Second People's Hospital of Shenzhen, Shenzhen, Guangdong 518035, P.R. China
  • Pages: 3207-3214
    |
    Published online on: June 21, 2018
       https://doi.org/10.3892/ol.2018.9009
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Previous studies have reported that scinderin (SCIN) affects multiple cellular processes, including proliferation, migration and differentiation in cancer. However, the specific role of SCIN in breast cancer (BC) cells is unknown. Immunohistochemistry was used to investigate SCIN expression in 46 BC and 21 mammary fibroadenoma or fibroadenomatoid hyperplasia tissue samples. SCIN expression was ablated in MDA‑MB‑231 and T‑47D cells using lentivirus‑mediated small interfering RNA technology. Cell proliferation was tested using Celigo and 3‑(4,5‑dimethylthiazol‑2‑yl)‑2,5‑diphenyltetrazolium bromide assays. Cell apoptosis was analyzed by measuring Caspase 3/7 activity and annexin‑V staining. The results of the present study demonstrated that SCIN expression was elevated in BC tissues compared with mammary fibroadenoma or fibroadenomatoid hyperplasia tissues. Specifically, higher SCIN expression was observed in Ki‑67‑positive BC tissues (78.6%) compared with Ki‑67‑negative BC tissues. Furthermore, knockdown of SCIN expression in the BC cell lines significantly suppressed cell proliferation and induced apoptosis. The data presented in the present study indicate that SCIN serves an important role in the development of breast cancer.

Introduction

Breast cancer (BC) is one of the most common malignancies in women worldwide (1) and accounts for 25% (1.7 million) of all cancer cases and 15% (521,900) of all cancer-related mortalities among females, based on data through 2012 (2). The percentage of cancer-related mortalities among females in less developed countries is even higher, for example, female breast cancer mortality in Belize was 14.0%, while 29.7% in the Cayman Islands in 2013 (3). Despite recent advancements in BC diagnoses and treatments, prognosis outcomes remain unsatisfactory due to the highly complex and heterogeneous nature of this disease (2). Thus, identification of novel therapeutic targets is required to develop additional effective treatment strategies.

Scinderin (SCIN), which is also referred to as adseverin, belongs to the gelsolin super family of actin binding proteins (4,5). SCIN was originally identified in chromaffin cells of the adrenal medulla (6), but is typically expressed in a variety of tissues. For instance, high expression of SCIN was observed in the kidneys and intestines (7), but was expressed at lower levels in other tissue types (6,8). Earlier studies indicated that SCIN serves an important role in the regulation of various cellular processes, including proliferation, migration and differentiation. In human prostate cancer and lung carcinoma cells, SCIN suppression inhibited cell proliferation (9,10). Conversely, in megakaryoblastic leukemia, SCIN overexpression inhibited cell proliferation and tumorigenesis via activating the ras-related C3 botulinum toxin substrate/p21-activated kinase/mammalian mitogen-activated protein kinase kinase, mitogen-activated protein kinase kinase 4/c-jun n-terminal kinase/c-jun, and rapidly accelerated fibrosarcoma kinase/mitogen-activated protein kinase kinase/extracellular signal-regulated kinase signaling pathways (11). In addition, manipulation of SCIN in gastric cancer cells has been linked to increased cell invasion and metastasis in vivo (12), and has also been revealed to be involved in the differentiation of dental pulp cells (13). However, the role of SCIN in BC is largely unknown.

Thus, in the present study, the biological role of SCIN in BC was investigated by analyzing its expression in BC tissue samples, as well as in control mammary fibroadenoma or fibroadenomatoid hyperplasia tissue samples. In addition, SCIN expression was ablated in MDA-MB-231 and T-47D BC cells using lentivirus (LV)-mediated short hairpin (sh)RNA technology to understand the functional consequences of knocking down SCIN expression. The results of the present study indicate that SCIN expression serves an important role in inhibiting proliferation and promoting apoptosis in BC cells.

Materials and methods

Selection of tumor specimens

This study was approved by the Ethics Committee of the Second People's Hospital of Shenzhen (Shenzhen, Guangdong, China), and written consent was obtained from all study participants. A total of 46 paraffin-embedded BC specimens, with a median age of 47.54 years (range, 28–64 years) and 21 paraffin-embedded control specimens, with a median age of 29.95 years (range, 17–45 years) collected from patients with mammary fibroadenoma or fibroadenomatoid hyperplasia were obtained from the Center for Breast Disease Diagnosis and Treatment at the Second People's Hospital of Shenzhen between January 2017 and June 2017. All patients were women. Among the 46 cases, 36 were invasive ductal carcinoma (IDC), 6 were ductal carcinoma in situ (DCIS) and 4 were mucoid carcinoma. All diagnoses and classifications were made according to the World Health Organization criteria (14). These resected specimens were 2–3 mm thick, then fixed in 10% neutral buffered formalin (pH 7.4) at room temperature for 12 h, embedded in paraffin, and cut into 4-µm sections.

Cell culture

Human BC MDA-MB-231, T-47D and MCF-7 cell lines were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). These cells were cultured in Dulbecco's modified Eagle medium (DMEM; Corning Incorporated, Corning, NY, USA) supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere with 5% CO2.

Immunohistochemistry (IHC)

Selected paraffin-embedded specimens were cut into 4-µm sections and stained using the Dako REAL Envision Detection system (Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) per the manufacturer's protocols. 4-µm sections were dewaxed by xylene and rehydrated in a graded ethanol series (100% ethanol for 5 min, 95% alcohol for 5 min, 90% alcohol for 3 min, 80% alcohol for 3 min, 70% alcohol for 3 min at room temperature), following washing 3 times with Phosphate Buffer Solution (PBS) for 10 min at room temperature. Sections were boiled in 0.01 mol/l citrate buffer (pH 6.0, MVS-0066, Maixin Biotechnology Development Co., Ltd, Fuzhou, China) at 100°C for 4 min, then cooled at room temperature for 1 h for antigen retrieval. The endogenous peroxidase activity was blocked with 3% H2O2 for 10 min at room temperature, followed by washing 3 times with PBS for 10 min at room temperature. Next, slides were immersed in 5% goat serum (YJ0130, Yanjing Biological Co., Shanghai, China) for 10 min at room temperature to block nonspecific binding. Following removal of goat serum, the slides were incubated with primary rabbit anti-SCIN monoclonal antibody (1:800 dilution; cat. no. ab199723, Abcam, Cambridge, MA, USA) and mouse anti-Ki67 monoclonal antibody (1:100 dilution; cat. no. MAB-0129, MXB Bio-company, Fuzhou, China) at 4°C overnight. The next day, the slides were re-heated at room temperature for 1 h. Then washed 3 times with PBS for 10 min in room temperature, the sections were then incubated with poly-horseradish peroxidase (HRP) anti-rabbit/mouse IgG (cat. no PV-9000, Beijing ZSGB-Bio Company, Beijing, China) for 30 min at room temperature. DAB staining was performed and later semi-quantitative evaluation of the immunohistochemical signal was performed by two pathologists working independently in a blinded fashion with an Olympus BX-51 microscope (Olympus Corporation, Tokyo, Japan) at ×200 magnification (15). The staining intensity of SCIN expression was scored as follows: 0, Negative (no cytoplasmic SCIN expression); 1, weak (1–25% staining); 2, moderate (26–50% staining); 3, strong (51–75% staining); and 4, high (76–100%) staining. The staining scores were analyzed using the X-tile software program (v3.6.1; Yale University School of Medicine, New Haven, CT, USA), and a score of 2 was designated as the cutoff value (16). Thus, samples having total scores of ≥2 were classified as having high SCIN expression, while scores of <2 represented no or low SCIN expression. Samples that exhibited <14% Ki-67 (proliferation marker) expression were grouped as Ki-67 negative (17).

SCIN expression in breast cancer cells from GEO

The information about SCIN expression in BC cells was extracted from GEO (https://www.ncbi.nlm.nih.gov/geo/). The term ‘breast cancer cells’ was entered and searched in the GEO datasets, and eligible and high quality profiling expression data was identified, ‘SCIN’ gene was then searched in the GDS4296 datasets and for the expression of SCIN in BC cells.

Generation of LV expressing SCIN, shRNA and target cell transfection

Several shRNAs were designed and tested to target the human SCIN gene in preliminary studies (NM_033128). The shRNA sequence (5′-CGAGATGAGCTGACAACAT-3′) that optimally ablated SCIN expression was selected for the present study. A random shRNA sequence (5′-TTCTCCGAACGTGTCACGT-3′) was used as a control. These shRNAs were subsequently ligated into the GV115 lentiviral vector with enhanced green fluorescent protein (GFP) cDNA (GeneChem). To generate LV, MDA-MB-231 and T-47D cells were transfected with GV115-SCIN or control shRNA using X-tremeGENE HP DNA Transfection Reagent (cat no. 6366546001, Roche Diagnostics, Basel, Switzerland), along with two helper plasmids, pHelper 1.0 and pHelper 2.0 (GeneChem), per the manufacturer's protocols. At 2 days post-transfection, the supernatant containing packaged LV was collected and filtered through a 0.45-µm filter. To infect MDA-MB-231 and T-47D cells, LV particles, at a multiplicity of transfection of 20, were added to the plated cells in 6-well plates and then cultured at 37°C in an incubator. A transfection efficiency of ~80% was observed via GFP expression using fluorescence microscopy following 3 days of LV transfection. Subsequent experimentations were performed 72 h following transfection.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from BC MDA-MB-231, T-47D and MCF-7 cell lines respectively using TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The cDNA was retro-transcribed from isolated RNA using the M-MLV kit (cat no. M1705, Promega Corporation, Madison, WI, USA). The RT-qPCR reaction conditions were at 95°C for 15 sec, at 95°C for 5 sec, then at 60°C for 30 sec, and the amplification was for 45 cycles using the Real-Time PCR Detection system (cat no. MX3000p; Agilent Technologies, Inc.) with SYBR Premix Ex Taq (cat no. DRR041B, Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocols. The primer sequences for SCIN gene amplification were as follows: Forward, AGGAAGGTCTGAACTAAT and reverse, CTGTTACTTATGTCTGCTAT. The primer sequences for GAPDH amplification were as follows: Forward, TGACTTCAACAGCGACACCCA and reverse, CACCCTGTTGCTGTAGCCAAA. The relative mRNA expression levels were determined by the cycle threshold (Ct) normalized to GAPDH expression, using the 2−ΔΔCq formula (18).

Western blot analysis

The knockdown efficiency of SCIN shRNA in BC cells transfected with GV115-SCIN shRNA or control shRNA LV was determined. At 2 days post-LV transfection, the cells were collected and lysed in radioimmunoprecipitation lysis buffer (BioTeke Corporation, Beijing, China). Protein concentration was measured using the BCA Protein assay kit (Beyotime Institute of Biotechnology, Haimen, China), and 20 µg protein lysates in each pane were separated by 10% SDS-PAGE, followed by transfer to polyvinylidene difluoride (PVDF) membranes (EMD Millipore, Billerica, MA, USA). Subsequently, the PVDF membranes were blocked in 5% skimmed milk diluted with TBST (cat no. BD232100, Solarbio Co, Beijing, China) for 1 h at room temperature. The membranes were then incubated with primary rabbit anti-SCIN monoclonal antibody (mAb) (80 kDa, 1:200; cat no. HPA020518, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and GAPDH mouse mAb (37 kDa, 1:1,000; cat no. SC-32233, Santa Cruz Biotechnology, Dallas TX) at 4°C overnight. Thereafter, the membranes were incubated with secondary goat anti-rabbit IgG (1:2,000; cat. no. sc-2004, Santa Cruz Biotechnology, Inc.) and goat anti-mouse IgG (1:2,000; cat. no. sc-2005, Santa Cruz Biotechnology, Inc.) antibodies for 1.5 h at room temperature, respectively. The protein bands were visualized using the Pierce™ ECL Western Blotting Substrate kit (Thermo Fisher Scientific, Inc.).

Cell Celigo analysis

LV infected MDA-MB-231 and T-47D cells were seeded into 96-well plates at a concentration of 2,000 cells/well in incubator with 4°C and 5% CO2 for 3 days. The cell nuclei were stained with Hoechst (2.6 µg/ml; Invitrogen; Thermo Fisher Scientific, Inc.) for 5 min at room temperature to quantify absolute cell number; green fluorescence-tagged shRNA was measured by a fluorescence microscope at x100 magnification to quantify cellular siRNA uptake. All analyses were performed using a Celigo cytometer (Nexcelom Bioscience, Lawrence, MA, USA) over a period of 5 days. Gross quantitative analysis for each fluorescence channel was performed, including total counts of gated events.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

BC cells were seeded into a 96-well plate (2,000 cells/well) 3 days after LV transfection. The MTT assay was performed per the manufacturer's protocols (cat no. JT343; Gen-view, Beijing, China). Briefly, at the indicated time points (1, 2, 3, 4 and 5 days), the MTT solution (5 mg/ml) was added to the wells and the cells were further incubated at 37°C for 4 h. The formazan dye was dissolved with 100 µl dimethyl sulfoxide at 37°C for 2–5 min. The optical density of the dye was measured using a microplate reader at 490 nm absorbance and 570 nm as the wavelength reference.

Caspase-3/7 activity assay

Caspase-3/7 activity was determined using the Caspase-Glo 3 and 7 kit (cat no. G8091, Promega Corporation), according to the manufacturer's protocols, following plating of transfected cells in 96-well plates (in triplicate) for 72 h.

Cell apoptosis

Cell apoptosis was analyzed using the allophycocyanin (APC)/annexin V kit (cat no. 88-8007, eBioscience; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. After 5 days of transfection, the cells were stained for 10–15 min in 100 µl cell suspension buffer, containing 5 µl annexin V-APC stain, at room temperature in the dark. Cell apoptosis was analyzed by flow cytometry (EMD Millipore).

Statistical analysis

All statistical analyses were performed using SPSS 20.0 (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference. Association between SCIN expression and clinicopathological features of patients with BC, as well as RT-qPCR experiments, were evaluated using the χ2 test. All other data sets were evaluated using Student's t-test and expressed as the mean ± standard error of the mean.

Results

SCIN expression is increased in breast cancer tissues

The IHC results revealed that SCIN protein expression was elevated in BC tissue samples compared with that in control mammary fibroadenoma or fibroadenomatoid hyperplasia tissue samples (Fig. 1). SCIN expression in the cytoplasm of BC ductal epithelial hyperplasia cells was primarily detected with varying intensity (Fig. 1A-D). However, very weak or no SCIN expression was observed in mammary fibroadenoma or fibroadenomatoid hyperplasia tissue samples (Fig. 1E and F). Quantification of SCIN expression in the BC tissue samples demonstrated that 60.9% of the BC tissue samples (28/46) revealed high SCIN expression compared with 28.6% of the mammary fibroadenoma or fibroadenomatoid hyperplasia tissue samples (6/21) (P=0.014) (Table I; Fig. 1).

Figure 1.

Immunohistochemistry analysis of SCIN expression in fibroadenoma and BC tissue samples. Representative images of (A) negative, (B) weak, (C) moderate and (D) strong SCIN staining in BC tissue, (E) negative and (F) and weak SCIN staining in fibroadenoma (original magnification, ×200). SCIN, scinderin; BC, breast cancer.

Table I.

Comparison of SCIN expression in breast fibroadenoma and breast cancer tissues.

Table I.

Comparison of SCIN expression in breast fibroadenoma and breast cancer tissues.

SCIN expression

Type of tissuenNone/low, n (%)High, n (%)χ2P-value
Fibroadenoma of the breast2115 (71.4)6 (28.6)6.0170.014
Breast cancer4618 (39.1)28 (60.9)

[i] SCIN, scinderin.

Further analysis of the association between SCIN expression and clinicopathological features demonstrated no significant differences between high and low expression of SCIN. The proportion of high SCIN-expressing Ki-67-positive BC tissue samples (78.6%, 22/28) was higher compared with the Ki-67-negative BC tissue samples (21.4%, 6/28); however, this difference was not statistically significant (Table II). This observation may indicate that SCIN expression in BC tissue is associated with Ki-67 expression, suggesting that changes in SCIN expression could affect BC cell proliferation.

Table II.

Association between SCIN expression and clinicopathological features in patients with breast cancer.

Table II.

Association between SCIN expression and clinicopathological features in patients with breast cancer.

SCIN expression

Pathological variablesnNone/low, n (%)High, n (%)χ2P-value
Pathological type 0.6340.728
  IDC3613 (36.1)23 (63.9)
  DCIS63 (50.0)3 (50.0)
  Mucoid carcinoma42 (50.0)2 (50.0)
ER 0.4170.518
  Negative186 (33.3)12 (66.7)
  Positive2812 (42.9)16 (57.1)
PR 0.2250.635
  Negative259 (36.0)16 (64.0)
  Positive219 (42.9)12 (57.1)
HER2 0.0040.949
  Negative3614 (38.9)22 (61.1)
  Positive104 (40.0)6 (60.0)
Ki-67 0.0040.949
  Negative104 (40.0)6 (60.0)
  Positive3614 (38.9)22 (61.1)
Stage 0.480.488
  ≤II3814 (36.8)24 (63.2)
  ≥III84 (50.0)4 (50.0)
Molecular characteristics 4.0360.258
  Luminal A75 (71.4)2 (28.6)
  Luminal B217 (33.3)14 (66.7)
  HER2 overexpression104 (40.0)6 (60.0)
  Triple-negative82 (25.0)6 (75.0)

[i] Ki-67 expression: ≤14%, Ki-67 negative staining; and ≥15%, Ki-67 positive staining. IDC, invasive ductal carcinoma; DCIS, ductal carcinoma in situ; SCIN, scinderin; HER2, human epidermal growth factor receptor 2; ER, estrogen receptor; PR, progesterone receptor.

SCIN is expressed in breast cancer cells

To investigate the functional contribution of SCIN in BC, the Gene Expression Omnibus database was initially utilized (GDS4296, Affymetrix Human Genome U133 Plus 2.0 Array; Affmetrix; Thermo Fisher Scientific, Inc. http://www.ncbi.nlm.nih.gov/geo/tools/profileGraph.cgi?ID=GDS4296%3A222272_x_at&sortby=tissue) to determine SCIN levels in BC samples (19). Using this database, SCIN was revealed to be expressed in multiple BC cell lines, including BT-549, HS578T, MCF-7, MDA-MB-231 and T-47D. As presented in Fig. 2A, SCIN expression was higher in MCF-7 and T-47D cells. SCIN expression in BC cells was further validated using RT-qPCR (Fig. 2B). The MDA-MB-231 cell line is a highly invasive and metastatic, while T-47D and MCF-7 cell lines exhibit comparatively mild invasive and metastatic capabilities. Therefore, MDA-MB-231 and T-47D cells were selected to examine the effect of SCIN on different BC cells.

Figure 2.

Assessment of SCIN expression using the GEO database and RT-qPCR. (A) Bioinformatics analysis of SCIN expression in five BC cell lines from the GEO database. (B) RT-qPCR analysis of SCIN expression in three BC cell lines; MDA-MB-231, T-47D and MCF-7. GAPDH expression was used as a control to normalize SCIN expression. SCIN, scinderin; BC, breast cancer; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; GEO, Gene Expression Omnibus. **P<0.05, *P>0.05.

Suppressed SCIN expression inhibits breast cancer cell proliferation

In order to investigate the molecular function of SCIN in BC cells, SCIN expression was ablated using LV-mediated knockdown. Following 3 days of LV transfection, infection efficiency and good cell morphology were observed by fluorescent microscope with ×200 magnification (Fig. 3A and B). Then RT-qPCR analysis revealed that SCIN mRNA expression was significantly lower in MDA-MB-231 and T-47D cells in the shSCIN group compared with that in the shCtrl group (Fig. 3C and D). Similarly, a reduction in SCIN protein expression was confirmed in BC cells that were transfected with shSCIN (Fig. 3E and F).

Figure 3.

Knockdown of SCIN expression by lentivirus-mediated shRNA and its effect on cell proliferation. Representative images of SCIN-knockdown in (A) MDA-MB-231 and (B) T-47D cells, assessed by GFP expression using fluorescence microscopy (×200 magnification). SCIN RNA expression following knockdown in (C) MDA-MB-231 and (D) T-47D cells, assessed by reverse transcription-quantitative polymerase chain reaction analysis. GAPDH expression was used as an internal control. Data are presented as mean values ± standard error of the mean of three independent experiments. **P<0.01 compared with the shCtrl group. Western blot analysis of SCIN-knockdown in (E) MDA-MB-231 and (F) T-47D cells. Representative blots of three separate experiments. (G) Representative images of Celigo assay (×100 magnification), (H) cumulative data of Celigo assay, and (I) bar graphs indicate the mean cell count values in MDA-MB-231 cells transfected with shCtrl or shSCIN were illustrated. (J) Representative images of Celigo assay (×100 magnification), (K) cumulative data of Celigo assay, and (L) bar graphs indicate the mean cell count values in T-47D cells transfected with shCtrl or shSCIN were presented. Cellular metabolic activity, assessed with MTT assay, of (M) MDA-MB-231 and (O) T-47D cells. Bar graphs indicate the mean cellular metabolic activity values in the MDA-MB-231 (N) and T-47D cells (P). All data represented are mean values ± standard error of the mean from four independent experiments. Student's t-test was used for statistical analysis. **P<0.01. *P>0.05 vs. control, SCIN, scinderin; BC, breast cancer; shCtrl, short hairpin control; GFP, green fluorescent protein; OD, optical density.

Next, proliferation was assessed in MDA-MB-231 and T-47D cells using the in vitro Celigo assay 3 days after shSCIN or shCtrl transfection. A marked reduction in proliferation of MDA-MB-231 and T-47D cells was identified (Fig. 3G-L). A separate experiment using the MTT assay confirmed that cellular metabolic activity was decreased in the MDA-MB-231 when silencing SCIN expression (Fig. 3M and N). The lower cellular metabolic activity was also examined in the T-47D cells with knockdown of SCIN expression (Fig. 3O and P). Thus, these results indicate that SCIN-knockdown inhibits BC cell proliferation and cellular metabolic activity.

SCIN-knockdown induces cell apoptosis

To further investigate the mechanism by which SCIN-knockdown reduces cell proliferation, Caspase-3/7 activity in MDA-MB-231 and T-47D cells was analyzed following 72 h of LV transfection of shSCIN and shCtrl. SCIN-knockdown significantly enhanced Caspase-3/7 activity in the two cell types (P<0.01; Fig. 4A and B). Flow cytometric analysis of cell apoptosis was also performed. As presented in Fig. 4C-F, apoptosis was significantly increased in the MDA-MB-231 and T-47D cells in the shSCIN group (P<0.01) following 5 days of LV transfection.

Figure 4.

Effects of SCIN-knockdown on cell apoptosis. Caspase 3/7 activity in (A) MDA-MB-231 and (B) T-47D cells 3 days following shRNA transfection. (C) Cumulative data of annexin-V staining analyzed by flow cytometry in MDA-MB-231 cells transfected with shCtrl or shSCIN and (D) its representative histograms were presented. (E) Cumulative data of annexin-V staining analyzed by flow cytometry in T-47D cells transfected with shCtrl or shSCIN and (F) its representative histograms were presented. All data are presented as mean values ± standard error of the mean from four independent experiments. Student's t-test was used for statistical analysis. **P<0.01. shCtrl, short hairpin control; SCIN, scinderin.

Discussion

The majority of cases of BC-associated mortality occur due to metastasis, for which cell proliferation is the biggest contributor. Cell proliferation is directly and indirectly associated with BC prognosis (20). Multiple studies evaluating the role of numerous proliferation genes have added to the current understanding of BC metastasis (21–23), but the functional contribution of SCIN expression in BC proliferation has been relatively under-reported. Thus, in the present study, the role of SCIN in BC proliferation and apoptosis was investigated. The results demonstrated that SCIN expression is increased in BC cells at the protein (IHC) and mRNA (RT-qPCR) levels. Furthermore, knockdown of SCIN expression in MDA-MB-231 and T-47D cells, with LV-mediated gene silencing technology, suggested that SCIN expression regulates cell proliferation and apoptosis. Inhibition of proliferation and induction of apoptosis were observed in MDA-MB-231 and T-47D cells following SCIN-knockdown.

Uncontrolled cell proliferation is a central hallmark of all types of cancer. Since the actin cytoskeleton serves a prominent role in cancer cell cycle regulation (24), a number of cytoskeleton-associated proteins have been studied in reference to BC (25–27). SCIN contains six gelsolin-like domains, three actin-binding sites and two calcium-binding sites (6,28). Previous studies have linked abnormal SCIN expression to various carcinomas, as well as to cell proliferation. In the present study, SCIN expression was revealed to be associated with Ki-67-positive BC cells in tissue samples. Although not significant, this trend does indicate that there may be an association between SCIN and Ki-67 expression in BC tissues. Since Ki-67 is a cellular marker of proliferation, the results of the current study indicate that SCIN may also be involved in the proliferation of BC cells. Consistent with this conclusion, SCIN-knockdown was revealed to inhibit breast carcinoma cell proliferation in vitro in the present study. This observation was in accordance with studies by Liu et al (10) and Wang et al (9), who revealed that SCIN overexpression enhanced human lung and prostate carcinoma cell proliferation. Therefore, as SCIN governs filamentous actin (F-actin) cytoskeleton remodeling, it is possible that SCIN's effects on cell proliferation may be mediated through F-actin. This hypothesis requires further analysis, for example, observing whether the F-actin cytoskeleton is changed when SCIN expression is silenced in BC cells. Further, animal experiments should be performed to validate the proliferative ability of SCIN.

Apoptosis can significantly contribute to normal cell physiology. Apoptosis maintains absolute cell numbers, affects wound healing and regulates remodeling (29). Abnormalities in apoptosis lead to numerous diseases, including cancer, in which the normal mechanisms of cell cycle regulation become dysfunctional (30). Inducing apoptosis during carcinogenesis can contribute to the treatment and prevention of cancer development and progression (31,32). In the current study, SCIN-knockdown induced cell apoptosis. Therefore SCIN may serve an important role in the development and progression of BC.

In summary, the results of the current study demonstrated that shRNA-mediated SCIN-knockdown inhibited breast cancer cell proliferation and induced apoptosis. This sheds new light on the novel role of SCIN in BC development and progression.

Acknowledgements

Not applicable

Funding

This study was funded by the following grants: The Science, Technology and Innovation Committee of Shenzhen Municipality (grant no. JCYJ20160425103015129) and the Science, Technology and Innovation Committee of Shenzhen Municipality (grant no. JSGG20160226202029158).

Availability of data and materials

All data used during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WJ designed the study and wrote the manuscript. XZ, JW and YL performed the experiments. CH analyzed data. XW and RL also contributed to study design, data analysis and modified the manuscript.

Ethics approval and consent to participate

This study was approved by the Ethics Committee of The Second People's Hospital of Shenzhen, and written consent was obtained from all study participants.

Patient consent for publication

Patients provided written consent for the publication of data and any associated images.

Competing interests

The authors declare that they have no competing interests.

References

1 

Harbeck N and Gnant M: Breast cancer. Lancet. 389:1134–1150. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Razzaghi H, Quesnel-Crooks S, Sherman R, Joseph R, Kohler B, Andall-Brereton G, Ivey MA, Edwards BK, Mery L, Gawryszewski V and Saraiya M: Leading causes of cancer mortality-Caribbean Region, 2003–2013. Morb Mortal Wkly Rep. 65:1395–1400. 2016. View Article : Google Scholar

4 

Lejen T, Pene TD, Rosé SD and Trifaró JM: The role of different Scinderin domains in the control of F-actin cytoskeleton during exocytosis. Ann N Y Acad Sci. 971:248–250. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Chen XM, Guo JM, Chen P, Mao LG, Feng WY, Le DH and Li KQ: Suppression of scinderin modulates epithelialmesenchymal transition markers in highly metastatic gastric cancer cell line SGC7901. Mol Med Rep. 10:2327–2333. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Del Castillo Rodriguez A, Lemaire S, Tchakarov L, Jeyapragasan M, Doucet JP, Vitale ML and Trifaró JM: Chromaffin cell scinderin, a novel calcium-dependent actin filament-severing protein. EMBO J. 9:43–52. 1990.PubMed/NCBI

7 

Lueck A, Brown D and Kwiatkowski DJ: The actin-binding proteins adseverin and gelsolin are both highly expressed but differentially localized in kidney and intestine. J Cell Sci. 111:3633–3643. 1998.PubMed/NCBI

8 

Tchakarov L, Vitale ML, Jeyapragasan M, Del Castillo Rodriguez A and Trifaró JM: Expression of scinderin, an actin filament-severing protein, in different tissues. FEBS Lett. 268:209–212. 1990. View Article : Google Scholar : PubMed/NCBI

9 

Wang D, Sun SQ, Yu YH, Wu WZ, Yang SL and Tan JM: Suppression of SCIN inhibits human prostate cancer cell proliferation and induces G0/G1 phase arrest. Int J Oncol. 44:161–166. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Liu H, Shi D, Liu T, Yu Z and Zhou C: Lentivirus-mediated silencing of SCIN inhibits proliferation of human lung carcinoma cells. Gene. 554:32–39. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Zunino R, Li Q, Rosé SD, Romero-Benítez MM, Lejen T, Brandan NC and Trifaró JM: Expression of scinderin in megakaryoblastic leukemia cells induces differentiation, maturation, and apoptosis with release of plateletlike particles and inhibits proliferation and tumorigenesis. Blood. 98:2210–2219. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Liu JJ, Liu JY, Chen J, Wu YX, Yan P, Ji CD, Wang YX, Xiang DF, Zhang X, Zhang P, et al: Scinderin promotes the invasion and metastasis of gastric cancer cells and predicts the outcome of patients. Cancer Lett. 376:110–117. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Coratti A, Fernandes E, Lombardi A, Di Marino M, Annecchiarico M, Felicioni L and Giulianotti PC: Robot-assisted surgery for gastric carcinoma: Five years follow-up and beyond: A single western center experience and long-term oncological outcomes. Eur J Surg Oncol. 41:1106–1113. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Lin H, Huang JF, Qiu JR, Zhang HL, Tang XJ, Li H, Wang CJ, Wang ZC, Feng ZQ and Zhu J: Significantly upregulated TACSTD2 and Cyclin D1 correlate with poor prognosis of invasive ductal breast cancer. Exp Mol Pathol. 94:73–78. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Shi H, Chen S, Jin H, Xu C, Dong G, Zhao Q, Wang W, Zhang H, Lin W, Zhang J, et al: Downregulation of MSP58 inhibits growth of human colorectal cancer cells via regulation of the cyclin D1-cyclin-dependent kinase 4-p21 pathway. Cancer Sci. 100:1585–1590. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Camp RL, Dolled-Filhart M and Rimm DL: X-tile: A new bio-informatics tool for biomarker assessment and outcome-based cut-point optimization. Clin Cancer Res. 10:7252–7259. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Cheang MC, Chia SK, Voduc D, Gao D, Leung S, Snider J, Watson M, Davies S, Bernard PS, Parker JS, et al: Ki67 index, HER2 status, and prognosis of patients with luminal B breast cancer. J Natl Cancer Inst. 101:736–750. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta (CT)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Shankavaram UT, Reinhold WC, Nishizuka S, Major S, Morita D, Chary KK, Reimers MA, Scherf U, Kahn A, Dolginow D, et al: Transcript and protein expression profiles of the NCI-60 cancer cell panel: An integromic microarray study. Mol Cancer Ther. 6:820–832. 2007. View Article : Google Scholar : PubMed/NCBI

20 

van Diest PJ, van der Wall E and Baak JP: Prognostic value of proliferation in invasive breast cancer: A review. J Clin Pathol. 57:675–681. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Kim K, Son MY, Jung CR, Kim DS and Cho HS: EHMT2 is a metastasis regulator in breast cancer. Biochem Biophys Res Commun. 496:758–762. 2018. View Article : Google Scholar : PubMed/NCBI

22 

Song L, Liu D, Zhao Y, He J, Kang H, Dai Z, Wang X, Zhang S, Zan Y and Xue X: Sinomenine reduces growth and metastasis of breast cancer cells and improves the survival of tumor-bearing mice through suppressing the SHh pathway. Biomed Pharmacother. 98:687–693. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Gao Y, Li F, Zhou H, Yang Y, Wu R, Chen Y, Li W, Li Y, Xu X, Ke C and Pei Z: Down-regulation of MRPS23 inhibits rat breast cancer proliferation and metastasis. Oncotarget. 8:71772–71781. 2017.PubMed/NCBI

24 

Hall A: The cytoskeleton and cancer. Cancer Metastasis Rev. 28:5–14. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Kas SM, de Ruiter JR, Schipper K, Annunziato S, Schut E, Klarenbeek S, Drenth AP, van der Burg E, Klijn C, Ten Hoeve JJ, et al: Insertional mutagenesis identifies drivers of a novel oncogenic pathway in invasive lobular breast carcinoma. Nat Genet. 49:1219–1230. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Mercado-Matos J, Clark JL, Piper AJ, Janusis J and Shaw LM: Differential involvement of the microtubule cytoskeleton in insulin receptor substrate 1 (IRS-1) and IRS-2 signaling to AKT determines the response to microtubule disruption in breast carcinoma cells. J Biol Chem. 292:7806–7816. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Kumar N, Hati S, Munshi P, Sen S, Sehrawat S and Singh S: A novel spiroindoline targets cell cycle and migration via modulation of microtubule cytoskeleton. Mol Cell Biochem. 429:11–21. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Chumnarnsilpa S, Lee WL, Nag S, Kannan B, Larsson M, Burtnick LD and Robinson RC: The crystal structure of the C-terminus of adseverin reveals the actin-binding interface. Proc Natl Acad Sci USA. 106:13719–13724. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Elmore S: Apoptosis: A review of programmed cell death. Toxicol Pathol. 35:495–516. 2007. View Article : Google Scholar : PubMed/NCBI

30 

King KL and Cidlowski JA: Cell cycle regulation and apoptosis. Annu Rev Physiol. 60:601–617. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Jordan VC: The new biology of estrogen-induced apoptosis applied to treat and prevent breast cancer. Endocr Relat Cancer. 22:R1–R31. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Carew JS, Espitia CM, Zhao W, Kelly KR, Coffey M, Freeman JW and Nawrocki ST: Reolysin is a novel reovirus-based agent that induces endoplasmic reticular stress-mediated apoptosis in pancreatic cancer. Cell Death Dis. 4:e7282013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jian W, Zhang X, Wang J, Liu Y, Hu C, Wang X and Liu R: Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells. Oncol Lett 16: 3207-3214, 2018.
APA
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., & Liu, R. (2018). Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells. Oncology Letters, 16, 3207-3214. https://doi.org/10.3892/ol.2018.9009
MLA
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., Liu, R."Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells". Oncology Letters 16.3 (2018): 3207-3214.
Chicago
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., Liu, R."Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells". Oncology Letters 16, no. 3 (2018): 3207-3214. https://doi.org/10.3892/ol.2018.9009
Copy and paste a formatted citation
x
Spandidos Publications style
Jian W, Zhang X, Wang J, Liu Y, Hu C, Wang X and Liu R: Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells. Oncol Lett 16: 3207-3214, 2018.
APA
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., & Liu, R. (2018). Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells. Oncology Letters, 16, 3207-3214. https://doi.org/10.3892/ol.2018.9009
MLA
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., Liu, R."Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells". Oncology Letters 16.3 (2018): 3207-3214.
Chicago
Jian, W., Zhang, X., Wang, J., Liu, Y., Hu, C., Wang, X., Liu, R."Scinderin‑knockdown inhibits proliferation and promotes apoptosis in human breast carcinoma cells". Oncology Letters 16, no. 3 (2018): 3207-3214. https://doi.org/10.3892/ol.2018.9009
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team