International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Regucalcin (RGN), a calcium binding protein with a molecular weight of 33 kDa, was first isolated by Japanese scientists from the rat liver in the 1980s (1–4). RGN serves a principal role in the maintenance of intracellular calcium homeostasis and liver metabolism. It also influences the activities of numerous enzymes including pyruvate kinase, succinate kinase, glycogen phosphorylase and adenosine (5–8). Since the 1990s, numerous studies have reported an association between RGN and carcinoma, where the upregulation of RGN expression in various cancer types inhibited tumor growth and metastasis. A previous study demonstrated that the downregulation of RGN expression using the RNAi technique significantly enhanced the proliferation and migration capacities of HepG2 cells (9).
Cervical cancer (CC) is a common tumor, which has a high rate of morbidity and mortality in developing countries (10). According to the global cancer statistics in 2018, incidence and mortality rates of cervical cancer in women worldwide are 6.6 and 7.5%, respectively (11). Cervical adenocarcinoma (CA) is a unique type of cervical cancer with an increasing rate of morbidity, even in young people (12,13). Furthermore, the rate of ovarian metastasis in CA is high compared with that of squamous carcinoma, while its sensitivity to radiotherapy and chemotherapy is significantly lower (14–16). Gene therapy is becoming one of the potential therapeutic strategies for cervical cancer due to its safety and specificity (17). In the present study, exogenous RGN was transfected into HeLa cells, a human papillomavirus-associated endocervical adenocarcinoma cell line, to analyze the effect of RGN in CA, and to determine the signaling proteins involved.
The clinical data for RGN expression in cervical and endocervical cancers (CESC) was derived from The Cancer Genome Atlas (TCGA) database (https://tcga-data.nci.nih.gov/tcga). RGN expression was analyzed in six aspects: principal cancer stage, individual cancer stage, patient's race, weight, age and histological subtype.
HeLa cells were obtained from the Chinese Academy of Sciences (Beijing, China). A lentiviral vector encoding RGN-cDNA was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The cDNA sequence was as follows: ATGTCTTCCATTAAGATTGAGTGTGTTTTGCCAGAGAACTGCCGGTGTGGTGAGTCTCCAGTATGGGAGGAAGTGTCCAACTCTCTGCTCTTTGTAGACATTCCTGCAAAAAAGGTTTGCCGGTGGGATTCATTCACCAAGCAAGTACAGCGAGTGACCATGGATGCCCCAGTCAGCTCCGTGGCTCTTCGCCAGTCGGGAGGCTATGTTGCCACCATTGGAACAAAGTTCTGTGCTTTGAACTGGAAAGAACAATCAGCAGTTGTCTTGGCCACGGTGGATAACGACAAGAAAAACAATCGCTTCAATGATGGGAAGGTGGATCCCGCCGGGAGGTACTTTGCTGGCACCATGGCTGAGGAAACAGCTCCAGCAGTTCTTGAGCGGCACCAGGGGGCCCTGTACTCCCTCTTTCCTGATCACCACGTGAAAAAGTACTTTGACCAGGTGGACATTTCCAATGGTTTGGATTGGTCGCTAGACCACAAAATCTTCTATTACATTGACAGCCTGTCCTACTCCGTGGATGCCTTTGACTATGACCTGCAGACAGGACAGATCTCCAACCGCAGAAGTGTTTACAAGCTAGAAAAGGAAGAACAAATCCCAGATGGAATGTGTATTGATGCTGAGGGGAAGCTCTGGGTGGCCTGTTACAATGGAGGAAGAGTGATTCGTTTAGATCCTGTGACAGGGAAAAGACTTCAAACTGTGAAGTTGCCTGTTGATAAAACAACTTCATGCTGCTTTGGAGGGAAGAATTACTCTGAAATGTATGTGACCTGCGCCCGGGATGGGATGGACCCCGAGGGTCTTTTGAGGCAACCTGAAGCTGGTGGAATTTTCAAGATAACTGGTCTGGGGGTCAAAGGAATTGCTCCCTACTCCTATGCGGGATGA. HeLa cells were maintained in Dulbecco's modified Eagle's medium (DMEM; HyClone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA). To produce a cell line that highly expressed RGN, 5×105 cells/well were incubated overnight in a 6-well plate, and the RGN lentiviral or empty vectors were added (multiplicity of infection, 20). Following a 24 h infection period, the cells were treated with puromycin (2 µg/ml) for 72 h to screen for positive clones. Successfully infected cells were verified by the positive expression of green fluorescent protein.
The expression of RGN mRNA was determined using the PrimeScript™ RT reagent kit and the SYBR Premix Ex Taq™ II kit (Takara Bio, Inc., Otsu, Japan). All steps were performed according to the manufacturer's protocols. Primer sequences were as follows: RGN forward, 5′-GTGGATGCCTTTGACTATGACC-3′, and reverse, 5′-CTTCCCCTCAGCATCAATACAC-3′; GAPDH forward, 5′-CGAGATCCTCAACCAATCAA-3′, and reverse 5′-GGTGGTCCAGGGTCGTTACT-3′. PCR reaction conditions were as follows: 20 sec at 95°C, 30 sec at 60°C and 30 sec at 72°C, repeated for 40 cycles. The 2−ΔΔCq method was used to analyze mRNA expression (18).
RGN-transfected and empty vector control cells cultured in 25 cm2 culture flasks were lysed using 500 µl RIPA lysate supplemented with 1 mM PMSF. The protein concentrations were determined using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology, Haimen, China) and 30 µg total protein/lane was separated using SDS-PAGE (separation gel, 12%; spacer gel, 5%). The separated proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA), blocked with 5% non-fat milk and incubated with the following primary antibodies overnight at 4°C: RGN (1:1,000; cat. no. 17947-1-AP; ProteinTech Group, Inc., Chicago, IL, USA), β-catenin (1:1,000; cat. no. 51067-2-AP; ProteinTech Group, Inc.), p-glycogen synthase kinase (GSK)-3β (1:1,000; cat. no. ab75814; Abcam, Cambridge, UK), GSK-3β (1:1,000; cat. no. 22104-1-AP; ProteinTech Group, Inc.), matrix metalloproteinase (MMP)-3 (1:1,000; cat. no. 17873-1-AP; ProteinTech Group, Inc.), MMP-7 (1:800; cat. no. 10374-2-AP; ProteinTech Group, Inc.), MMP-9 (1:800; cat. no. 10375-2-AP; ProteinTech Group, Inc.), E-cadherin (1:1,000; cat. no. 20874-1-AP; ProteinTech Group, Inc.), N-cadherin (1:1,000; cat. no. 22018-1-AP; ProteinTech Group, Inc.), Vimentin (1:1,000; cat. no. 10366-1-AP; ProteinTech Group, Inc.) and GAPDH (1:1,000; cat. no. 10494-1-AP; ProteinTech Group, Inc.). GAPDH was selected as internal reference. The membranes were washed with TBS + 0.1% Tween-20 (TBST) three times for 5 min and subsequently incubated with secondary goat anti-rabbit IgG-HRP (1:5,000; cat. no. E-AB-1003; Elabscience Biotechnology Co., Ltd., Wuhan, China) for 1 h at 37°C. The membranes were washed with TBST three times for 10 min. Enhanced chemiluminescence ultra-sensitive luminescence solution (Applygen, Beijing, China) was used to develop the bands. Densitometry was performed using ImageJ v1.48 software (National Institutes of Health, Bethesda, MD, USA).
800 µl/well DMEM with 10% FBS was added to a 24-well plate prior to the addition of Transwell inserts. HeLa cells (3×104) were resuspended in 200 µl DMEM and loaded into the upper chamber. Following a 24 h incubation period in 37°C, the membranes were fixed with 4% paraformaldehyde for 15 min at room temperature (RT) and stained with 0.1% crystal violet for 10 min at RT. The cells on the inner surface of membrane were removed by a cotton swab, whereas those on the outer surface were counted by an optical microscope (magnification, ×400; Olympus Corporation, Tokyo, Japan) in five random fields.
Cellular invasive capacity was analyzed using a Matrigel assay. Matrigel (BD Biosciences; Becton, Dickinson and Company, Franklin, Lakes, NJ, USA) was diluted with DMEM at a ratio of 1:9 and added to the upper chamber. Once the gel had set, 800 µl DMEM with 10% FBS was added to 24-well plates, and 3×104 cells were inserted into the chamber. The cells were incubated at 37°C for 24 h, fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet for 10 min at RT. The cells on the inner surface of membrane were removed, whereas those on the outer surface were counted using an optical microscope (magnification, ×400) in five random fields.
HeLa cells were cultured in 96-well plates (3×103 cells/well) for 24, 48, 72 and 96 h. The culture medium was removed and 100 µl DMEM with 10% FBS and 10 µl Cell Counting Kit-8 assay buffer (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to each well. Following a 4-h incubation period, the absorbance was determined at 450 nm. The experiment was performed in triplicate.
A total of 500 cells/well were seeded into 6-well plates and gently dispersed by agitation. The cells were cultured at 37°C with 5% CO2 for 14 days with frequent observation. The culture medium was discarded as soon as colonies were visible, and the wells were gently washed twice with PBS. The cells were subsequently fixed and stained with 0.1% crystal violet for 10 min at RT. The samples were gently washed with water and allowed to dry naturally, prior to the colonies being photographed and counted.
Cell cycle analysis was conducted using a cell cycle detection kit (Vazyme Piscataway, NJ, USA). 2×106 HeLa cells were washed and fixed with ice-cold ethanol (70%) for 8 h at 4°C. The cells were centrifuged at 300 × g for 5 min at 4°C, resuspended in 400 µl PBS supplemented with 20 µl RNase A solution, and incubated in a water bath at 37°C for 1.5 h. Subsequently, 400 µl PI Staining Solution (Beyotime Institute of Biotechnology, Shanghai, China) was added, and the cells were incubated at 4°C for 0.5 h prior to flow cytometric analysis using a flow cytometer (FACScalibur; Becton Dickinson, Cockeysville, MD, USA) and CellQuest software (Becton Dickinson).
The data are described as the mean ± standard deviation. The experiments were performed in triplicate. Student's t-test and one-way ANOVA were used to analyze the experimental results and bioinformatics analysis. Student-Newman-Keuls post hoc test was used for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.
Based on clinical information in TCGA, it was revealed that the expression of RGN in CESC tissues was reduced compared with those of normal tissues (Fig. 1A), though this was not associated with individual cancer stage, patient's race, patient's weight, patient's age or histological subtype (Fig. 1B-F).
HeLa cells were infected with lentivirus-mediated RGN or empty lentivirus. The expression levels of RGN mRNA in RGN transfectants was significantly increased compared with those transfected with the empty vector (Fig. 2A; P<0.001). RGN protein expression level in the RGN transfectants was also increased significantly compared with the controls (Fig. 2B; P<0.001). The results indicated that HeLa cells that highly express RGN were successfully produced.
The expression levels of β-catenin, p-GSK-3β, GSK-3β, MMP-3, MMP-7, MMP-9, E-cadherin, N-cadherin and vimentin were measured using western blotting. The expression levels of β-catenin, p-GSK-3β, MMP-3, MMP-7 and MMP-9 in RGN transfectants was markedly downregulated, whilst E-cadherin and GSK-3β expression was upregulated (Fig. 3A). There was no significant change in the expression levels of N-cadherin and vimentin. The ratio of phosphorylated/total GSK-3β is displayed in Fig. 3B, and reveals that the average ratio of phosphorylated/total GSK-3β in the controls was higher compared with that of the HeLa-RGN cell line. The aforementioned results indicate that exogenous RGN may effectively inhibit the Wnt/β-catenin pathway and subsequent epithelial-mesenchymal transition (EMT).
Transwell and Matrigel assays were used to evaluate the migration and invasion abilities of HeLa cells, respectively. Fig. 4A illustrates that the migration ability of HeLa cells was significantly depressed by RGN (number of migrated cells: 385.67±35.02 vs. 276.33±13.32, P<0.01), and Fig. 4B reveals that invasiveness was also depressed in RGN transfectants (number of invaded cells: 348.33±20.48 vs. 157.00±9.14, P<0.01). The aforementioned results suggest that RGN overexpression may have the ability to inhibit tumor cell metastasis.
Cell growth was analyzed using the CCK-8 assay. Fig. 5A demonstrates that compared with the control group, the proliferation rate of the RGN transfectants was significantly lower at 72 h (P<0.001). Cell proliferation was analyzed using a colony formation assay. Following 14 days of incubation, cell colonies formed of RGN transfectants were lower in number compared with those of the empty vector controls (P<0.01; Fig. 5B). The experimental results revealed that RGN effectively inhibits HeLa cell proliferation.
Flow cytometry was used to compare the distribution of RGN transfectants and control cells between the cell cycle phases. The number of diploid HeLa-RGN cells in the G2/M phase was greater compared with those in the control group (Fig. 6A). The proportion of RGN transfectants in the G2/M phase was higher compared with that of the empty vector transfectants (P<0.01, Fig. 6B), which suggests that RGN may depress tumor growth by retarding the cell cycle at the G2/M phase.
In the present study, lentivirus-mediated RGN was successfully transfected into HeLa cells, which markedly reduced cellular proliferation, migration and invasion. The effect of exogenous RGN expression on specific signaling pathways was analyzed using western blotting. The expression of β-catenin, p-GSK-3β, MMP-3, MMP-7 and MMP-9 was downregulated, whilst E-cadherin and GSK-3β expression was upregulated in cells overexpressing RGN. The results suggest that RGN may regulate proliferation and metastasis of HeLa cells by blocking the activation of the Wnt/β-catenin signaling pathway and EMT.
The inhibitory effects of RGN on cancer cell proliferation and metastasis have been reported in a number of studies. It has been demonstrated that RGN depresses H4-II-E cell proliferation by attenuating DNA synthesis, suppressing the activity of Ca2+/calmodulin-dependent protein kinase, protein kinase C and protein tyrosine kinase, or by altering the mRNA expression of various intracellular signaling-associated factors, including p21 and Insulin-like growth factor 1 (19–23).
Proliferation may also be inhibited when transferring exogenous RGN into lung cancer cells, or by incubating pancreatic cancer cells with RGN-supplemented media (24,25). It was also demonstrated that RGN transgenic rats possessed a lower propensity for breast cancer, in addition to lower cellular proliferation and metastasis rates (26,27). More recently, Yamaguchi et al (28) reported that the overexpression of RGN in the colorectal adenocarcinoma cancer cell line, RKO, suppressed proliferation and induced cell cycle arrest at the G1 and G2/M phases. The results of the present study revealed that the proliferation, migration and invasion abilities of RGN transfectants were significantly inhibited. Yamaguchi et al (24,28,29) also demonstrated that RGN promoted cell cycle arrest at the G1 and G2/M phases in A549, HepG2 and RKO cells. The present study on HeLa cells revealed that RGN halted the cell cycle at the G2/M phase, but not at the G1 phase. This suggests that the influence of RGN on the cell cycle varies between cell types.
Numerous studies have demonstrated that RGN is associated with various signaling pathways, including the nuclear factor-κB, Akt, mitogen-activated protein kinase and stress-activated protein kinases/Jun amino-terminal kinases pathways (29,30). The overexpression of RGN suppressed the expression of multiple oncogenes including K-ras, Ha-ras, c-fos, c-jun, c-myc and chk,2, or enhanced the expression of certain anti-oncogenes including p53 and Rb (28,31,32). The Wnt/β-catenin signaling pathway, which is associated with cell proliferation and metastasis, is involved in cervical carcinogenesis (33,34). Wnt signaling is activated by the Frizzled family of transmembrane receptors; Wnt binding promotes the binding of β-catenin and T-cell factor/lymphoid enhancer factors in the cytosol, and their subsequent nuclear translocation; this results in the activation of target genes, including the MMPs (35–37). Prior to Wnt signaling activation, β-catenin is sequestered by E-cadherin in the cytoplasm. When β-catenin translocates to the nucleus, E-cadherin expression decreases, a phenomenon associated with EMT. During EMT, the expression of E-cadherin decreases significantly, while the expression of N-cadherin and vimentin increases (38–40). Additionally, the enhancement of GSK-3β activity results in the ubiquitination, and subsequent phosphorylation and degradation β-catenin (41). In the present study, β-catenin, p-GSK-3β, MMP-3, MMP-7 and MMP-9 expression were downregulated, while E-cadherin and GSK-3β expression were upregulated in RGN transfectants, indicating that exogenous RGN expression may inhibit the activation of Wnt/β-catenin signaling, enhance cell adhesion and alter cell morphology to an epithelial phenotype.
In conclusion, the present study may suggest that RGN is a protective factor in CA. Though the association between RGN, Wnt/β-catenin and EMT requires further investigation.
Not applicable.
The present study was supported by the National Natural Science Foundation of China (grant no. 81460432, 81572994); Guangxi Nature Science Foundation (grant nos. 2015GXNSFDA139017, 2015GXNSFBA139155 and 2017GXNSFAA198063); Guangxi Science and Technology Research and Technology Development Project (grant no. 15104001-7); Guangxi Nanning Qingxiu District Science and Technology Research and Technology Development Project (grant no. 2014S03) and the Open Fund of Guangxi Key Laboratory of Biological Targeting Diagnosis and Therapy Research (grant no. KFJJ2014-03).
All data generated or analyzed during the present study are included in this publication.
SZ and XL conceived the study. XL and YH were major contributors in writing the manuscript. SZ, XL, YH, SG, MX, XB, MS, AC, SC, FW and QH performed the experiments and data analysis. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Yamaguchi M and Sugii K: Properties of calcium-binding protein isolated from the soluble fraction of normal rat liver. Chem Pharm Bull (Tokyo). 29:567–570. 1981. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Yoshida H: Regulatory effect of calcium-binding protein isolated from rat liver cytosol on activation of fructose 1,6-diphosphatase by Ca2+-calmodulin. Chem Pharm Bull (Tokyo). 33:4489–4493. 1985. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Mori S: Effect of Ca2+ and Zn2+ on 5′-nucleotidase activity in rat liver plasma membranes: Hepatic calcium-binding protein (regucalcin) reverses the Ca2+ effect. Chem Pharm Bull (Tokyo). 36:321–325. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M, Mori S and Suketa Y: Effects of Ca2+ and V5+ on glucose-6-phosphatase activity in rat liver microsomes: The Ca2+ effect is reversed by regucalcin. Chem Pharm Bull (Tokyo). 37:388–390. 1989. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Shibano H: Effect of calcium-binding protein on the activation of phosphorylase a in rat hepatic particulate glycogen by Ca2+. Chem Pharm Bull (Tokyo). 35:2581–2584. 1987. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Shibano H: Calcium-binding protein isolated from rat liver cytosol reverses activation of pyruvate kinase by Ca2+. Chem Pharm Bull (Tokyo). 35:2025–2029. 1987. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Shibano H: Reversible effect of calcium-binding protein on the Ca2+-induced activation of succinate dehydrogenase in rat liver mitochondria. Chem Pharm Bull (Tokyo). 35:3766–3700. 1987. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M, Mori S and Kato S: Calcium-binding protein regucalcin is an activator of (Ca2+-Mg2+)-adenosine triphosphatase in the plasma membranes of rat liver. Chem Pharm Bull (Tokyo). 36:3532–3539. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang SC, Liang MK, Huang GL, Jiang K, Zhou SF and Zhao S: Inhibition of SMP30 gene expression influences the biological characteristics of human Hep G2 cells. Asian Pac J Cancer Prev. 15:1193–1196. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Denny L: Cervical cancer: Prevention and treatment. Discov Med. 14:125–131. 2012.PubMed/NCBI | |
|
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Smith HO, Tiffany MF, Qualls CR and Key CR: The rising incidence of adenocarcinoma relative to squamous cell carcinoma of the uterine cervix in the United States-a 24-year population-based study. Gynecol Oncol. 78:97–105. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Galic V, Herzog TJ, Lewin SN, Neugut AI, Burke WM, Lu YS, Hershman DL and Wright JD: Prognostic significance of adenocarcinoma histology in women with cervical cancer. Gynecol Oncol. 125:287–291. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Shimada M, Kigawa J, Nishimura R, Yamaguchi S, Kuzuya K, Nakanishi T, Suzuki M, Kita T, Iwasaka T and Terakawa N: Ovarian metastasis in carcinoma of the uterine cervix. Gynecol Oncol. 101:234–237. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Huang YT, Wang CC, Tsai CS, Lai CH, Chang TC, Chou HH, Hsueh S, Chen CK, Lee SP and Hong JH: Long-term outcome and prognostic factors for adenocarcinoma/adenosquamous carcinoma of cervix after definitive radiotherapy. Int J Radiat Oncol Biol Phy. 80:429–436. 2011. View Article : Google Scholar | |
|
Katanyoo K, Tangjitgamol S, Chongthanakorn M, Tantivatana T, Manusirivithaya S, Rongsriyam K and Cholpaisal A: Treatment outcomes of concurrent weekly carboplatin with radiation therapy in locally advanced cervical cancer patients. Gynecol Oncol. 123:571–576. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Yee GP, de Souza P and Khachigian LM: Current and potential treatments for cervical cancer. Curr Cancer Drug Targets. 13:205–220. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonák J, Lind K, Sindelka R, Sjöback R, Sjögreen B, Strömbom L, et al: The real-time polymerase chain reaction. Mol Aspects Med. 27:95–125. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Inagaki S and Yamaguchi M: Suppressive role of endogenous regucalcin in the enhancement of protein kinase activity with proliferation of cloned rat hepatoma cells (H4-II-E). J Cell Biochem Suppl. 36 (Suppl):S12–S18. 2001. View Article : Google Scholar | |
|
Inagaki S and Yamaguchi M: Regulatory role of endogenous regucalcin in the enhancement of nuclear deoxyribonuleic acid synthesis with proliferation of cloned rat hepatoma cells (H4-II-E). J Cell Biochem. 82:704–711. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Misawa H, Inagaki S and Yamaguchi M: Suppression of cell proliferation and deoxyribonucleic acid synthesis in the cloned rat hepatoma H4-II-E cells overexpressing regucalcin. J Cell Biochem. 84:143–149. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Daimon Y: Overexpression of regucalcin suppresses cell proliferation in cloned rat hepatoma H4-II-E cells: Involvement of intracellular signaling factors and cell cycle-related genes. J Cell Biochem. 95:1169–1177. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M: Role of regucalcin in maintaining cell homeostasis and function (review). Int J Mol Med. 15:371–389. 2005.PubMed/NCBI | |
|
Yamaguchi M, Osuka S, Shoji M, Weitzmann MN and Murata T: Survival of lung cancer patients is prolonged with higher regucalcin gene expression: Suppressed proliferation of lung adenocarcinoma A549 cells in vitro. Mol Cell Biochem. 430:37–46. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M and Murata T: Suppressive effects of exogenous regucalcin on the proliferation of human pancreatic cancer MIA PaCa-2 cells in vitro. Int J Mol Med. 35:1773–1778. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Marques R, Vaz CV, Maia CJ, Gomes M, Gama A, Alves G, Santos CR, Schmitt F and Socorro S: Histopathological and in vivo evidence of regucalcin as a protective molecule in mammary gland carcinogenesis. Exp Cell Res. 330:325–335. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Maia C, Santos C, Schmitt F and Socorro S: Regucalcin is under-expressed in human breast and prostate cancers: Effect of sex steroid hormones. J Cell Biochem. 107:667–676. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M, Osuka S and Murata T: Prolonged survival of patients with colorectal cancer is associated with a higher regucalcin gene expression: Overexpression of regucalcin suppresses the growth of human colorectal carcinoma cells in vitro. Int J Oncol. 53:1313–1322. 2018.PubMed/NCBI | |
|
Yamaguchi M, Osuka S, Weitzmann MN, El-Rayes BF, Shoji M and Murata T: Prolonged survival in hepatocarcinoma patients with increased regucalcin gene expression: HepG2 cell proliferation is suppressed by overexpression of regucalcin in vitro. Int J Oncol. 49:1686–1694. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi M, Osuka S, Weitzmann MN, El-Rayes BF, Shoji M and Murata T: Prolonged survival in pancreatic cancer patients with increased regucalcin gene expression: Overexpression of regucalcin suppresses the proliferation in human pancreatic cancer MIA PaCa-2 cells in vitro. Int J Oncol. 48:1955–1964. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Tsurusaki Y and Yamaguchi M: Role of regucalcin in liver nuclear function: Binding of regucalcin to nuclear protein or DNA and modulation of tumor-related gene expression. Int J Mol Med. 14:277–281. 2004.PubMed/NCBI | |
|
Tsurusaki Y and Yamaguchi M: Overexpression of regucalcin modulates tumor-related gene expression in cloned rat hepatoma H4-II-E cells. J Cell Biochem. 90:619–626. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Jacques BE, Montgomery WH IV, Uribe PM, Yatteau A, Asuncion JD, Resendiz G, Matsui JI and Dabdoub A: The role of Wnt/β-catenin signaling in proliferation and regeneration of the developing basilar papilla and lateral line. Dev Neurobiol. 74:438–456. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Bahrami A, Hasanzadeh M, ShahidSales S, Yousefi Z, Kadkhodayan S, Farazestanian M, Joudi Mashhad M, Gharib M, Mahdi Hassanian S and Avan A: Clinical significance and prognosis value of Wnt signaling pathway in cervical cancer. J Cell Biochem. 118:3028–3033. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Burgy O and Königshoff M: The WNT signaling pathways in wound healing and fibrosis. Matrix Biol 68–69. 67–80. 2018. View Article : Google Scholar | |
|
Kypta RM and Waxman J: Wnt/β-catenin signalling in prostate cancer. Nat Rev Urol. 9:418–428. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wang X, Su GY, Zhao C, Qu FZ, Wang P and Zhao YQ: Anticancer activity and potential mechanisms of 1C, a ginseng saponin derivative, on prostate cancer cells. J Ginseng Res. 42:133–143. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Cong N, Du P, Zhang A, Shen F, Su J, Pu P, Wang T, Zjang J, Kang C and Zhang Q: Downregulated microRNA-200a promotes EMT and tumor growth through the wnt/β-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastri adenocarcinoma. Oncol Rep. 29:1579–1587. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Xu HG, Zheng Q, Song JX, Li J, Wang H, Liu P, Wang J, Wang CD and Zhang XL: Intermittent cyclic mechanical tension promotes endplate cartilage degeneration via canonical Wnt signaling pathway and E-cadherin/β-catenin complex cross-talk. Osteoarthritis Cartilage. 24:158–168. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang X, Yang M, Shi H, Hu J, Wang Y, Sun Z and Xu S: Reduced E-cadherin facilitates renal cell carcinoma progression by WNT/β-catenin signaling activation. Oncotarget. 8:19566–19576. 2017.PubMed/NCBI | |
|
Fang X, Yu SX, Lu Y, Bast RC Jr, Woodgett JR and Mills GB: Phosphorylation and inactivation of glycogen synthase kinase 3 by protein kinase A. Proc Natl Acad Sci USA. 97:11960–11965. 2000. View Article : Google Scholar : PubMed/NCBI |