Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
December-2018 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection

  • Authors:
    • Zhihong Min
    • Xiaowen Pu
    • Zhengrong Gu
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai 200127, P.R. China
    Copyright: © Min et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 7189-7194
    |
    Published online on: September 28, 2018
       https://doi.org/10.3892/ol.2018.9520
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

This study investigated the expression of IL-10 and Ki-67 in human cervical cancer and cervical intraepithelial neoplasia (CIN) and the correlation with human papillomavirus infection. A total of 110 patients with cervical lesions undergoing surgical treatment in Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine from 2016 to 2017 were selected. Those patients included 36 cases of cervical cancer and 74 cases of CIN. At the same time, 30 cases of chronic cervicitis were selected as the control group. RT‑qPCR was used to detect the expression of IL‑10 and Ki‑67 in cervical tissue. PCR was used to detect HPV infection in cervical tissue. The expression levels of IL‑10 and Ki‑67 in the cervical cancer and CIN groups were higher than those in the control group. Moreover, the expression levels of IL‑10 and Ki‑67 in the cervical cancer and CIN II‑III groups were higher than those in the CIN I group (P<0.05). In addition, the expression levels of IL‑10 and Ki‑67 in the cervical cancer group were significantly higher than those in the CIN II‑III group. Furthermore, the expression levels of IL‑10 and Ki‑67 were positively correlated with HPV infection (r=0.783 or 0.712, P<0.05). Finally, the expression levels of IL‑10 and Ki‑67, and HPV infection in the cervical lesions studied were significantly different. Therefore, combined detection of IL‑10, Ki‑67 and HPV infection can improve the diagnosis of CIN and early cervical cancer.

Introduction

Cervical cancer is a common gynecological malignancy that affects 500,000 new cases and causes approximately 270,000 deaths worldwide every year (1). In recent years, the onset age of cervical cancer is becoming increasingly younger. Cervical cancer lacks obvious symptoms during the early stages, and prognosis of cervical cancer at advanced cervical cancer is poor (2).

The etiology of cervical cancer is complex and diverse. Currently, the main cause of cervical lesions has been proven to be the infection of human papillomavirus (HPV) (3). HPV is a common sexually transmitted virus, with more than 200 subtypes, and those subtypes are divided into the low-risk group and the high-risk group (4). High-risk HPV infection usually causes malignant tumors such as cervical cancer (5), and HPV16 and HPV18 as two high risk types have been confirmed to be related to the occurrence of cervical cancer (6,7). In most cases, viruses can be killed by immune response after HPV infection. Aggravated HPV infection can lead to the progression of cervical disease to cervicitis and cervical intraepithelial neoplasia (CIN). In extreme cases, CIN will further develop into cervical cancer (8). Body's immune response can effectively control precancerous lesions, and changes in immune response may increase the probability of HPV-related diseases (9). Studies have shown that the immunosuppressive factor IL-10 produced by cervical lesions can interact with other types of cytokines to weaken tumor-specific immunity and promote tumorigenesis (10,11). Development of CIN is often characterized by excessive cell proliferation and abnormal differentiation (12). Therefore, markers related to cell proliferation have clinical value for the evaluation of cervical cancer. Ki-67 is a nuclear antigen gene synthesized in the G1, S, and G2/M phases for the maintenance of cell prolife-rative activity (13). It can accurately reflect cell proliferation activity and provide important references for the prediction of malignant transformation. Therefore, timely monitoring of HPV infection and IL-10 and Ki-67 expression can provide guidance for the treatment of cervical cancer.

In this study, 110 cases of cervical lesions undergoing surgical treatment (36 cases of cervical cancer and 74 cases of CIN) were selected and 30 cases of chronic cervicitis were also selected to serve as a the control group to detect the expression of IL-10 and Ki-67, and HPV infection. The correlation of IL-10 and Ki-67 expression with HPV infection was also investigated.

Patients and methods

Grouping of patients

A total of 110 females with cervical lesions diagnosed in Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine (Shanghai, China) from 2016 to 2017 were included as the observation group. The observation group included 36 cases of cervical cancer (invasive squamous cell carcinoma of the cervix) and 74 cases of CIN patients (34 cases of CIN stage I, 18 cases of CIN stage II and 22 cases of CIN stage III). Stages II and III were combined into the CIN II–III group (40 cases), and the control group was 30 patients with chronic cervicitis. All research subjects were suitable for hysterectomy or cervical conization. No preoperative chemotherapy and chemotherapy were performed before surgery. Acute gynecological inflammation was not observed in the patients. There was no statistically significant difference in age between the control group and the observation group (Table I). All patients were reviewed and confirmed by pathologists. All participants were informed and signed informed consent. The study was approved by the Ethics Committee of Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine.

Table I.

Clinical data.

Table I.

Clinical data.

GroupsCasesAge (mean ± SD)Interstitial infiltration depth >1/2Lymph node metastasisSCC-Ag (µg/l)CA125 (U/ml)
Control3042.8±8.8000.53±0.059.58±1.55
CIN I3440.3±7.6611.35±0.0715.67±2.53
CIN II–III4042.1±7.81947.87±0.8543.51±3.33
CC3643.5±6.220610.56±1.5352.34±4.53
F-value 0.016<11.524><4.86>94.347129.686
P-value 0.9050.0030.048<0.001<0.001

[i] CIN, cervical intraepithelial neoplasia.

Main reagents

RNA extraction kit, DNA extraction kit, Taq enzyme, and real-time fluorescence quantitative PCR kit were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Rabbit anti-human IL-10 polyclonal antibody, rabbit anti-human Ki-67 polyclonal antibody (dilution, 1:300; cat no. 20850-1-AP, 27309-1-AP) were purchased from ProteinTech Group, Inc.; Wuhan Sanying Biotechnology (Wuhan, China) and SP universal reagent kits and DAB chromogenic kits were purchased from Boster Biological Technology (Pleasanton, CA, USA). cDNA first-strand synthesis kit was purchased from Takara Bio, Inc. (Otsu, Japan). Primers used in this experiment were all synthesized by GenScript Co., Ltd. (Nanjin, China).

HPV detection

Genomic DNA of the patient's cervical tissue obtained during surgical resection was extracted and used as a template to perform PCR reactions using HPV universal primer MY09/11 (14) to detect whether HPV existed in the patient's cervical tissues. PCR reaction system consisted of 2 µl of buffer, 1 µl of dNTPs, 0.5 µl of upstream and downstream primers, 1 µl of template and 0.5 µl of Taq enzyme, and ddH2O was added to make a final concentration of 20 µl. PCR reaction conditions were: 94°C for 5 min, followed by 30 cycles of 94°C for 50 sec, 55°C for 50 sec and 72°C for 1 min, and 72°C for 10 min. After the PCR reaction, the amplified product was detected by 1.5% agarose gel electrophoresis and photographed using imaging system.

RT-qPCR

RNA extraction kit was used to extract total RNA from cervical tissue, and cDNA was synthesized according to the instructions of cDNA first-strand synthesis kit. RT-qPCR reactions were performed to detect the expression of IL-10 and Ki-67 mRNA using cDNA as template and β-actin as endogenous control. PCR reaction system was: 10 µl of SYBR-Green Master Mix, 0.5 µl of upstream and downstream primers, and 1 µl of template cDNA, and ddH2O was added to make a final volume of 20 µl. RT-qPCR reaction conditions: 95°C for 3 min, followed by 40 cycles of 95°C for 30 sec and 58°C for 1 min. Sequences of primers are listed in Table II. The experimental results were analyzed using the 2−ΔΔCq method (15).

Table II.

Sequences of primers of RT-qPCR amplification.

Table II.

Sequences of primers of RT-qPCR amplification.

GenesPrimersSequences (5′-3′)Length of product (bp)
IL-10F: ATGCCCCAAGCTGAGAACCAAG350
R: TCTCAAGGGGCTGGGTCACTATC
Ki-67F: GTCTGTCTTACATGTTATTTAATC219
R: ATCACCAATAAATAGTCTGGGCT
β-actinF: TTCCAGCCTTCCTTCCTGG225
R: TTGCGCTCAGGAGGAGCAAT

[i] F, forward; R, reverse.

Immunohistochemical detection of positive rates of IL-10 and Ki-67 expression

Paraffin embedded cervical tissue were used to make tissue sections with a thickness of 4 µm and immunohistochemical SP method was used to detect the positive rate of IL-10 and Ki-67 expression according the manufacturers instructions. DAB method was used for color development, and yellow granules in the nucleus indicated the positive expression of IL-10 and Ki-67. As a result, the ratio of positive cells to tumor cells <10% was determined a negative, and >10% was determined as positive.

Statistical analysis

SPSS 17.0 (Beijing Xin Mei Jiahong Technology Co., Ltd., Beijing, China) was used for statistical analysis. Measurement data were expressed as mean ± SD. Analysis of variance was used for comparisons among multiple groups and Least Significant Difference test was the post hoc test. t-test was used for comparisons between two groups. Chi-square test was used for comparisons of count data. Personality analysis was performed using Pearsons correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Analysis of clinical data

Clinical data are shown in Table I. There was no difference in age between the observation group (CIN I, CIN II–III and cervical cancer groups) and the control group. In the observation group, interstitial infiltration depth >1/2 was observed in 40.91% of patients (45/110) and lymph node metastasis was observed in 10% (11/110) of patients. Significant differences were found between the observation and control groups (P<0.05). The levels of SCC-Ag and CA125 indicators were significantly higher in the observation group than in the control group (P<0.05).

Analysis of HPV infection in cervical tissues

PCR detection results showed that the positive rates of HPV in cervical cancer, CIN I and CIN II–III groups were significantly higher than those in the control group (Chi-square values were 11.356, 10.486 and 31.268, respectively; P<0.05). The positive rate of HPV in the cervical cancer group was significantly higher than that in the CIN II–III and CIN I groups (Chi-square values were 9.188 and 25.656, respectively; P<0.05). Finally, the positive rate of the CIN II–III group was significantly higher than that of the CIN I group (Chi-square value was 7.349; P<0.05) (Table III).

Table III.

HPV Infection in cervical tissues (n, %).

Table III.

HPV Infection in cervical tissues (n, %).

GroupsCaseHPV
Control303 (10)
CIN I3416 (47.06)a,b
CIN II–III4031 (77.5)a–c
CC3636 (100)a
χ2 63.417
P-value <0.001

a P<0.05, compared with the control group

b P<0.05, compared with the CC group

c P<0.05, compared with CIN I. CIN, cervical intraepithelial neoplasia.

Analysis of IL-10 expression in cervical tissue

RT-qPCR analysis showed that the mRNA expression levels of IL-10 in the cervical cancer, CIN I, and CIN II–III groups were significantly higher than those in the control group (t values were 25189.812, 6054.89, 21118.557, respectively; P<0.05). The expression of IL-10 in the cervical cancer group was significantly higher than that in the CIN II–III and CIN I groups (t values were 8842.564 and 6054.489, respectively; P<0.05). The expression level of IL-10 in the CIN II–III group was significantly higher than that in the CIN I group (t value was 30762.692; P<0.05). The positive rate of IL-10 expression was significantly higher in the cervical cancer, CIN I, and CIN II–III groups than that in the control group (Chi-square values were 35.867, 3.757 and 17.77759, respectively; P<0.05). The positive rate of IL-10 expression was significantly higher in the cervical cancer group than in the CIN II–III and CIN I groups (Chi-square values were 27.68 and 10.902, respectively; P<0.05). Finally, the positive rate of IL-10 expression was significantly higher in the CIN II–III group than in the CIN I group (Chi-square values was 5.606; P<0.05) (Table IV).

Table IV.

The expression of IL-10 in the cervical tissues of each group [mean ± SD, n (%)].

Table IV.

The expression of IL-10 in the cervical tissues of each group [mean ± SD, n (%)].

GroupsCases (n)IL-10 expression levelIL-10 positive rate
Control3023.63±3.242 (6.67)
CIN I34 102.08±10.34a,b6 (17.65)a,b
CIN II–III40 238.36±15.22a–c22 (55)a–c
CC36 303.24±18.17a29 (80.56)a
F-value (χ2) 25658.601<48.35>
P-value <0.001<0.001

a P<0.05, compared with the control group

b P<0.05, compared with the CC group

c P<0.05, compared with CIN I. CIN, cervical intraepithelial neoplasia.

Analysis of Ki-67 expression in cervical tissue

As shown in Table V, the expression level of Ki-67 was higher in the cervical cancer, CIN I, and CIN II–III groups than in the control group (t values were 61329.613, 571.8836 and 95665.658, respectively; P<0.05). The expression level of Ki-67 was significantly higher in the cervical cancer group than in the CIN II–III and CIN I groups (t values were 2075.601 and 59985.685, respectively; P<0.05). The expression level of Ki-67 was significantly higher in the CIN II–III group than in the CIN I group (t value 46500.616; P<0.05). The positive rate of Ki-67 expression was significantly higher in the cervical cancer, CIN, and CIN II–III groups than in the control group (Chi-square values were 30.249, 15.877 and 34.435, respectively; P<0.05). The positive rate of Ki-67 expression was significantly higher in the cervical cancer group than in the CIN II–III and CIN I groups (Chi-square values were 3.849 and 6.949, respectively; P<0.05). Finally, the positive rate of Ki-67 expression was significantly higher in the CIN II–III group than in the CIN I group (Chi-square value was 4.18; P<0.05).

Table V.

The expression of Ki-67 in the cervical tissues of each group [mean ± SD, n (%)].

Table V.

The expression of Ki-67 in the cervical tissues of each group [mean ± SD, n (%)].

GroupsCases (n)Ki-67 expression levelsKi-67 positive expression rate
Control3049.37±5.2410 (33.33)
CIN I34 143.18±18.54a,b27 (79.41)a,b
CIN II–III40 323.83±17.23a–c36 (90)a–c
CC36 353.12±18.19a36 (100)a
F-value (χ2) 38114.081<55.576>
P-value <0.001<0.001

a P<0.05 compared with the control group

b P<0.05, compared with the CC group

c P<0.05, compared with CIN I. CIN, cervical intraepithelial neoplasia.

Correlation between IL-10 and Ki-67 expression and HPV infection in cervical cancer tissues

Among 110 cases of cervical lesions and 30 cases of chronic cervicitis, 86 cases were HPV-positive and 54 cases were HPV-negative. Correlation analysis showed that the levels of IL-10 and Ki-67 expression were positively correlated with HPV infection (r=0.783, 0.712; P<0.05) (Table VI).

Table VI.

Correlation between HPV infection and IL-10 and Ki-67 expression in CC tissues (n).

Table VI.

Correlation between HPV infection and IL-10 and Ki-67 expression in CC tissues (n).

IL-10 expressionKi-67 expression


GroupsCasesPositiveNegativePositiveNegative
HPV positive865729860
HPV negative542522332
r 0.7830.712

Discussion

Cervical cancer is a serious threat to women's health, and the incidence rate is gradually increasing. At present, the conventional clinical treatment methods for this disease are surgery, radiotherapy, and chemotherapy. Although these treatments have a certain therapeutic effect, recurrence and metastasis after treatment still occur, especially in patients with advanced cervical cancer (16). Therefore, early diagnosis and treatment of cervical cancer is still critical.

HPV is a spherical DNA virus that causes squamous epithelium proliferation in the skin mucous membranes (17). Studies have shown that HPV infection is closely related to the occurrence of cervical cancer, in which infection of high-risk HPV plays an important role (18). High-risk HPV16 and HPV18 infection rate in cervical cancer patients was 50 and 20%, respectively (19). DNA fragment of high-risk HPV inserts into host genome to disrupt the stability of the genome, so as to induce neoplastic transformation (20). This study found that the positive rate of HPV in the cervical cancer group was 100%, which was significantly higher than that of the CIN I, CIN II–III and control groups (P<0.05). The positive rate of HPV in the CIN II–III group was significantly higher than that in the CIN I and control groups (P<0.05). The positive rate of HPV in the CIN I group was significantly higher than that in the control group (P<0.05). Our findings showed that, with the development of cervical lesions, the infection rate of HPV increases. All cervical cancer patients were infected with HPV, indicating that HPV infection is closely related to the occurrence and development of cervical cancer. Vuitton et al (21) reported that the onset of cervical cancer patients is associated with high-risk HPV infection, suggesting that high-risk HPV is an important factor in the onset of cervical cancer.

Studies have shown that the proportion of T cells secreting IL-10 is higher in patients infected with HPV virus than in non-infected individuals (22), revealing that the development of cervical cancer is related to high level of IL-10. The role of IL-10 is to inhibit the production of antitumor factors, hinder the role of monocyte-macrophages, and accelerate tumor growth and proliferation (23). In addition, studies have shown that in cervical lesions, the increase in IL-10 is mainly caused by local lesions, and is not related to the plasma content (21). Therefore, the present study examined the expression of IL-10 in cervical tissue. Results showed that the mRNA expression levels of IL-10 in the cervical cancer, CIN I, and CIN II–III groups were significantly higher than those in the control group (P<0.05). The expression level of IL-10 in the cervical cancer group was significantly higher than that in the CIN II–III and CIN I groups (P<0.05). The expression level of IL-10 in the CIN II–III group was significantly higher than that in the CIN I group (P<0.05), indicating that, with the development of cervical lesions, the expression level of IL-10 also increased. The positive rate of IL-10 expression was also significantly different among the cervical cancer, CIN I, CIN II–III and control groups (P<0.05). With the increase of cervical lesions, the IL-10 positive expression rate also increased. Those data suggest that expression of IL-10 is closely related to the development of cervical lesions. Correlation analysis showed that the IL-10 expression was positively correlated with HPV infection. Our study confirmed that the expression of IL-10 is closely related to the occurrence and development of cervical cancer, which is consistent with the findings of Barbisan et al (24).

Ki-67 expression is closely related to cell mitosis and cell proliferation. Ki-67 can be used as a criterion to distinguish different degrees of benign and malignant tumors (25). Results of this study showed that expression level of Ki-67 in the cervical cancer, CIN I, and CIN II–III groups were higher than those in the control group (P<0.05). The expression level of Ki-67 in the cervical cancer group was significantly higher than in the CIN II–III and CIN I groups (P<0.05). The expression level of Ki-67 in the CIN II–III group was significantly higher than that in the CIN I group (P<0.05), indicating that the expression level of Ki-67 increased with the development of cervical cancer. Furthermore, the positive rate of Ki-67 expression increased significantly, with increase in severity of cervical lesions (from CIN I and CIN II–III groups to cervical cancer group, P<0.05). The correlation analy-sis showed that the expression of Ki-67 was positively correlated with HPV infection. The above data indicated that the expression of Ki-67 is closely related to the occurrence and development of cervical cancer, which is consistent with the findings of Muñoz et al (26).

In conclusion, HPV infection rate in cervical cancer tissues is high, and the expression levels of IL-10 and Ki-67 increase with increased severity of cervical lesions, and the expression levels of IL-10 and Ki-67 are positively correlated with HPV infection rate. Therefore, detection of the IL-10 and Ki-67 expression and HPV infection may provide references for the diagnosis of cervical cancer.

Acknowledgements

Not applicable.

Funding

This study was supported by Shanghai municipal medical and health discipline construction projects (no. 2017ZZ02015).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

ZM drafted this study. ZM and XP detected HPV and were responsible for RT-qPCR. ZG contributed to the performance of immunohistochemical detection. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine (Shanghai, China). Signed informed consents were obtained from the patients or guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Pedroza-Torres A, Campos-Parra AD, Millan-Catalan O, Loissell-Baltazar YA, Zamudio-Meza H, de León Cantú D, Montalvo-Esquivel G, Isla-Ortiz D, Herrera LA, Ángeles-Zaragoza Ó, et al: MicroRNA-125 modulates radioresistance through targeting p21 in cervical cancer. Oncol Rep. 39:1532–1540. 2018.PubMed/NCBI

2 

Ho CM, Chien TY, Huang SH, Wu CJ, Shih BY and Chang SC: Multivariate analysis of the prognostic factors and outcomes in early cervical cancer patients undergoing radical hysterectomy. Gynecol Oncol. 93:458–464. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Hildesheim A, Gonzalez P, Kreimer AR, Wacholder S, Schussler J, Rodriguez AC, Porras C, Schiffman M, Sidawy M, Schiller JT, et al: Costa Rica HPV Vaccine Trial (CVT) Group: Impact of human papillomavirus (HPV) 16 and 18 vaccination on prevalent infections and rates of cervical lesions after excisional treatment. Am J Obstet Gynecol. 215:212.e1–212.e15. 2016. View Article : Google Scholar

4 

Gill SS, Jana AM, Shrivastav A, Sharma S and Sharma A: The carcinogenic potential of E6& E7 genes of high-risk HPV compared with E6, E7 genes of low-risk HPV in human cervical cancer: A review. Int J Pharm Sci Res. 5:703–712. 2014.

5 

Karanikas V, Zamanakou M, Kerenidi T, Dahabreh J, Hevas A, Nakou M, Gourgoulianis KI and Germenis AE: Indoleamine 2,3-dioxygenase (IDO) expression in lung cancer. Cancer Biol Ther. 6:1258–1262. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Bagarazzi ML, Yan J, Morrow MP, Shen X, Parker RL, Lee JC, Giffear M, Pankhong P, Khan AS, Broderick KE, et al: Immunotherapy against HPV16/18 generates potent TH1 and cytotoxic cellular immune responses. Sci Transl Med. 4:155ra1382012. View Article : Google Scholar : PubMed/NCBI

7 

Amador-Molina A, Hernández-Valencia JF, Lamoyi E, Contreras-Paredes A and Lizano M: Role of innate immunity against human papillomavirus (HPV) infections and effect of adjuvants in promoting specific immune response. Viruses. 5:2624–2642. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Vidal JP, Felix SP, Chaves CB, Patury P, Franco VF, de Morais EA, de Carvalho NA, Carvalho AC, Neto Almeida OF, Vieira LM, et al: Genetic diversity of HPV16 and HPV18 in Brazilian patients with invasive cervical cancer. J Med Virol. 88:1279–1287. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Reuschenbach M, Waterboer T, Einenkel J, Wallin K-L, Dillner J, Heilig B, Hamsikova E, Pawlita M, von Knebel Doeberitz M and Wentzensen N: Characterization of humoral immune responses against p16 in HPV-associated and non HPV-associated disease. Cancer Res. 68 Suppl 9:21262008.

10 

Cilfone NA, Ford CB, Marino S, Mattila JT, Gideon HP, Flynn JL, Kirschner DE and Linderman JJ: Computational modeling predicts IL-10 control of lesion sterilization by balancing early host immunity-mediated antimicrobial responses with caseation during mycobacterium tuberculosis infection. J Immunol. 194:664–677. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Ekalaksananan T, Malat P, Pientong C, Kongyingyoes B, Chumworathayi B and Kleebkaow P: Local cervical immunity in women with low-grade squamous intraepithelial lesions and immune responses after abrasion. Asian Pac J Cancer Prev. 15:4197–4201. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Bergner S, Halec G, Schmitt M, Aubin F, Alonso A and Auvinen E: Individual and complementary effects of human papillomavirus oncogenes on epithelial cell proliferation and differentiation. Cells Tissues Organs. 201:97–108. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Palacios F, Moreno P, Morande P, Abreu C, Correa A, Porro V, Landoni AI, Gabus R, Giordano M, Dighiero G, et al: High expression of AID and active class switch recombination might account for a more aggressive disease in unmutated CLL patients: Link with an activated microenvironment in CLL disease. Blood. 115:4488–4496. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Zhang M, Liu Y, Liu S, Zhang B, Si J, Xu X, Chen L and Song G: Assay and L1 gene sequence analysis of human papillomavirus type 6 and 11 in condylomata acuminata. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 22:463–466. 2000.(In Chinese). PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Landoni F, Colombo A, Milani R, Placa F, Zanagnolo V and Mangioni C: Randomized study between radical surgery and radiotherapy for the treatment of stage IB-IIA cervical cancer: 20-year update. J Gynecol Oncol. 28:e342017. View Article : Google Scholar : PubMed/NCBI

17 

Leto M, Santos Júnior GF, Porro AM and Tomimori J: Human papillomavirus infection: Etiopathogenesis, molecular biology and clinical manifestations. An Bras Dermatol. 86:306–317. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Jiménez-Wences H, Martínez-Carrillo DN, Peralta-Zaragoza O, Campos-Viguri GE, Hernández-Sotelo D, Jiménez-López MA, Muñoz-Camacho JG, Garzón-Barrientos VH, Illades-Aguiar B and Fernández-Tilapa G: Methylation and expression of miRNAs in precancerous lesions and cervical cancer with HPV16 infection. Oncol Rep. 35:2297–2305. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Wagner M, Bennetts L, Patel H, Welner S, de Sanjose S and Weiss TW: Global availability of data on HPV genotype-distribution in cervical, vulvar and vaginal disease and genotype-specific prevalence and incidence of HPV infection in females. Infect Agent Cancer. 10:132015. View Article : Google Scholar : PubMed/NCBI

20 

Araujo-Neto AP, Ferreira-Fernandes H, Amaral CMM, Santos LG, Freitas AC, Silva-Neto JC, Rey JA, Burbano RR, Silva BB, Yoshioka FKN, et al: Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil. Genet Mol Biol. 39:24–29. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Vuitton DA, Azizi A, Richou C, Vuitton L, Blagosklonov O, Delabrousse E, Mantion GA and Bresson-Hadni S: Current interventional strategy for the treatment of hepatic alveolar echinococcosis. Expert Rev Anti Infect Ther. 14:1179–1194. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Chung EY, Liu J, Zhang Y and Ma X: Differential expression in lupus-associated IL-10 promoter single-nucleotide polymorphisms is mediated by poly(ADP-ribose) polymerase-1. Genes Immun. 8:577–589. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Naing A, Papadopoulos KP, Autio KA, Ott PA, Patel MR, Wong DJ, Falchook G, Pant S, Whiteside M, Rasco D, et al: Anti-tumor activity of PEGylated human IL-10 (AM0010) in renal cancer alone and in combination with anti-PD1. Ann Oncol. 27:364PD2016. View Article : Google Scholar

24 

Barbisan G, Pérez LO, Contreras A and Golijow CD: TNF-α and IL-10 promoter polymorphisms, HPV infection, and cervical cancer risk. Tumour Biol. 33:1549–1556. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Kemmerling R, Weyland D, Kiesslich T, Illig R, Klieser E, Jäger T, Dietze O and Neureiter D: Robust linear regression model of Ki-67 for mitotic rate in gastrointestinal stromal tumors. Oncol Lett. 7:745–749. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Muñoz N, Hernandez-Suarez G, Méndez F, Molano M, Posso H, Moreno V, Murillo R, Ronderos M, Meijer C and Muñoz A: Instituto Nacional de Cancerología HPV Study Group: Persistence of HPV infection and risk of high-grade cervical intraepithelial neoplasia in a cohort of Colombian women. Br J Cancer. 100:1184–1190. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Min Z, Pu X and Gu Z: Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection. Oncol Lett 16: 7189-7194, 2018.
APA
Min, Z., Pu, X., & Gu, Z. (2018). Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection. Oncology Letters, 16, 7189-7194. https://doi.org/10.3892/ol.2018.9520
MLA
Min, Z., Pu, X., Gu, Z."Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection". Oncology Letters 16.6 (2018): 7189-7194.
Chicago
Min, Z., Pu, X., Gu, Z."Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection". Oncology Letters 16, no. 6 (2018): 7189-7194. https://doi.org/10.3892/ol.2018.9520
Copy and paste a formatted citation
x
Spandidos Publications style
Min Z, Pu X and Gu Z: Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection. Oncol Lett 16: 7189-7194, 2018.
APA
Min, Z., Pu, X., & Gu, Z. (2018). Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection. Oncology Letters, 16, 7189-7194. https://doi.org/10.3892/ol.2018.9520
MLA
Min, Z., Pu, X., Gu, Z."Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection". Oncology Letters 16.6 (2018): 7189-7194.
Chicago
Min, Z., Pu, X., Gu, Z."Correlative analysis of the expression of IL‑10 and Ki‑67 in human cervical cancer and cervical intraepithelial neoplasias and human papillomavirus infection". Oncology Letters 16, no. 6 (2018): 7189-7194. https://doi.org/10.3892/ol.2018.9520
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team