Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February-2019 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2019 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Case Report Open Access

ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report

  • Authors:
    • Xiaojing Xu
    • Hong Li
    • Ke Peng
    • Yiyi Yu
    • Lingli Chen
    • Yong Fang
    • Yihong Sun
    • Yingyong Hou
    • Tianshu Liu
  • View Affiliations / Copyright

    Affiliations: Department of Oncology, Zhongshan Hospital, Fudan University, Shanghai 200032, P.R. China, Department of Oncology, Jiahui International Hospital, Shanghai 200032, P.R. China, Department of Pathology, Zhongshan Hospital, Fudan University, Shanghai 200032, P.R. China, Department of General Surgery, Zhongshan Hospital, Fudan University, Shanghai 200032, P.R. China
    Copyright: © Xu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2370-2376
    |
    Published online on: December 21, 2018
       https://doi.org/10.3892/ol.2018.9865
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Epithelioid inflammatory myofibroblastic sarcoma (EIMS), a specific subtype of inflammatory myofibroblastic tumors (IMT), is a relatively rare malignant mesenchymal tumor with clinical features of positive anaplastic lymphoma kinase (ALK), high invasiveness, treatment resistance and poor prognosis. Therefore, ALK inhibitors represent specific effective drugs for patients with this type of tumor. However, acquired resistance remains inevitable without a clear mechanism of action and therapeutic strategy to counteract this. Herein, a chromosomal ALK‑G1269A mutation was identified using next‑generation sequencing (NGS) and the mutation was confirmed by Sanger sequencing in a patient with crizotinib‑resistant EIMS who benefited from treatment with the second‑generation ALK inhibitor AP26113. To the best of our knowledge, a few rare cases of crizotinib‑resistance in IMTs have been reported, and there are no reported cases in EIMS. In this article, we present the case of a patient with a secondary mutation of ALK‑G1269A in EIMS, and suggest that AP26113 (Brigatinib) may represent an ideal treatment for these patients.

Introduction

Epithelioid inflammatory myofibroblastic sarcomas (EIMSs) were first described by Mariño-Enríquez in 2011 (1), and are rare malignant mesenchymal tumors commonly identified in the lung, abdominal/pelvic cavity and retroperitoneal cavity irrespective of age (2). In contrast to the conventional spindle-cell inflammatory myofibroblastic tumors (IMTs), the characteristics of EIMSs include extensive epithelial cell infiltration pathologically and a dismal prognosis (3). Given its low incidence and inadequate recognition, standard guidelines for EIMSs are presently not available. Based on experience, surgery is the primary choice for patients with localized lesions; however, in the event of recurrence or metastasis, traditional chemotherapeutic drugs such as anthracyclines are typically ineffective (2).

Similar to 50% of IMTs, EIMSs primarily express the anaplastic lymphoma kinase (ALK) protein (1). The gene encoding ALK is located on the short arm of chromosome 2 (2p23) (https://www.ncbi.nlm.nih.gov/gene/238). The protein typically manifests as RAN-binding protein 2 (RANBP2)-ALK fusion oncoprotein with distinctive nuclear membrane localization (4). Therefore, patients expressing this fusion protein may benefit from treatment with targeted ALK inhibitors such as crizotinib (5). Crizotinib is a small molecule ALK kinase inhibitor that has been approved for use in patients with various types of ALK+ advanced cancer, such as non-small cell lung cancer (6). However, acquired resistance remains inevitable and largely limits the efficacy of crizotinib (7). Despite this limitation, the mechanism and therapeutic strategy for crizotinib-resistance in EIMSs have been rarely documented in the literature.

In the case presented herein article, a chromosomal ALK-G1269A mutation was identified in a patient with crizotinib-resistant EIMS by next generation sequencing (NGS) and Sanger sequencing. Treatment with the chemically distinct ALK inhibitor AP26113 (brigatinib) was an effective therapeutic modality in this patient, and a significant partial response was observed. The aim of the present study was to explore the resistance mechanisms and develop follow-up treatment strategies for patients with EIMSs, and to ultimately improve the symptoms and survival time of these patients.

Case report

A 28-year-old male suffering from recurrent fever, abdominal distention, night sweats and obvious fatigue since May 2016 presented at our institution in July 2018. Examination with computed tomography (CT) and magnetic resonance imaging (MRI) revealed substantial ascites and a huge caking in the abdomen and pelvis. Radical surgery was impossible due to discrete miliary nodules on the abdominal wall surface and extensive peritoneal adhesions, which were revealed by an exploratory laparotomy. Thus, a mass biopsy was performed, and the patient was diagnosed with epithelioid inflammatory myofibroblastic sarcoma composed of predominantly epithelioid cells (Fig. 1A). IHC performed as previously described (8) revealed that ALK was positive (3+) in tumor cells (Fig. 1B), whereas other indicators, including cytokeratin, smooth muscle actin, calretinin, epithelial membrane antigen and myogenin were negative (data not shown). ALK rearrangement was assessed by fluorescence in situ hybridization (FISH) using a Vysis ALK Break Apart Probe kit (Abbott Pharmaceutical Co., Ltd., Lake Bluff, IL, USA), and tests were performed according to the manufacturer's protocol (8). ALK rearrangement was defined as positive when >15% tumor cells exhibited split probe signals. Ten randomly chosen visual fields were observed on each section under microscope. The proportion of positive stained cells was ~30% (Fig. 1C). NGS suggested that RANBP2-ALK gene fusion had occurred (Fig. 1D). Following the exploratory laparotomy, the patient's condition deteriorated rapidly, with obvious abdominal distention, dyspnea, electrolyte disturbances, a high level of uric acid (800 µmol/l) and extreme fatigue. From July 2016, crizotinib (200 mg) was administered to the patient twice a day orally. In September 2016, the patient's previous clinical symptoms were significantly relieved, and the response evaluation reached a partial response (PR) according to the Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 (http://recist.eortc.org/recist-1-1-2/) (Fig. 2) with slight adverse events, such as grade 1 edema and myelosuppression according to the NCI Common Terminology Criteria version 4.0 (https://evs.nci.nih.gov/ftp1/CTCAE/). Until April 2017, the patient presented with abdominal distention, and MRI scanning confirmed the reappearance of a large amount of ascites, which was classified as progressive disease (PD). NGS, using the second aspiration biopsy specimen of the abdominal mass identified RANBP2 as fusion partner and revealed the acquisition of an ALK-G1269A mutation with a mutational abundance of 22.9% (data not shown), which was confirmed by Sanger sequencing (Fig. 3A). Primers designed were as shown in Table I. No additional mutations were detected. Treatment with AP26113 was initiated in April 2017 (90 mg daily), and the tumor-associated symptoms resolved rapidly. On July 2017, MRI scanning revealed a 50% reduction in the abdominal mass, which was classified as a partial response (Fig. 3B). The patient is currently alive.

Figure 1.

Characters of EIMS. (A) The tumor was predominantly composed of epithelioid cells (H&E ×100 magnification); (B) IHC revealed ALK positivity (3+) in tumor cells, indicating that the tumor was ALK immunopositive (H&E ×100 magnification); (C) Fluorescence in situ hybridization using break apart probes revealed ALK rearrangement in 30% tumor cells (H&E ×1,000 magnification); (D) NGS assays suggested RANBP2-ALK gene fusion. NGS, next generation sequencing; IHC immunohistochemistry; EIMS, epithelioid inflammatory myofibroblastic sarcoma; ALK, anaplastic lymphoma kinase.

Figure 2.

CT revealed a PR following treatment with crizotinib. On July 2016, computed tomography revealed massive ascites and significant caking in the abdomen and pelvis. crizotinib was administered to the patient. On October 2016, their ascites disappeared, and the response evaluation revealed a PR. Continuous PR was noted until January 2017. CT, computed tomography; PR, partial response.

Figure 3.

Assessment of resistance mutation. (A) Sanger sequencing confirmed the ALK point mutation G1269A in the crizotinib-resistant tumor tissue (No. 2). Specifically, base G was changed to C at position 3806 of the ALK gene, and the coded amino acid of was the changed from glycine to alanine. (B) On April 2017, MRI scanning confirmed the presence of a large number of ascites, this was classified as progressive disease (PD). Following the administration of AP26113, MRI scanning revealed a 50% reduction, which was classified as a partial response again on July 2017. MRI, magnetic resonance imaging.

Table I.

Sequences for Sanger test.

Table I.

Sequences for Sanger test.

PrimerSequence (5′-3′)Template strandLengthStartStopTemperatureGC%Self complementaritySelf 3′ complementarity
Forward TAAGGCTGTTTCTCTCACACPlus2021323255.0245.003.000.00
Reverse CCATAGCCTGAAAAGGAACTMinus2061559655.0245.003.001.00
Product length, base pairs403

Discussion

Herein, we identified a chromosomal ALK-G1269A mutation in a rare and special case of a patient with EIMS who responded to treatment with AP26113, following the failure of crizotinib. Given the rarity of EIMSs, no large, well-powered clinical trials are available, with only ~40 cases being reported to date. In 2016, Yu et al (2) reviewed the clinical characteristics and pathological features of 25 cases of EIMS. The present study summarized an additional 18 cases of EIMS reported since 2016 (Table II). From these reports, certain factors, including age, sex, tumor location, tumor size, proliferation index, mitosis and necrosis degree, were not associated with clinical progression. However, positive ALK expression was closely associated with recurrence or metastasis. The positive rate of ALK rearrangements is presently unknown in EIMSs. However, according to the reported cases, several ALK fusion proteins, including RNA binding protein 2 (RANBP2)-ALK, tropomyosin 3 (TPM3)-ALK, TRK-fused Gene (TFG)-ALK and ribosome binding protein 1 (RRBP1)-ALK, were identified in EIMS (Table II). RANBP2-ALK fusion oncoproteins exhibit distinctive nuclear membrane localization, indicating that they may be sensitive to targeted kinase inhibitors, such as crizotinib (3,9–11). In the present case, the young male was diagnosed with EIMS characterized with predominant epithelioid cells and ALK positivity via immunohistochemistry. In addition, FISH using break apart probes revealed ALK rearrangement, and the NGS assay suggested that RANBP2-ALK gene fusion had occurred. These findings are consistent with the diagnostic criteria of EIMS.

Table II.

Clinical features of 18 cases of EIMS since 2016.

Table II.

Clinical features of 18 cases of EIMS since 2016.

Age/sexSiteALK rearrangementFusion typeCrizotinibFollow up (months)Reference
15/FOvary+RANBP2-ALKYesNDI9
42/MAbdominal cavity+RANBP2-ALKYesRecurred at 8 m, AWD at 40 m
10/FAbdominal cavity+TFG-ALKNoANED at 81 m
34/MLiver+RANBP2-ALKNoDOD at 5 m
62/MAbdominal cavity+RRBP1-ALKNoDOD at 2 m
14/MPelvis+TPM3-ALKNoDOD at 3 m10
76/FAbdominal cavity+RANBP2-ALKNoDOD at 4 m
30/MAbdominal cavity+NDNoDOD at 8 m
26/MAbdominal cavity+RRBP1-ALKNoRecurred at 7 and 16 m, AWD at 16 m
39/FAbdominal cavity+RRBP1-ALKNoRecurred and AWD at 10 m
7/MAbdominal cavity+ RRBP1-ALK-negativeNoDOD at 36 m
16/FLung+ RRBP1-ALK-negativeYesRecurred at 1 m, AWD at 48 m
52/FSmall bowel mesentery+NDNoDOD at 8 m11
37/FRectum+NDNoANED at 8 m2
55/MMesentery of ileum+NDNoANED AT 10 m
22/MMesentery of colon+NDYesRecurred at 2 m, AWD at 14 m
58/FOmentum+NDNoRecurred at 2 m, DOD at 8 m
15/FTransverse colon+NDNoANED at 7 m

[i] AWD, alive with disease; ANED, alive with no evidence of disease; DOD, died of disease; ND, not determined; ALK, anaplastic lymphoma kinase; RNA binding protein 2 (RANBP2)-ALK, tropomyosin 3 (TPM3)-ALK, TRK-fused gene (TFG)-ALK, and ribosome binding protein 1 (RRBP1)-ALK; m, months.

Crizotinib has a significant effect in EIMS patients with ALK-rearrangement; however, it is difficult to avoid acquired resistance. In the present case report, the patient with EIMS was resistant to crizotinib after 9 months. Secondary NGS detection revealed an ALK point mutation G1269A in addition to RANBP2-ALK fusion, suggesting that the base G was changed to C at position 3806 of the ALK gene. Consequently, the coded amino acid was changed from glycine to alanine at position 1269, which was located at the end of the adenosine triphosphate (ATP) binding pocket. The steric hindrance effect of the mutation affects ALK protein binding to oxazolidine, therefore ALK G1269A is an acquired resistance mutation in EIMS. However, only a few cases describing the mechanisms of crizotinib-resistance have been reported in IMTs and even fewer in EIMSs, as summarized in Table III (12–14).

Table III.

ALK crizotinib-resistance reported in IMTs or EIMSs.

Table III.

ALK crizotinib-resistance reported in IMTs or EIMSs.

CaseAge/sexSiteDiseaseALK fusionTreatment 1Follow Up 1Secondary mutationTreatment 2Follow Up 2(Refs.)
1NANAIMTRANBP2-ALKCrizotinibNAF1174LHigh dosage of crizotinib;In vitro (effective)14
TAE684
232/MLungIMTTPM3-ALKCrizotinibPFS(8m)Numerous genesCeritinibAWD (8 m); ANED (18 m)12
336/FLungIMTDCTN1-ALKCrizotinibPFS(29m)G1269ACeritinibPFS (3 m)13
Oncology, 2017
428/MAbdomenEIMSRANBP2-ALKCrizotinibPFS(9m)ALK-G1269AAP26113AWD at 8 mPresent study

[i] AWD, alive with disease; ANED, alive with no evidence of disease; PFS, progression-free survival; NA, not available; EIMS, epithelioid inflammatory myofibroblastic sarcoma; ALK, anaplastic lymphoma kinase; IMT, inflammatory myofibroblastic tumor; m, months.

In addition to G1269A, other secondary mutations, such as L1152R, C1156Y, F1174L, L1196M, G1202R and S1206Y, were also identified in vitro, xenograft models or patients with ALK-rearranged tumors, such as non-small-cell lung cancers (7). These patients were sensitive to high dosages of crizotinib or second-generation ALK inhibitors, such as ceritinib and alectinib (15,16). In the present article, AP26113 was still effective in the patient with crizotinib resistance. AP26113 is also a second-generation ALK inhibitor with a double inhibitory effect on ALK and EGFR (17). Similar to crizotinib, AP26113 could relieve the clinical symptoms of the patient, without obvious side effects. Thus, the quality of life of this patient was greatly improved. Previously, certain novel agents, such as heat shock protein (HSP) 90 inhibitors, have been demonstrated to be effective in overcoming crizotinib-resistance in preclinical models and Phase I–II studies (14). With a deeper understanding of EIMS, more molecular mechanisms and potential treatments will be available in the future.

Acknowledgements

The authors would like to thank Ms. Huiyan Li from the institute of Precision Medicine, 3D Medicines Inc. (Shanghai, China) for their excellent technical assistance with NGS and Sanger sequencing.

Funding

The present study was supported by the National Nature Science Foundation of China (grant no. 81502003) and the Shanghai Committee of Science and Technology (grant nos. 14ZR1406500 and 15411961900).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XX, YY and TL conceived and designed the study. XX, HL and KP performed the experiments. LC and YH provided the FISH results. YF and YS performed the operation on the patient. XX wrote the paper. YY and TL reviewed and edited the manuscript. All authors read and approved the manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Zhongshan Hospital Affiliated to Fudan University (Shanghai, China). The research involved one patient and their tissues, and informed consent for use of their clinical images and tissues was obtained from the patient.

Patient consent for publication

Identifying information, including names, initials, date of birth or hospital numbers, images or statements were not included in the manuscript. And the patient has provided written informed consent for publication.

Competing interests

The authors have declared that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

EIMS

epithelioid inflammatory myofibroblastic sarcoma

ALK

anaplastic lymphoma kinase

IMT

inflammatory myofibroblastic tumor

NGS

next-generation sequencing

H&E

hematoxylin and eosin

FFPE

formalin fixed paraffin embedded

PCR

polymerase chain reaction

IHC

immunohistochemistry

RECIST

Response Evaluation Criteria in Solid Tumors

PR

partial response

PD

progressive disease

References

1 

Mariño-Enríquez A, Wang WL, Roy A, Lopez-Terrada D, Lazar AJ, Fletcher CD, Coffin CM and Hornick JL: Epithelioid inflammatory myofibroblastic sarcoma: An aggressive intra-abdominal variant of inflammatory myofibroblastic tumor with nuclear membrane or perinuclear ALK. Am J Surg Pathol. 35:135–144. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Yu L, Liu J, Lao IW, Luo Z and Wang J: Epithelioid inflammatory myofibroblastic sarcoma: A clinicopathological, immunohistochemical and molecular cytogenetic analysis of five additional cases and review of the literature. Diagn Pathol. 11:672016. View Article : Google Scholar : PubMed/NCBI

3 

Liu Q, Kan Y, Zhao Y, He H and Kong L: Epithelioid inflammatory myofibroblastic sarcoma treated with ALK inhibitor: A case report and review of literature. Int J Clin Exp Pathol. 8:15328–15332. 2015.PubMed/NCBI

4 

Kruczynski A, Delsol G, Laurent C, Brousset P and Lamant L: Anaplastic lymphoma kinase as a therapeutic target. Expert Opin Ther Targets. 16:1127–1138. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Kimbara S, Takeda K, Fukushima H, Inoue T, Okada H, Shibata Y, Katsushima U, Tsuya A, Tokunaga S, Daga H, et al: A case report of epithelioid inflammatory myofibroblastic sarcoma with RANBP2-ALK fusion gene treated with the ALK inhibitor, crizotinib. Jpn J Clin Oncol. 44:868–871. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Heigener DF and Reck M: Crizotinib. Recent Results Cancer Res. 211:57–65. 2018. View Article : Google Scholar : PubMed/NCBI

7 

Voena C and Chiarle R: The battle against ALK resistance: Successes and setbacks. Expert Opin Investig Drugs. 21:1751–1754. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Su D, Zhang D, Chen K, Lu J, Wu J, Cao X, Ying L, Jin Q, Ye Y, Xie Z, et al: High performance of targeted next generation sequencing on variance detection in clinical tumor specimens in comparison with current conventional methods. J Exp Clin Cancer Res. 36:1212017. View Article : Google Scholar : PubMed/NCBI

9 

Fang H, Langstraat CL, Visscher DW, Folpe AL and Schoolmeester JK: Epithelioid inflammatory myofibroblastic sarcoma of the ovary with RANB2-ALK fusion: Report of a case. Int J Gynecol Pathol. 37:468–472. 2018.PubMed/NCBI

10 

Lee JC, Li CF, Huang HY, Zhu MJ, Mariño-Enríquez A, Lee CT, Ou WB, Hornick JL and Fletcher JA: ALK oncoproteins in atypical inflammatory myofibroblastic tumours: Novel RRBP1-ALK fusions in epithelioid inflammatory myofibroblastic sarcoma. J Pathol. 241:316–323. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Fang N, Yang QJ, Deng YT, Feng X, Xia HS, Zhang YG, Wang MW, Wu D, Zhou H and Guo F: Epithelioid inflammatory myofibroblastic sarcoma of small bowel mesentery: Report of a case. Zhonghua Bing Li Xue Za Zhi. 46:201–202. 2017.(In Chinese). PubMed/NCBI

12 

Mansfield AS, Murphy SJ, Harris FR, Robinson SI, Marks RS, Johnson SH, Smadbeck JB, Halling GC, Yi ES, Wigle D, et al: Chromoplectic TPM3-ALK rearrangement in a patient with inflammatory myofibroblastic tumor who responded to ceritinib after progression on crizotinib. Ann Oncol. 27:2111–2117. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Michels SYF, Scheel AH, Wündisch T, Heuckmann JM, Menon R, Puesken M, Kobe C, Pasternack H, Heydt C, Scheffler M, et al: ALKG1269A mutation as a potential mechanism of acquired resistance to crizotinib in an ALK-rearranged inflammatory myofibroblastic tumor. NPJ Precis Oncol. 1:42017. View Article : Google Scholar : PubMed/NCBI

14 

Sasaki T, Okuda K, Zheng W, Butrynski J, Capelletti M, Wang L, Gray NS, Wilner K, Christensen JG, Demetri G, et al: The neuroblastoma-associated F1174L ALK mutation causes resistance to an ALK kinase inhibitor in ALK-translocated cancers. Cancer Res. 70:10038–10043. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Nishio M, Murakami H, Horiike A, Takahashi T, Hirai F, Suenaga N, Tajima T, Tokushige K, Ishii M, Boral A, et al: Phase I study of ceritinib (ldk378) in Japanese patients with Advanced, Anaplastic lymphoma kinase-rearranged non-small-cell lung cancer or other tumors. J Thorac Oncol. 10:1058–1066. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Katayama R, Lovly CM and Shaw AT: Therapeutic targeting of anaplastic lymphoma kinase in lung cancer: A paradigm for precision cancer medicine. Clin Cancer Res. 21:2227–2235. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Huang WS, Liu S, Zou D, Thomas M, Wang Y, Zhou T, Romero J, Kohlmann A, Li F, Qi J, et al: Discovery of brigatinib (AP26113), a phosphine oxide-containing, potent, orally active inhibitor of anaplastic lymphoma kinase. J Med Chem. 59:4948–4964. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu X, Li H, Peng K, Yu Y, Chen L, Fang Y, Sun Y, Hou Y and Liu T: ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report. Oncol Lett 17: 2370-2376, 2019.
APA
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y. ... Liu, T. (2019). ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report. Oncology Letters, 17, 2370-2376. https://doi.org/10.3892/ol.2018.9865
MLA
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y., Sun, Y., Hou, Y., Liu, T."ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report". Oncology Letters 17.2 (2019): 2370-2376.
Chicago
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y., Sun, Y., Hou, Y., Liu, T."ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report". Oncology Letters 17, no. 2 (2019): 2370-2376. https://doi.org/10.3892/ol.2018.9865
Copy and paste a formatted citation
x
Spandidos Publications style
Xu X, Li H, Peng K, Yu Y, Chen L, Fang Y, Sun Y, Hou Y and Liu T: ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report. Oncol Lett 17: 2370-2376, 2019.
APA
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y. ... Liu, T. (2019). ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report. Oncology Letters, 17, 2370-2376. https://doi.org/10.3892/ol.2018.9865
MLA
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y., Sun, Y., Hou, Y., Liu, T."ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report". Oncology Letters 17.2 (2019): 2370-2376.
Chicago
Xu, X., Li, H., Peng, K., Yu, Y., Chen, L., Fang, Y., Sun, Y., Hou, Y., Liu, T."ALK‑G1269A mutation in epithelioid inflammatory myofibroblastic sarcoma after progression on crizotinib: A case report". Oncology Letters 17, no. 2 (2019): 2370-2376. https://doi.org/10.3892/ol.2018.9865
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team