Effects of KIF2A on the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells

  • Authors:
    • Qiuchan Zhang
    • Dongling Lu
    • Wenlin Liu
    • Shijie Ye
    • Huanping Guo
    • Tianyi Liao
    • Cuifang Chen
  • View Affiliations

  • Published online on: July 9, 2019     https://doi.org/10.3892/ol.2019.10597
  • Pages: 2718-2723
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Nasopharyngeal carcinoma (NPC) is a common tumor in south China. Kinesin family member 2A (KIF2A) belongs to the kinesin‑13 family and is associated with the growth and invasion of a number of different types of human cancer, including ovarian, breast and prostate cancer. The aim of the present study was to evaluate the expression of KIF2A in NPC and explore the relationship between KIF2A and the basic characteristics of 5‑8F cells. Immunohistochemistry was performed on tissues from 97 patients with NPC to assess KIF2A protein expression. KIF2A was knocked down by a specific short interfering (si)RNA in 5‑8F cell lines. Cell proliferation, apoptosis and cycle were analyzed by MTT assay and flow cytometry. The invasive ability and angiogenesis were evaluated by Matrigel assay and reverse transcription‑quantitative PCR. The level of KIF2A was associated with the growth and migration of primary tumor, nodal status and tumor stage. The viability of KIF2A‑knockdown cells was decreased compared with that of the control cells. The number of apoptotic cells, as well as the percentage of cells in the G0/G1 phase, was higher in the KIF2A siRNA group compared with the control group. The invasive and angiogenetic ability of 5‑8F cells in the KIF2A siRNA group was decreased compared with the control group. In conclusion, the expression of KIF2A correlated with the poor clinicopathological features in NPC. Therefore, KIF2A may serve an important role in the progression of NPC and proliferation of 5‑8F cells, which might present a potential therapeutic target for patients with NPC.

Introduction

Nasopharyngeal carcinoma (NPC), which is a malignant tumor, is the most prevalent head and neck cancer in south China (13). The pathogenesis of NPC is complicated, including the Epstein-Barr virus (EBV) infection, carcinogen hazards and individual susceptibility (1,4). In clinic, NPC exhibits low differentiation and high rates of metastasis compared with other types of cancers (57). Although chemotherapy and radiotherapy are used, the treatment efficacy for NPC is still unsatisfactory due to the local recurrence and distant metastasis (5,8). Therefore, it is important to understand the molecular mechanisms of NPC.

The kinesin superfamily proteins (KIFs) are a conserved class of microtubule-dependent motor proteins that serve the role of oncogenes in cancer cells (9,10). Microtubules (MTs) are the important components of cytoskeleton are vital for mitotic activity of tumor and for invading tissues (9). Kinesin family member 2A (KIF2A), which is a member of the kinesin-13 family, is associated with the process of mitosis and mitotic spindle assembly in cancer cells (11,12). KIF2A is able to inhibit the process of microtubule polymerization and is vital for the tumor growth and invasion (11). Recent studies have demonstrated that KIF2A is involved in carcinogenesis and prognosis in different types of human cancer, such as prostate, breast and ovarian cancer (1315). However, the role of KIF2A in human NPC is still unknown.

The aim of the present study was to investigate the function of KIF2A in the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells. The expression of KIF2A was examined in 97 human NPC tumor samples; the prognostic value of KIF2A for patients NPC was evaluated, and the biological functions of KIF2A in the 5-8F NPC cell line were analyzed.

Materials and methods

Patient specimens

A total of 97 patients (47 male, 50 female; age range, 25–78 years; median age, 44 years) diagnosed with NPC by biopsy between January 2017 and June 2018 at the Sixth Affiliated Hospital of Guangzhou Medical University (Guangdong, China) were included in the present study. All specimens had confirmed pathological diagnosis and were classified according to the World Health Organization (WHO) Tumor-Node-Metastasis staging system (16,17). The patients with a history of radiotherapy or chemotherapy were excluded. Sample collection protocols were approved by the Ethics Committee of the Sixth Affiliated Hospital of Guangzhou Medical University (approval no. ERC-2016-33). Written informed consent was obtained from all patients.

Immunohistochemistry

Immunohistochemical staining assays were performed on NPC tissue sections using the EnVision Detection system according to the manufacturer's protocol. Briefly, the tissues were fixed in 4% paraformaldehyde for 24 h at 4°C and embedded in paraffin, and then six consecutive sections (4 µm) were obtained from each tissue. The sections were incubated with a KIF2A primary antibody (1:500; catalog no. PA1-640; Thermo Fisher Scientific, Inc.) overnight at 4°C. The slides were treated with horseradish peroxidase-conjugated secondary antibodies (1:1,000; catalog no. GP016029; Gene Tech Co, Ltd.). The negative controls included the sections incubated without primary antibodies. The sections were evaluated and scored by three independent pathologists according the percentage of positive-stained cells (0, 0%; 1, 1–10%; 2, 11–60%; 3, 61–75%; and 4, 76–100%). The average staining intensity was calculated, and an average score <3 was considered as weak KIF2A protein expression, and an average score ≥3 was considered strong.

Cell culture and RNA interference

The human NPC cell line 5-8F was purchased from the Cancer Institute, Southern Medical University (Guangdong, China). Cells were maintained in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin in a humidified atmosphere with 5% CO2 at 37°C. For RNA interference, 5-8F cells were transfected with 50 nM KIF2A small-interfering (si)RNA (5′-GGCAAAGAGAUUGACCUGG-3′; Invitrogen; Thermo Fisher Scientific, Inc.) with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Scrambled siRNA (5′-AUCAGCAUACCUCA-3′) and mock treatment (using Lipofectamine) were used as controls.

Western blotting

Cells were collected and treated with RIPA buffer (Beyotime Institute of Biotechnology) on ice and the extracted protein was quantified by a bicinchoninic acid kit (Beyotime Institute of Biotechnology). A total of 30 µg protein sample was separated by 10% SDS-PAGE and subsequently transferred onto a PVDF membrane (18). Following blocking with 5% BSA in TBS + 0.1% Tween-20 for 1 h, the membrane was incubated with antibodies against KIF2A (1:500; catalog no. PA1-640; Thermo Fisher Scientific, Inc.) or β-actin (1:1,000; catalog no. 3700; Cell Signaling Technology, Inc.) overnight at 4°C. The membrane was subsequently incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (1:1,000; catalog no. GP016029; Gene Tech Co., Ltd.) for 1 h. The results were analyzed using the fluorescence imaging system (Bio-Rad Laboratories, Inc.). The density of the protein bands was analyzed using ImageJ software (version 1.8.0; National Institutes of Health).

Reverse transcription-quantitative PCR

Total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Following quantitation, 5 µg total RNA was reverse-transcribed into cDNA using a PrimeScript™ RT reagent kit (Takara Bio, Inc.) according to manufacturer's protocol. The mRNA expression levels were detected with the 2−∆∆Cq method using SYBR Green kit (Takara Bio, Inc.) with specific primers (19). The thermocycling conditions were as follows: 45 cycles of 95°C for 5 min, 95°C for 30 sec, 57°C for 30 sec and 72°C for 1 min. The gene-specific primers were synthesized by Sangon Biotech Co., Ltd., and the sequences are presented in Table I.

Table I.

Reverse transcription-quantitative PCR primer sequences.

Table I.

Reverse transcription-quantitative PCR primer sequences.

GeneSequence (5′→3′)Size (bp)
KIF2AF: AAGGCAAAGAGATTGACCTGG151
R: GAAGCTACAGTCCGTCGATTC
Bcl-2F: GGTGGGGTCATGTGTGTGG  89
R: CGGTTCAGGTACTCAGTCATCC
BaxF: CCCGAGAGGTCTTTTTCCGAG155
R: CCAGCCCATGATGGTTCTGAT
VEGFF: AGGGCAGAATCATCACGAAGT  75
R: AGGGTCTCGATTGGATGGCA
GAPDHF: CTGGGCTACACTGAGCACC101
R: AAGTGGTCGTTGAGGGCAATG

[i] KIF2A, kinesin family member 2a; VEGF, vascular endothelial growth factor.

Cell proliferation assay

Cells were seeded at the density of 1×103 cells/well in a 96-well plate and were cultured for 24, 48 and 72 h. Cell viability was assessed by MTT assay. MTT reagent (5 mg/ml; Amresco, LLC) was added to each well and incubated in a dark environment for 3 h at 37°C with 5% CO2. DMSO (100 µl/well) was added into each well. Absorbance at 490 nm was recorded using a microplate reader (Thermo Fisher Scientific, Inc.).

Flow cytometry assay

Following cell collection (1×106), the cell cycle was evaluated by a Cell Cycle Analysis kit (Beyotime) in the dark for 30 min at 37°C. Apoptosis was evaluated by phycoerythrin Annexin V Apoptosis Detection kit (BD Biosciences) following the manufacturer's protocol. After staining, the cells were analyzed by flow cytometry (BD Biosciences).

Cell invasion assay

The invasive ability of 5-8F cells was determined by Matrigel assay using Transwell chambers (BD Biosciences). The filters were pre-coated with 50 µl Matrigel and incubated in a humidified incubator for polymerization. The lower compartment was filled with DMEM medium (Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. Cells with 0.2 ml serum-free DMEM were seeded in the upper compartment of the chamber (2×105 cells/chamber). Following incubation at 37°C for 24 h, the cells on the upper surface of the filter were removed using a cotton swab. Cells that traversed the filter were fixed with 10% methanol for 5 min at 4°C, stained with 0.5% eosin for 30 min at 37°C and counted using a light microscope.

Statistical analysis

All experiments were performed in triplicate. Statistical analyses were performed using SPSS version 20.0 software package (IBM Corp.). One-way analysis of variance with Bonferroni correction was used for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

Association between of KIF2A expression and clinicopathological parameters in NPC

The protein expression level of KIF2A in NPC tissue was detected by immunohistochemistry. The results demonstrated that the expression levels of KIF2A were not associated with the sex and age of patients. However, KIF2A expression levels were associated with the size, location and stage of the primary tumor, the nodal status and the tumor stage. High KIF2A expression was significantly associated with T3-T4 (P=0.005), N2-N3 (P=0.037) and stage III–IV (P=0.014) (Table II).

Table II.

Association between KIF2A expression and the clinicopathological features in patients.

Table II.

Association between KIF2A expression and the clinicopathological features in patients.

KIF2A expression (%)

VariablePatients, nLow, n=57High, n=40P-value
Sex 0.315
  Male4729 (50.9)24 (60.0)
  Female5028 (49.1)16 (40.0)
Age, years 0.827
  <607847 (82.5)30 (75.0)
  ≥601910 (17.5)10 (25.0)
Primary tumor 0.005a
  T1-T26848 (84.2)15 (37.5)
  T3-T429  9 (15.8)25 (62.5)
Nodal status 0.037a
  N0-N17552 (91.2)25 (62.5)
  N2-N3225 (8.8)15 (37.5)
Stage 0.014a
  I–II7350 (87.7)15 (37.5)
  III–IV24  7 (12.3)25 (62.5)

a P<0.05. KIF2A, kinesin family member 2a.

KIF2A silencing decreases 5-8F cell viability

To identify the functions of KIF2A in nasopharyngeal carcinoma, siRNA knockdown of KIF2A was performed. Western blotting and RT-qPCR results confirmed that the mRNA and protein expression of KIF2A was inhibited in siRNA-transfected cells compared with the control group and the scrambled siRNA group (P<0.05; Fig. 1A and B). The effects of KIF2A siRNA on the viability of 5-8F cells were investigated by MTT assay; the results demonstrated that the viability of KIF2A-knockdown cells was decreased at 48 and 72 h compared with the control groups (Fig. 1C).

Effects of KIF2A silencing on the apoptosis and cell cycle of 5-8F cells

To assess whether the decrease of cell proliferation induced by KIF2A siRNA was associated with apoptosis and cell cycle arrest, apoptotic rate and cell cycle of 5-8F cells were examined. The results demonstrated that the number of apoptotic cells in the KIF2A siRNA group was higher compared with those in the control and scrambled siRNA groups (Fig. 2A). In the KIF2A siRNA group, the mRNA expression level of Bcl-2 was decreased, whereas the expression level of Bax was increased compared with the control groups (Fig. 2B). The cell cycle assay revealed that, compared with the control and scrambled siRNA groups, the percentage of cells in the G0/G1 phase of the cell cycle was significantly increased, whereas the percentages of cells in the S and G2/M phases were significantly decreased in the KIF2A siRNA group (Fig. 2C).

KIF2A knockdown inhibits the invasive ability and vascular endothelial growth factor (VEGF) expression in 5-8F cells

To evaluate the invasive ability of 5-8F cells in the KIF2A siRNA group, Matrigel cell invasion assay was performed. The results demonstrated that the invasive capacity of 5-8F cells was significantly decreased in the KIF2A siRNA group compared with the control and scrambled siRNA groups (P<0.05; Fig. 3A). In addition, the expression levels of the angiogenesis marker VEGF of 5-8F were evaluated by RT-qPCR. Compared with the control and scrambled siRNA groups, VEGF expression levels were significantly decreased in the KIF2A siRNA group (P<0.05; Fig. 3B).

Discussion

Nasopharyngeal carcinoma (NPC), a common malignant tumor, derives from the nasopharyngeal epithelium (2022). The long-term survival rate for NPC patients is currently unsatisfactory. Therefore, it is important to investigate the molecular mechanisms of NPC tumorigenesis and progression to improve the therapy of NPC.

KIF2A, which is a type of motor protein with an oncogenic function, has been identified to be overexpressed in a number of human cancers (15,23). KIF2A is a member of the kinesin-13 family of proteins, and serves the function of depolymerizing the ends of microtubules (MTs) (24,25). MTs are vital components of the cytoskeleton and are involved in the invasion and metastasis of cancer (26,27). Therefore, the aim of the present study was to evaluate the expression of KIF2A in NPC and explore the relationship between KIF2A expression and the basic characteristics of 5-8F cells.

In patients with NPC, the expression levels of KIF2A were not related with the sex and age of the patients; however, the levels of KIF2A were notably associated with the primary tumor, the nodal status and the tumor stage, which suggested that high levels of KIF2A may be associated with the malignant degree of NPC. Similarly, in a previous study, the mRNA and protein expression levels of KIF2A were significantly higher in grade III–IV glioma tissues compared with grade I–II and healthy tissues (28). Therefore, the results of the present study indicated that KIF2A may be involved in the malignant development of NPC.

A previous study demonstrated that the silencing of KIF2A significantly inhibits the growth and invasion of oral tongue squamous cell carcinoma, which suggested that KIF2A may regulate the viability and invasion of cancer cells (29). In the present study, 5-8F cell proliferation decreased and apoptosis increased in the KIF2A siRNA group compared with the control groups. The Bax/Bcl-2 ratio is an effective method to identify apoptotic cells (30,31). In the KIF2A siRNA group, the mRNA level of anti-apoptotic Bcl-2 decreased, whereas the pro-apoptotic Bax increased, which demonstrated that the ratio of apoptotic cells increased.

The cell cycle analysis in the present study demonstrated that the number of cells arrested at the G0/G1 phase was increased in the KIF2A siRNA group compared with the control groups. A recent study has revealed that the MRE11-RAD50-NBS1 complex activates KIF2A, which leads to spindle turnover and DNA damage (11); therefore, KIF2A may be associated with the DNA structure and spindle dynamics.

In addition, the results of the present study demonstrated that the invasive ability and the expression of the angiogenesis marker VEGF in 5-8F cells were inhibited in the KIF2A siRNA group compared with the control groups. A previous study has reported that KIF2A is associated with the prognosis of ovarian cancer, and the inhibition of KIF2A decreases invasion in ovarian cancer in vitro (15). Downregulation of KIF2A inhibits gastric cancer cell invasion by suppressing membrane type I-matrix metallopeptidase (32). Therefore, KIF2A may be associated with the invasion and angiogenesis of 5-8F cells.

In conclusion, the present study demonstrated that the expression of KIF2A was correlated with poor clinicopathological features in NPC. In addition, KIF2A may serve an important role in the progression of NPC and the proliferation 5-8F cells.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Qingyuan Science and Technology Project (grant no. 2016B030).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Authors' contributions

CC and QZ designed the study. QZ, TL and CC guided the experiments. QZ, DL and WL performed the experiments. QZ, SY and HG collected and processed the clinical data. QZ, HG and TL analyzed and interpreted the patient data. QZ wrote the paper, and TL and CC reviewed and edited the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Sample collection protocols were approved by the Ethics Committee of the Sixth Affiliated Hospital of Guangzhou Medical University (approval no. ERC-2016-33). Written informed consent was obtained from all patients.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wei KR, Zheng RS, Zhang SW, Liang ZH, Li ZM and Chen WQ: Nasopharyngeal carcinoma incidence and mortality in China, 2013. Chin J Cancer. 36:902017. View Article : Google Scholar : PubMed/NCBI

2 

Tang XR, Li YQ, Liang SB, Jiang W, Liu F, Ge WX, Tang LL, Mao YP, He QM, Yang XJ, et al: Development and validation of a gene expression-based signature to predict distant metastasis in locoregionally advanced nasopharyngeal carcinoma: A retrospective, multicentre, cohort study. Lancet Oncol. 19:382–393. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Zhang F, Li J, Xiao H, Zou Y, Liu Y and Huang W: AFAP1-AS1: A novel oncogenic long non-coding RNA in human cancers. Cell Prolif. 51:2018. View Article : Google Scholar

4 

Tsao SW, Tsang CM and Lo KW: Epstein-Barr virus infection and nasopharyngeal carcinoma. Philos Trans R Soc Lond B Biol Sci. 19:3722017.

5 

He JY, Han P, Zhang Y, Liu YD, Song SJ, Feng GK, An Y, Zhou AJ, Wang HB, Yuan L, et al: Overexpression of Nogo receptor 3 (NgR3) correlates with poor prognosis and contributes to the migration of epithelial cells of nasopharyngeal carcinoma patients. J Mol Med (Berl). 96:265–279. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Zhu JF, Huang W, Yi HM, Xiao T, Li JY, Feng J, Yi H, Lu SS, Li XH, Lu RH, et al: Annexin A1-suppressed autophagy promotes nasopharyngeal carcinoma cell invasion and metastasis by PI3K/AKT signaling activation. Cell Death Dis. 9:11542018. View Article : Google Scholar : PubMed/NCBI

7 

You R, Cao YS, Huang PY, Chen L, Yang Q, Liu YP, Zou X, Zhang YN, Jiang R, Zhang MX, et al: The changing therapeutic role of chemo-radiotherapy for loco-regionally advanced nasopharyngeal carcinoma from two/three-dimensional radiotherapy to intensity-modulated radiotherapy: A network meta-analysis. Theranostics. 7:4825–4835. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Xie P, Yang JP, Cao Y, Peng LX, Zheng LS, Sun R, Meng DF, Wang MY, Mei Y, Qiang YY, et al: Promoting tumorigenesis in nasopharyngeal carcinoma, NEDD8 serves as a potential theranostic target. Cell Death Dis. 8:e28342017. View Article : Google Scholar : PubMed/NCBI

9 

Lucanus AJ and Yip GW: Kinesin superfamily: Roles in breast cancer, patient prognosis and therapeutics. Oncogene. 37:833–838. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Chen J, Li S, Zhou S, Cao S, Lou Y, Shen H, Yin J and Li G: Kinesin superfamily protein expression and its association with progression and prognosis in hepatocellular carcinoma. J Cancer Res Ther. 13:651–659. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Xu R, Xu Y, Huo W, Lv Z, Yuan J, Ning S, Wang Q, Hou M, Gao G, Ji J, et al: Mitosis-specific MRN complex promotes a mitotic signaling cascade to regulate spindle dynamics and chromosome segregation. Proc Natl Acad Sci USA. 115:E10079–E10088. 2018. View Article : Google Scholar : PubMed/NCBI

12 

Chen MH, Liu Y, Wang YL, Liu R, Xu BH, Zhang F, Li FP, Xu L, Lin YH, He SW, et al: KIF2A regulates the spindle assembly and the metaphase I-anaphase I transition in mouse oocyte. Sci Rep. 6:393372016. View Article : Google Scholar : PubMed/NCBI

13 

Tao T, Chen M, Jiang R, Guan H, Huang Y, Su H, Hu Q, Han X and Xiao J: Involvement of EZH2 in aerobic glycolysis of prostate cancer through miR-181b/HK2 axis. Oncol Rep. 37:1430–1436. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Zhao P, Lan F, Zhang H, Zeng G and Liu D: Down-regulation of KIF2A inhibits gastric cancer cell invasion via suppressing MT1-MMP. Clin Exp Pharmacol Physiol. 45:1010–1018. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Sheng N, Xu YZ, Xi QH, Jiang HY, Wang CY, Zhang Y and Ye Q: Overexpression of KIF2A is suppressed by miR-206 and associated with poor prognosis in ovarian cancer. Cell Physiol Biochem. 50:810–822. 2018. View Article : Google Scholar : PubMed/NCBI

16 

Palazzi M, Guzzo M, Tomatis S, Cerrotta A, Potepan P, Quattrone P and Cantù G: Improved outcome of nasopharyngeal carcinoma treated with conventional radiotherapy. Int J Radiat Oncol Biol Phys. 60:1451–1458. 2004. View Article : Google Scholar : PubMed/NCBI

17 

OuYang PY, You KY, Zhang LN, Xiao Y, Zhang XM and Xie FY: External validity of a prognostic nomogram for locoregionally advanced nasopharyngeal carcinoma based on the 8th edition of the AJCC/UICC staging system: A retrospective cohort study. Cancer Commun (Lond). 38:552018. View Article : Google Scholar : PubMed/NCBI

18 

Anufrieva KS, Shender VC, Arapidi GP, Pavlyukov MS, Shakhparonov MI, Shnaider PV, Butenko IO, Lagarkova MA and Govorun VM: Therapy-induced stress response is associated with downregulation of pre-mRNA splicing in cancer cells. Genome Med. 10:492018. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Xing H, Chen X and Han Y: Role of regenerating gene IA expression on local invasion and survival in nasopharyngeal carcinoma. Biol Res. 50:372017. View Article : Google Scholar : PubMed/NCBI

21 

Zuo LL, Zhang J, Liu LZ, Zhou Q, Du SJ, Xin SY, Ning ZP, Yang J, Yu HB, Yue WX, et al: Cadherin 6 is activated by Epstein-Barr virus LMP1 to mediate EMT and metastasis as an interplay node of multiple pathways in nasopharyngeal carcinoma. Oncogenesis. 6:4022017. View Article : Google Scholar : PubMed/NCBI

22 

Xing H, Chen X and Han Y: Role of regenerating gene IA expression on local invasion and survival in nasopharyngeal carcinoma. Biol Res. 50:372017. View Article : Google Scholar : PubMed/NCBI

23 

Watanabe T, Kakeno M, Matsui T, Sugiyama I, Arimura N, Matsuzawa K, Shirahige A, Ishidate F, Nishioka T, Taya S, et al: TTBK2 with EB1/3 regulates microtubule dynamics in migrating cells through KIF2A phosphorylation. J Cell Biol. 210:737–751. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Ali A, Veeranki SN, Chinchole A and Tyagi S: MLL/WDR5 complex regulates Kif2A localization to ensure chromosome congression and proper spindle assembly during mitosis. Dev Cell. 41:605–622. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Kwon HJ, Park JE, Song H and Jang CY: DDA3 and Mdp3 modulate Kif2a recruitment onto the mitotic spindle to control minus-end spindle dynamics. J Cell Sci. 129:2719–2725. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Yan C, Wang F, Peng Y, Williams CR, Jenkins B, Wildonger J, Kim HJ, Perr JB, Vaughan JC, Kern ME, et al: Microtubule acetylation is required for mechanosensation in drosophila. Cell Rep. 25:1051–1065.e6. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Sandi MJ, Marshall CB, Balan M, Coyaud É, Zhou M, Monson DM, Ishiyama N, Chandrakumar AA, La Rose J, Couzens AL, et al: MARK3-mediated phosphorylation of ARHGEF2 couples microtubules to the actin cytoskeleton to establish cell polarity. Sci Signal. 10(pii): eaan32862017. View Article : Google Scholar : PubMed/NCBI

28 

Zhang X, Ma C, Wang Q, Liu J, Tian M, Yuan Y, Li X and Qu X: Role of KIF2A in the progression and metastasis of human glioma. Mol Med Rep. 13:1781–1787. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Wang CQ, Li YJ, Wei ZM, Zhu CJ, Qu X, Wei FC, Xing XM and Yu WJ: Stable gene-silence of Kif2a synergistic with 5-fluorouracil suppresses oral tongue squamous cell carcinoma growth in vitro and in vivo. Oral Surg Oral Med Oral Pathol Oral Radiol. 116:49–54. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Zhang P, Zhang Y, Liu K, Liu B, Xu W, Gao J, Ding L and Tao L: Ivermectin induces cell cycle arrest and apoptosis of HeLa cells via mitochondrial pathway. Cell Prolif. 52:e125432019. View Article : Google Scholar : PubMed/NCBI

31 

Zhou S, Wang Y and Zhu JJ: Simultaneous detection of tumor cell apoptosis regulators Bcl-2 and bax through a dual-signal-marked electrochemical immunosensor. ACS Appl Mater Interfaces. 8:7674–7682. 2016. View Article : Google Scholar : PubMed/NCBI

32 

Zhao P, Lan F, Zhang H, Zeng G and Liu D: Down-regulation of KIF2A inhibits gastric cancer cell invasion via suppressing MT1-MMP. Clin Exp Pharmacol Physiol. 45:1010–1018. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

September-2019
Volume 18 Issue 3

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Q, Lu D, Liu W, Ye S, Guo H, Liao T and Chen C: Effects of KIF2A on the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells. Oncol Lett 18: 2718-2723, 2019.
APA
Zhang, Q., Lu, D., Liu, W., Ye, S., Guo, H., Liao, T., & Chen, C. (2019). Effects of KIF2A on the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells. Oncology Letters, 18, 2718-2723. https://doi.org/10.3892/ol.2019.10597
MLA
Zhang, Q., Lu, D., Liu, W., Ye, S., Guo, H., Liao, T., Chen, C."Effects of KIF2A on the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells". Oncology Letters 18.3 (2019): 2718-2723.
Chicago
Zhang, Q., Lu, D., Liu, W., Ye, S., Guo, H., Liao, T., Chen, C."Effects of KIF2A on the prognosis of nasopharyngeal carcinoma and nasopharyngeal carcinoma cells". Oncology Letters 18, no. 3 (2019): 2718-2723. https://doi.org/10.3892/ol.2019.10597