Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer

  • Authors:
    • Wen‑Jing Yue
    • Yi‑Pin Liu
    • Ming Li
    • Cheng‑Xia Liu
    • Shao‑Jia Mou
    • Qian‑Kun Li
    • Zi‑Ping Chen
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The Qianfoshan Hospital of Shandong University, Jinan, Shandong 250014, P.R. China, Department of Gastroenterology, Yantai Affiliated Hospital of Binzhou Medical University, Yantai, Shandong 264003, P.R. China, Department of Gastroenterology, Affiliated Hospital of Binzhou Medical University, Binzhou, Shandong 256603, P.R. China
    Copyright: © Yue et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4455-4461
    |
    Published online on: July 24, 2018
       https://doi.org/10.3892/ol.2018.9202
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Gastric cancer is an intractable disease with a poor prognosis and limited treatment options. Its treatment remains a major clinical challenge worldwide. Ephrin‑B2 is upregulated and involved in tumor growth in various types of cancer. However, the association between ephrin‑B2 and prognosis of gastric cancer, and the potential of ephrin‑B2 as a therapeutic target remains unknown. The present study investigated ephrin‑B2 as a prognostic factor and a therapeutic target for gastric cancer. Reverse transcription‑quantitative polymerase chain reaction was performed to detect the protein expression level of ephrin‑B2 in gastric cancer serum samples (n=162) and healthy serum samples (n=165). It was revealed that the protein expression level of ephrin‑B2 was significantly upregulated in gastric cancer serum samples compared with the healthy samples. Ephrin‑B2 protein expression was associated with tumor size (P<0.001), metastasis (P=0.02) and TNM stage (P=0.03), and was indicated to be an independent prognostic factor for gastric cancer. Furthermore, the Kaplan‑Meier survival curve demonstrated that patients with high ephrin‑B2 protein expression had shorter overall and progression‑free survival rates than those with low ephrin‑B2 protein expression. Ephrin‑B2 protein expression was induced by small interfering RNA (siRNA) transfection of HGC27 and MKN‑45 cells, significantly impeding cell viability and inducing apoptosis of HGC27 and MKN‑45 cells compared with the respective negative control (NC) group. Thus, to the best of our knowledge, the present study indicates that ephrin‑B2 functions as an oncogene in gastric cancer, and that serum ephrin‑B2 level may be a promising non‑invasive prognostic indicator, as well as a therapeutic target for gastric cancer.

Introduction

Gastric cancer is an intractable disease and due to its poor prognosis and limited treatment options, it remains a major clinical challenge worldwide. Ephrin-B2, a membrane-anchored ligand that serves a key role in controlling angiogenic and lymphangiogenic growth factors, is upregulated and involved in tumor growth in various types of cancer (1). For example, ephrin-B2 protein overexpression has been demonstrated to be associated with poor overall survival rates in patients with head and neck squamous cell carcinoma (2). Ephrin-B2 mRNA levels have been reported to increase significantly with clinical stage, and high ephrin-B2 protein expression predicted a high 24-month survival rate of patients with ovarian cancer (3). Ephrin-B2 expression has also been demonstrated to be upregulated in primary hepatocarcinoma, glioblastoma and uterine cervical cancer (4–6). These findings suggest that ephrin-B2 may be a prognostic indicator in numerous types of cancer.

Ephrin-B2 is also a promising therapeutic target for cancer treatment and mediates glioblastoma stem-like-cell perivascular invasion (7). Ephrin-B2-knockdown has been demonstrated to block tumor initiation and treatment of established tumors via ephrin-B2 antibodies, which suppress progression in human glioblastoma stem-like cell-derived orthotopic xenografts (7). Systemic administration of ephrin-B2 blocking antibody indicated a reduction in the number of blood and lymphatic vessels in xenograft mice, and a concomitant reduction in tumor growth (8). Silencing of ephrin-B2 by RNA interference has been demonstrated to inhibit proliferation, invasion, migration and angiogenesis and to induce apoptosis of colorectal cancer cells; a possible result of vascular endothelial growth factor (VEGF) and matric metallopeptidase 9 (MMP9) regulation (9).

The association between ephrin-B2 and gastric cancer prognosis and the potential of ephrin-B2 as a therapeutic target in gastric cancer treatment remains unknown. The present study investigated ephrin-B2 as a prognostic factor and therapeutic target for gastric cancer.

Materials and methods

Collection of gastric cancer tissues and serum samples

Twenty gastric cancer tissues along with the matched healthy adjacent tissues were collected from patients at the Qianfoshan Hospital of Shandong University (Shandong, China) between April 2014 and April 2015. The serum samples were collected upon physical examination of healthy personnel (age median, 58 years; age range from 32–78 years; male/female: 80/85; n=165) and patients with gastric cancer (age median, 55 years; age range from 30–75 years; male/female: 78/84; n=162) from Qianfoshan Hospital of Shandong University (Shandong, China) between March 2009 and April 2016. Subjects with any other types of cancer, diabetes, cardiovascular and cerebrovascular diseases were excluded. Medical records of patients with gastric cancer with clinical Tumor-Node-Metastasis (TNM) staging and survival information were collected. The basic demographic characteristics and clinical features of the gastric cancer cases and heathy controls are presented in Table I. Overall survival (OS) is defined as the time from the date of pathological diagnosis to the date of mortality from any cause. Progression-free survival (PFS) is defined as the time from the date of pathological diagnosis to the date of the disease progression or mortality, if no progression was identified. All subjects provided written informed consent to participate in the present study. This project was approved by the Ethics Committee of The Qianfoshan Hospital, Shandong University (Shandong, China).

Table I.

Basic demographic characteristics and clinical features of the patients with gastric cancer and healthy controls.

Table I.

Basic demographic characteristics and clinical features of the patients with gastric cancer and healthy controls.

CharacteristicsGastric cancer tissue (n=20)Serum from patients with gastric cancer (n=162)Heathy control serum (n=165)P-value (patient vs. healthy serum)
Age, years (mean ± standard deviation)57.4±11.256.6±12.355.6±8.40.562
Sex
  Male1278800.951
  Female88485
Tumor size
  <5 cm778
  ≥5 cm1384
Distant metastasis
  No774
  Yes1388
Tumor-Node-Metastasis
  I–II569
  III–IV1593
Cell lines and cell transfection

The gastric cancer cell lines, HGC27 and MKN-45, were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were grown routinely in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% foetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and cultured in a 37°C with 5% CO2.

Knockdown of ephrin-B2 was achieved by transfection of lentiviruses containing ephrin-B2 small interfering RNA (GeneCopoecia, Guangzhou, China; sequence: CCGGTCTACATCAAATGGGTCTTTGCTCGAGCAAAGACCCATTTGATGTAGATTTTTG). The cells transfected with empty lentivirus were used as control. Cells were plated in 6 replicate wells in 96-well plates and cultured for 12 h. Cells were then transfected with the lentivirus (multiplicity of infection=10) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h according to the manufacturer's protocol. Transfected cells were used in subsequent assays.

Immunohistochemical (IHC) staining

The human tissues were fixed in 4% paraformaldehyde for 48 h at room temperature and paraffin-embedded. Tumor sections were cut into 4-µm thick sections. The slides were regularly deparaffinised and dehydrated. Slides were treated with citric acid buffer (pH 6.0) in a microwave oven (500 W, 12 min). Subsequent to cooling, the slices were blocked by normal goat serum (Wuhan Boster Biological Technology, Ltd., Wuhan, China), and incubated with a primary rabbit polyclonal anti-ephrin-B2 antibody (cat. no. ab131536; 1:100 dilution; Abcam, Cambridge, UK) overnight at 4°C. The sections were then washed with PBS and incubated with an Goat Anti-Rabbit IgG (Biotin) (cat. no. ab6720; 1:2,000 dilution; Abcam) for 2 h at 37°C and washed by PBS. The slides were stained by using DAB Detection kit (Maxim, Xiamen, China) according to manufacturer's protocol. Finally, the sections were counterstained with 1% hematoxylin for 3 min at 45°C. The IHC images were obtained at ×20 magnification under a light microscope (clipse Ni-E, Nikon, Japan). The quantification of positive signalling was performed by ImageJ (National Institutes of Health, Bethesda, MA, USA). The data of ephrin-B2-positive staining was analyzed in 8 fields of view and the data was averaged to produce a single value per subject.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

TRizol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from HGC27 and MKN-45 cells following lentiviral transfection. ABScript II cDNA First-Strand Synthesis kit (cat. no. RK20400; ABclonal Biotechnology Co., Ltd, Wuhan, China) was used for reverse transcription, according to the manufacturer's protocol. The expression of ephrin-B2 was measured by SsoFast EvaGreen supermix [cat. no. 1725201; Bio-Rad Laboratories (Shanghai) Co., Ltd. Shanghai, China], according to the manufacturer's protocol. Expression of β-actin was used as an endogenous control. The following primers were used: Ephrin-B2, forward, 5′-GCTGGGGTGTTTTGATGGTTT-3′, reverse, 5′-AGTGCATCTGTCTGCTTGGT-3′; β-actin, forward, 5′-GCCCTATAAAACCCAGCGGC-3′, reverse, 5′-TCGATGGGGTACTTCAGGGT-3′. The primers were synthesized by Sangon Co. Ltd. (Shanghai, China). RT-qPCR was performed with the following thermocycling conditions: 95.0°C for 3 min, and 39 cycles of 95.0°C for 10 sec and 60°C for 30 sec.

GenElute Plasma/Serum RNA Purification Midi kit (cat no. RNB600; Merck KGaA, Darmstadt, Germany) was used to isolate RNA from 1.5 ml serum per subject, according to the manufacturer's protocol. The quality and quantity of RNA was evaluated using NanoDrop 2000 (Thermo Fisher Scientific, Inc.). The RNA yield from these serum sample was ~50 ng/ml. The average absorbance ratio at 260/280 nm was ~1.93. A total of fifty ng RNA was reverse transcribed using a cDNA ABScript II cDNA First-Strand Synthesis kit (cat. no. RK20400, ABclonal Biotechnology Co., Ltd, Wuhan, China) according to the manufacturer's protocol The RT-PCR data was analysed by using 2−ΔΔCq method (10).

Cell Counting kit-8 proliferation assay (CCK-8)

HCG27 and MKN45 cells proliferation rates were measured using CCK-8 (Beyotime Institute of Biotechnology, Hangzhou, China) following Ephrin B2 knockdown. Cells were seeded at 0.5×104 cells per well in a 96-well plate for 24 h, and further incubated for 24, 48 or 72 h. A total of 10 µl CCK-8 reagent was added to each well 1 h prior to the endpoint of incubation. The optical density value per well was determined by a microplate reader at a wavelength of 570 nm. The experiments were repeated three times. Triplicate wells were used in each group.

Flow cytometry

An Annexin V-FITC/PI Apoptosis Detection kit (cat no. 40302ES50, Yeasen, Shanghai, China; http://www.yeasen.com/) was used for analysis of apoptosis. HGC27 and MKN-45 cells were harvested and washed twice with PBS. A total of 2×105 cells were resuspended in 500 µl binding buffer from the kit. A total of 10 µl Annexin V-FITC and 10 µl propidium iodide (PI) were added and mixed. After 15 min incubation, the cells were analyzed using a flow cytometer (BD Biosciences, San Jose, CA, USA) according to the manufacturer's protocol. The experiments were repeated three times. FlowJo (version 10.4.2, FlowJo LLC, Ashland, OR, USA) was used to analyse the apoptotic rate.

Statistical analysis

All data from three independent experiments were expressed as the mean ± standard deviation and processed using SPSS 17.0 statistical software (SPSS Inc., Chicago, IL, USA). The overall survival rate estimates were calculated using the Kaplan-Meier method with the log-rank test. The clinical association between ephrin-B2 expression and clinicopathological variables in patients with gastric cancer was evaluated by the χ2 test. The difference between two groups was calculated by Student's t-test and the difference between multiple groups were determined using a one-way analysis of variance with Tukey's post-hoc test. P<0.05 was considered to indicate a statistically significant difference. In addition, factors that could predict the prognosis of patients with gastric cancer were investigated by univariate and multivariate analyses.

Results

Ephrin-B2 expression is upregulated in gastric cancer tissues and serum samples

IHC staining was performed to measure the protein expression level of ephrin-B2 in gastric cancer tissues (n=20) and the matched healthy adjacent tissues. Ephrin-B2 was expressed in the cytoplasm of gastric cancer cells (Fig. 1). Ephrin-B2 expression was significantly increased in gastric cancer tissues compared with adjacent healthy control tissues (Fig. 1). In addition, RT-qPCR was performed to detect the protein expression level of ephrin-B2 in an independent cohort, including gastric cancer serum samples (n=162) and healthy serum samples (n=165). The expression of ephrin-B2 was revealed to be significantly upregulated in gastric cancer serum samples compared with the adjacent healthy samples (Fig. 2A), and the ephrin-B2 protein expression level was higher in serum from patients with TNM stage III–IV than TNM stage I–II disease (Fig. 2B), suggesting an association of ephrin-B2 with gastric cancer development.

Figure 1.

(A) Immunohistochemistry staining of ephrin-B2 in gastric cancer tissues and matched adjacent healthy tissues (n=20). (B) Quantification of the protein expression level of ephrin-B2 relative to gastric cancer tissues compared with matched adjacent control tissues (*P<0.05).

Figure 2.

The expression of ephrin-B2 in serum samples. (A) RT-qPCR was performed to measure the expression of ephrin-B2 in serum samples from the gastric cancer group (n=162) and the healthy control group (n=165). (B) The protein expression level of ephrin-B2 in the healthy control group compared with patients with gastric cancer with stage I–II and stage III–IV disease (*P<0.05). RT-qPCR, reverse transcription-quantitative polymerase chain reaction; GC, gastric cancer.

Ephrin-B2 is associated with clinicopathoclinical features of patients with gastric cancer

The cases of gastric cancer were divided into high and low ephrin-B2 protein expression groups, according to the mean mRNA expression value. It was revealed that ephrin-B2 protein expression was associated with tumor size (P<0.001), metastasis (P=0.02) and TNM stage (P=0.03) (Table II). Univariate analysis indicated that the serum ephrin-B2 protein expression level (P=0.02), as well as tumor size (P=0.01), distant metastasis (P=0.02) and TNM stage (P=0.03) were significantly associated with prognosis (Table III). Multivariate analysis indicated that the serum ephrin-B2 protein expression level (P=0.01), tumor size (P=0.01), distant metastasis (P=0.03) and TNM stage (P=0.02) were independent factors for predicting the prognosis of patients with gastric cancer (Table IV).

Table II.

Clinical association between serum ephrin-B2 levels and clinicopathological variables in gastric cancer.

Table II.

Clinical association between serum ephrin-B2 levels and clinicopathological variables in gastric cancer.

Serum ephrin-B2

VariableLow expression (n=69)High expression (n=93)P-value (χ2 test)
Age 0.52
  <603350
  ≥603643
Sex 0.63
  Male3543
  Female3450
Tumor size <0.001
  <5 cm4632
  ≥5 cm2361
Distant metastasis 0.02
  No3935
  Yes3058
Tumor-Node-Metastasis stage 0.03
  I–II3633
  III–IV3360

Table III.

Univariate analysis of factors associated with gastric cancer.

Table III.

Univariate analysis of factors associated with gastric cancer.

VariableHazard ratio (95% confidence intervals)P-value
Age (≥60/<60)1.16 (0.66–1.66)0.68
Sex (male/female)1.07 (0.67–1.47)0.72
Tumor size (≥5 cm/<5 cm)2.34 (2.24–2.44)0.01
Distant metastasis (yes/no)4.21 (3.81–4.61)0.02
Tumor-Node-Metastasis stage (III–IV/I–II)2.55 (2.35–2.75)0.03
Serum ephrin-B2 levels (high/low)3.71 (3.51–3.91)0.02

Table IV.

Multivariate analysis of potential independent prognostic factors of gastric cancer.

Table IV.

Multivariate analysis of potential independent prognostic factors of gastric cancer.

VariableHazard ratio (95% confluence intervals)P-value
Tumor size2.06 (1.96–2.16)0.01
Distant metastasis3.24 (2.94–3.54)0.03
Tumor-Node-Metastasis stage2.46 (2.16–2.76)0.02
Serum ephrin-B2 levels3.23 (3.03–3.53)0.01
High serum ephrin-B2 levels predict short overall and progression-free survival rates for patients with gastric cancer

The association between serum ephrin-B2 levels and survival time was analyzed in patients with gastric cancer. The Kaplan-Meier survival curve revealed that patients with high ephrin-B2 protein expression had shorter overall survival rates than those with low ephrin-B2 protein expression (Fig. 3A). It was also revealed that patients with low serum ephrin-B2 had longer progression-free survival times than those with high ephrin-B2 levels (Fig. 3B). Thus, the results suggest that ephrin-B2 served a role in the development of gastric cancer.

Figure 3.

Kaplan-Meier survival curves for high and low protein ephrin-B2 expression level in the gastric cancer group. (A) The overall survival rate of patients with gastric cancer (P=0.014). (B) The progression-free survival rate of patients with gastric cancer (P=0.035).

Knockdown of ephrin-B2 by siRNA inhibits the proliferation and promotes apoptosis of gastric cancer cells

To investigate whether ephrin-B2 affected the proliferation of gastric cells, ephrin-B2 expression was knocked down by siRNA in HGC27 and MKN-45 cells (Fig. 4A). The corresponding effect on apoptosis was observed in a flow cytometry assay (the data was not shown), which indicated a significant induction of apoptosis by ephrin-B2-knockdown in HGC27 and MKN-45 cells compared with the NC group (Fig. 4B). Ephrin-B2-knockdown was indicated to significantly increase the viability of HGC27 and MKN-45 cells (Fig. 4C and D).

Figure 4.

Effects of ephrin-B2-knockdown on apoptosis and proliferation. (A) Ephrin-B2 expression was knocked down by siRNA in HCG27 and in MKN-45 cells. (B) Apoptotic rate of HCG27 and MKN-45 cells with and without ephrin-B2-knockdown. (C) Cell viability following ephrin-B2-knockdown in HCG27 cells (D) Cell viability following ephrin-B2-knockdown in MKN45 cells. *P<0.05 and **P<0.001 vs. control. siRNA, small interfering RNA; OD, optical density.

Discussion

In the present study, ephrin-B2 was indicated to be significantly upregulated in gastric cancer serum samples compared with the adjacent healthy samples. Ephrin-B2 was revealed to be associated with tumor size, metastasis and TNM stage. Furthermore, patients with gastric cancer with high ephrin-B2 protein expression were indicated to have shorter survival rates than those with low ephrin-B2 protein expression. Ephrin-B2 has been demonstrated to be upregulated in various types of cancer, including papillary thyroid carcinoma, ovarian cancer and glioblastoma (11). Protein expression of ephrin-B2 in arterial endothelium has been reported to be significantly increased in tumor sections of the kidney, the bladder and the prostate compared with non-tumor sections (12). An association has been identified between the protein expression level of ephrin-B2 in glioma tissues and the Karnofsky performance scale (KPS) score of patients with glioma. Positive protein expression rates of ephrin-B2 in glioma tissues were significantly higher in patients with low KPS scores (4). A significant increase in the mRNA expression levels of ephrin-B2 in ovarian cancer tissues with clinical stage has been identified in ovarian cancers. The 24-month survival rates of patients with high ephrin-B2 protein expression were indicated to be poor (3). In cervical cancer tissues, an increase of ephrin-B2 has been detected with disease advancement, based on clinical stage, lymph node metastasis, tumor size and poor patient prognoses (6). The aforementioned findings suggest that ephrin-B2 may be a prognostic indicator in several types of cancer. In the present study, it was reported that ephrin-B2 was significantly upregulated in gastric cancer serum samples compared with healthy samples. Taking into consideration the association of serum ephrin-B2 with tumor size, metastasis and TNM stage of gastric cancer, and the non-invasiveness of collecting serum samples, we speculate that ephrin-B2 function is a promising prognostic indicator for gastric cancer.

Ephrin-B2 regulates endothelial cell death (13), suggesting that ephrin-B2 is involved in angiogenesis (14). A previous study has reported that blocking ephrin-B2 with highly specific antibodies inhibits angiogenesis, lymphangiogenesis and tumor growth (8). Krusche et al (7) revealed that upregulation of the ephrin-B2 ligand in glioblastoma stem-like cells enabled perivascular migration through homotypic forward signaling. In human glioblastoma stem-like cell-derived orthotopic xenografts, ephrin-B2-knockdown was indicated to block tumor initiation. Furthermore, a combined treatment, involving an ephrin-B2-specific antibody, was indicated to have an additive activity that inhibited the migration and invasion of Kaposi sarcoma cells (15). An association between ephrin-B2 and chemoresistance has also been reported (16). Ephrin-B2 has been identified as a target gene of the gain-of-function mutant p53, which is responsible for chemoresistance (17). The mutant p53 complex has been reported to transcriptionally upregulate ephrin-B2 protein expression in response to DNA damage. Ephrin-B2-silencing has been demonstrated to restore chemosensitivity in mutant p53-harboring tumors, involving the c-Jun N-terminal kinase signaling pathway and the c-Src/extracellular signal-regulated kinase pathway (17). To evaluate the function of ephrin-B2 in gastric cancer, a loss-function assay was performed in two gastric cancer cell lines. The results indicated that ephrin-B2-knockdown significantly inhibited cell viability and induced apoptosis. Thus, ephrin-B2 was demonstrated to function as an oncogene in gastric cancer. However, the underlying mechanism by which ephrin-B2 promotes gastric cancer cell proliferation requires further examination.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Authors' contributions

WJY and ZPC made substantial contributions to the design of the study. YPL, ML and CXL analysed and interpreted the patient data. SJM and QKL performed cell biological experiments. WJY and SJM performed quantitative polymerase chain reaction and immunohistochemical staining. All authors contributed to writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of the Qianfoshan Hospital of Shandong University (Shandong, China). Written informed consent was obtained from all patients.

Patient consent for publication

All subjects participating in the present study provided written informed consent for the publication of any data.

Competing interests

The authors have no conflicts of interest to declare.

References

1 

Wang Y, Nakayama M, Pitulescu ME, Schmidt TS, Bochenek ML, Sakakibara A, Adams S, Davy A, Deutsch U, Lüthi U, et al: Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis. Nature. 465:483–486. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Yavrouian EJ, Sinha UK, Rice DH, Salam MT, Gill PS and Masood R: The significance of EphB4 and EphrinB2 expression and survival in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg. 134:985–991. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Alam SM, Fujimoto J, Jahan I, Sato E and Tamaya T: Coexpression of EphB4 and ephrinB2 in tumour advancement of ovarian cancers. Br J Cancer. 98:845–851. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Tu Y, He S, Fu J, Li G, Xu R, Lu H and Deng J: Expression of EphrinB2 and EphB4 in glioma tissues correlated to the progression of glioma and the prognosis of glioblastoma patients. Clin Transl Oncol. 14:214–220. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Zhu XL, Chen P, Guo H, Hou WJ, Shi Y, Zhang T, Li Q and Zhang N: Relationships among differentiation degree, contrast-enhanced ultrasound and the expression of Ephb4/Ephrinb2 in primary hepatocarcinoma. Hepatogastroenterology. 59:1164–1167. 2012.PubMed/NCBI

6 

Alam SM, Fujimoto J, Jahan I, Sato E and Tamaya T: Coexpression of EphB4 and ephrinB2 in tumor advancement of uterine cervical cancers. Gynecol Oncol. 114:84–88. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Krusche B, Ottone C, Clements MP, Johnstone ER, Goetsch K, Lieven H, Mota SG, Singh P, Khadayate S, Ashraf A, et al: EphrinB2 drives perivascular invasion and proliferation of glioblastoma stem-like cells. Elife. 5:e148452016. View Article : Google Scholar : PubMed/NCBI

8 

Abengozar MA, de Frutos S, Ferreiro S, Soriano J, Perez-Martinez M, Olmeda D, Marenchino M, Canamero M, Ortega S, Megias D, et al: Blocking ephrinB2 with highly specific antibodies inhibits angiogenesis, lymphangiogenesis, and tumor growth. Blood. 119:4565–4576. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Li P, Chen W, Wang Y, Fu X, Wen K, Qian J, Huang C and Fu Z: Effects of ephrinB2 gene siRNA on the biological behavior of human colorectal cancer cells. Oncol Rep. 33:758–766. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Sharma GK, Dhillon VK, Masood R and Maceri DR: Overexpression of EphB4, EphrinB2, and epidermal growth factor receptor in papillary thyroid carcinoma: A pilot study. Head Neck. 37:964–969. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Ozgur E, Heidenreich A, Dagtekin O, Engelmann U and Bloch W: Distribution of EphB4 and EphrinB2 in normal and malignant urogenital tissue. Urol Oncol. 29:78–84. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Salvucci O, Ohnuki H, Maric D, Hou X, Li X, Yoon SO, Segarra M, Eberhart CG, Acker-Palmer A and Tosato G: EphrinB2 controls vessel pruning through STAT1-JNK3 signalling. Nat Commun. 6:65762015. View Article : Google Scholar : PubMed/NCBI

14 

Yamanda S, Ebihara S, Asada M, Okazaki T, Niu K, Ebihara T, Koyanagi A, Yamaguchi N, Yagita H and Arai H: Role of ephrinB2 in nonproductive angiogenesis induced by Delta-like 4 blockade. Blood. 113:3631–3639. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Scehnet JS, Ley EJ, Krasnoperov V, Liu R, Manchanda PK, Sjoberg E, Kostecke AP, Gupta S, Kumar SR and Gill PS: The role of Ephs, Ephrins, and growth factors in Kaposi sarcoma and implications of EphrinB2 blockade. Blood. 113:254–263. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Depner C, Zum BH, Bogurcu N, Cuesta AM, Aburto MR, Seidel S, Finkelmeier F, Foss F, Hofmann J, Kaulich K, et al: EphrinB2 repression through ZEB2 mediates tumour invasion and anti-angiogenic resistance. Nat Commun. 7:123292016. View Article : Google Scholar : PubMed/NCBI

17 

Alam SK, Yadav VK, Bajaj S, Datta A, Dutta SK, Bhattacharyya M, Bhattacharya S, Debnath S, Roy S, Boardman LA, et al: DNA damage-induced ephrin-B2 reverse signaling promotes chemoresistance and drives EMT in colorectal carcinoma harboring mutant p53. Cell Death Differ. 23:707–722. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yue WJ, Liu YP, Li M, Liu CX, Mou SJ, Li QK and Chen ZP: High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer. Oncol Lett 16: 4455-4461, 2018.
APA
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., & Chen, Z. (2018). High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer. Oncology Letters, 16, 4455-4461. https://doi.org/10.3892/ol.2018.9202
MLA
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., Chen, Z."High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer". Oncology Letters 16.4 (2018): 4455-4461.
Chicago
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., Chen, Z."High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer". Oncology Letters 16, no. 4 (2018): 4455-4461. https://doi.org/10.3892/ol.2018.9202
Copy and paste a formatted citation
x
Spandidos Publications style
Yue WJ, Liu YP, Li M, Liu CX, Mou SJ, Li QK and Chen ZP: High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer. Oncol Lett 16: 4455-4461, 2018.
APA
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., & Chen, Z. (2018). High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer. Oncology Letters, 16, 4455-4461. https://doi.org/10.3892/ol.2018.9202
MLA
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., Chen, Z."High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer". Oncology Letters 16.4 (2018): 4455-4461.
Chicago
Yue, W., Liu, Y., Li, M., Liu, C., Mou, S., Li, Q., Chen, Z."High serum Ephrin‑B2 levels predict poor prognosis for patients with gastric cancer". Oncology Letters 16, no. 4 (2018): 4455-4461. https://doi.org/10.3892/ol.2018.9202
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team