Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2020 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2020 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299

  • Authors:
    • Abdalkhalig Elkhider
    • Bing Wang
    • Xunli Ouyang
    • Mahmoud Al‑Azab
    • Williams Walana
    • Xiaotong Sun
    • Han Li
    • Yawei Tang
    • Jing Wei
    • Xia Li
  • View Affiliations / Copyright

    Affiliations: Department of Immunology, College of Basic Medical Sciences, Dalian Medical University, Dalian, Liaoning 116044, P.R. China
    Copyright: © Elkhider et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1665-1672
    |
    Published online on: January 7, 2020
       https://doi.org/10.3892/ol.2020.11251
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Non‑small cell lung cancer (NSCLC) constitutes the majority of all lung‑cancer cases. Aquaporin 5 (AQP5) may be involved in NSCLC by promoting lung‑cancer initiation and progression. The present study aimed to determine the role of AQP5 in migration and angiogenesis using NSCLC cells and HUVECs. AQPs 1, 3, 4, 5, 8 and 9 were screened in the NSCLC cell line H1299, and the present results showed that AQP5 mRNA was upregulated compared with the other AQP genes. At the protein level, AQP5 was significantly increased in H1299 cells compared with 16HBE cells. AQP5 knockdown in H1299 cells significantly decreased cell migration compared with untransfected cells, as demonstrated by both Transwell and wound closure assays. The present study further investigated H1299 ability to promote HUVEC vascularisation. The supernatants of both transfected and untransfected H1299 cells were used as conditioned medium for HUVECs, and tube formation was measured. The supernatant of AQP5‑downregulated cells exhibited significantly low tube formation potential compared with untransfected cells. Similarly, vascular endothelial growth factor was significantly increased in control cells (si‑NC) compared with cells transfected with small interfering RNA targeting AQP5. The present study found that AQP5 downregulation significantly decreased the phosphorylation level of epidermal growth factor receptor and the activity of the ERK1/2 pathway. In summary, the present study suggested that AQP5 influenced migration and angiogenesis in NSCLCs in vitro and may potentially exhibit similar in vivo effects.

Introduction

Globally, lung cancer is ranked as the second most prevalent malignancy among all types of cancer and is a common cause of cancer-associated mortalities (1). It has been reported that >80% of diagnosed lung-cancer cases are non-small cell lung cancers (NSCLCs) (2). Lung-cancer treatment is promising if the disease is detected at its early stage, and less beneficial at advanced stage, though a relatively high risk of recurrence occurs even after exposure to available potent treatment (3). NSCLC migration and invasion contribute to poor treatment outcome and lung-cancer mortality (4). NSCLC cells aggressively proliferate and invade adjacent tissues, cross the basement membrane and migrate to establish colonies in distant organs of the body via either the vascular system or the lymphatic system (5). With advancements in molecular biology tools and the biological processes identified in the past decades, the basic biology of tumors is now well understood (6). Several oncogenes have been identified, including passenger and driver genes, such as KRAS, ERBB2 and BRAF (7). Various oncogenes modulating cancer angiogenesis and metastasis have been identified in recent years, providing novel potential therapeutic targets such as aquaporin (AQP), which was investigated in the present study.

AQPs are water channels, and are ubiquitous integral membrane proteins that control extra- and intra-cellular fluid passage (8). AQPs play a regulatory role in human carcinogenesis (9). The expression of human AQP1 has been found to be unaffected in brain tumors, renal cell carcinoma, colon cancer and pancreatic cancer, whereas AQP5 expression was identified to be increased in lung, salivary glands and kidney cancer (10). In addition, AQP5 is increased in ovarian and cervical cancer, esophageal squamous cell carcinoma, and hepatocellular carcinoma; however, lymphocyte activation stimulates the transcription of AQP1, AQP3 and AQP5 (11–14). AQPs play an important functional role in cell migration in various cell types, including brain, pancreas and colon cancer cells (15,16). A previous study examining NSCLC revealed that AQP5 level is associated with the progression of lung cancer (4). AQP5 upregulation was also observed in adenocarcinoma cells, but it is relatively less expressed in non-mucinous bronchioloalveolar carcinoma (11). The H1299 cell line is a human NSCLC cell line, which is derived from the lymph node and has been widely used to investigate a number of disease-associated mechanisms, such as tumor necrosis and cancer cells apoptosis (17,18). A previous study indicated that AQP5 activates the EGFR1/2 and ERK1/2 pathway, which regulates cancer cell migration and proliferation (19,20). In the present study, the influence of AQP5 on H1299 cell migration and regulation of angiogenesis was investigated, and the present study suggested that AQP5 downregulation significantly decreased both migration and angiogenesis regulation of NSCLC H1299 cells.

Materials and methods

Cell culture

The NSCLC cell lines H1299 and 16HBE were purchased from the American Type Culture Collection. Cells were cultured in RPMI-1640 medium (Hyclone; GE Healthcare Life Sciences) supplemented with 10% FBS (Thermo Fisher Scientific, Inc.), 100 U/ml penicillin, and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.). Cells were passaged 3–5 times before collection. HUVECs were obtained from The Dalian Medical University, and cultured in M199 medium (Gibco; Thermo Fisher Scientific, Inc.). Both cultures were incubated at 37°C with 5% CO2.

Total mRNA extraction

H1299 cells were grown until they reached 80–90% confluency and were washed twice with sterile PBS and harvested using RNAiso Plus (Takara Bio, Inc.) according to the manufacturer's protocol. Cells were resuspended in RNAiso Plus, put on ice for 5 min and centrifuged at 4°C at 12,000 × g for 15 min. The supernatant was added to an equal volume of chloroform, incubated on ice for 10 min and centrifuged at 4°C at 12,000 × g. In total, 550 µl isopropanol was added to the aqueous phase, and the solution was mixed gently and centrifuged at 12,000 × g for 15 min at 4°C. The sediment was washed in 1 ml ethanol (75%) in diethyl pyrocarbonate (DEPC)-treated H2O, and centrifuged for 10 min at 4°C at 12,000 × g. The pellet was air-dried, dissolved in 10 µl RNase-free H2O, and the concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific, Inc.).

Reverse transcription PCR (RT-PCR)

RNA (~1 µg) was converted to cDNA using the PrimeScript first strand cDNA Synthesis kit (Takara Bio, Inc.) according to the manufacturer's protocol. A mixture containing oligo dT primer, dNTP mixture (Takara Bio, Inc.), RNase-free ddH2O and the extracted RNA was incubated at 65°C for 5 min and immediately cooled on ice. The buffer 5X PrimeScript (Takara Bio, Inc.), RNase inhibitor, reverse transcriptase and RNase-free ddH2O (Takara Bio, Inc.) were added to the previous mixture in a total volume of 20 µl, according to the manufacturer's protocol. The mixture was homogenized gently using a micro-centrifuge at 6,000 × g at room temperature for 5 min, and incubated for 60 min at 42°C. The enzyme was inactivated by incubating the samples at 95°C for 5 min. Subsequently, the samples were cooled on ice. PCR was performed using PCR premix (Takara Bio, Inc.) as follows: 30 cycles of 94°C for 5 min, 94°C for 30 sec, 56°C for 30 sec, 72°C for 1 min, 72°C for 7 min and final hold at 12°C, the PCR product was loaded in 2% agarose gel and visualized using EthidiumBromide, and GAPDH was used as an internal control to evaluate cDNA synthesis efficiency. The RT bands were determined by IMAGEJ software (version 1.46; National Insitutes of Health). The primers used in the present study were purchased from Takara Bio, Inc. (Table I).

Table I.

Primer sequences used for cDNA amplification.

Table I.

Primer sequences used for cDNA amplification.

GeneSequences (5′→3′)
AQP1F: TCTGGAGGCTGTGGTGGCT
R: AAGTGAGTTCTCGAGCAGGGA
AQP3F: AGCGAGTTTGGATGAGCAGCAGA
R: AAGGAGACGGCAAGCAGGGTGTA
AQP4F: ATGGTGGCTTTCAAAGGGGT
R: GATGGGCCCAACCCAATATAT
AQP5F: TGGGTCTTCTGGGTAGGGCCTATTGT
R: GCCGGCTTTGGCACTTGAGATACT
AQP8F: TCATTGGAGATGGGAAG ACC
R: TGAGAAGCAAGGAAGTG GC
AQP9F: CTCAGTCCCAGGCTCTTCAC
R: CTCAGTCCCAGGCTCTTCAC
VEGFF: TTCTGGGCTGTTCTCGCTTC
R: CTCTCCTCTTCCTTCTCTTCTTCC
GAPDHF: TGACCACAGTCCATGCCATCAC
R: CGCCTGCTTCACCACCTTCTT

[i] F, forward; R, reverse; AQP, aquaporin.

Protein extraction

H1299 cells cultured to 100% confluence were scraped using ice-cold PBS and a cold plastic scraper and harvested following a centrifugation at 12,000 × g for 3 min at 4°C. RIPA lysis buffer (Nanjing KeyGen Biotech Co., Ltd.) containing a proteinase inhibitor, phosphate inhibitor and PMSF, and cells were lysed according to the manufacturer's protocol. The mixture was then vortexed for 40 min at room temperature and centrifuged at 12,000 × g for 15 min at 4°C. The supernatant was used as the total protein extract. Total protein concentration was measured using a bicinchoninic acid assay (Nanjing KeyGen Biotech Co., Ltd.) according to the manufacturer's protocol. A standard absorbance curve was established using known concentrations of protein, and the protein concentration in the samples was extrapolated from the standard curve. Total protein (~20 µg) was used for SDS-PAGE and western blot analysis.

Western blot analysis

Total protein (~20 µg/lane) extracted from H1299 or 16HBE cells was loaded on 12% SDS-PAGE, transferred to Hybond-C nitrocellulose membranes (GE Healthcare Life Sciences), and blocked with 5% skimmed milk in 0.5% TBS-Tween 20 (TBST) at room temperature for 1 h. The membranes were incubated with rabbit anti-AQP5 (cat. no. ab78486), EGFR (cat. no. ab52894), p-EGFR (cat. no. ab5644), ERK (cat. no. ab54230) and p-ERK (cat. no. ab65142), (dilution, 1:1,000) and β-actin (dilution, 1:1,000; cat no. ab6276) (all from Abcam) at 4°C overnight. After the membranes were washed three times with TBST, they were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibodies (dilution 1:100, catalog no. ab205718; Abcam) for 1 h at room temperature. The protein was visualized using an enhanced chemiluminescence detection system (Bio-Rad Laboratories, Inc.). Band density was quantified using the Image Lab software (version 4.0; Bio-Rad Laboratories, Inc.).

AQP5 gene silencing

Small interfering (si)RNAs against AQP5, negative (NC) and positive (PC) controls were purchased from Shanghai GenePharma Co., Ltd. siRNA sequences are presented in Table II. The siRNAs were dissolved in 125 µl DEPC-treated water (Shanghai GenePharma Co., Ltd.) and transfected into H1299 cells at 70–90% confluence. According to the manufacturer's protocol, cells were transfected with 20 nmol of siRNA using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The effect of the transfection was confirmed by RT-PCR, western blot analysis and fluorescence microscopy 48 h after transfection.

Table II.

Sequences of siRNA used to knockdown AQP5 expression.

Table II.

Sequences of siRNA used to knockdown AQP5 expression.

siRNASequence (5′→3′)
AQP5-560F: CCGUGUUCGCAGAGUUCUUTT
R: AAGAACUCUGCGAACACGGTT
AQP5-883F: GCGUGUGGCCAUCAUCAAATT
R: UUGUGUUGUUGUUGAGCGCTT
AQP5-1224F: GCGUGUGGCCAUCAUCAAATT
R: UUUGAUGAUGGCCACACGCTT
Negative siRNAF: UUCUCCGAACGUGUCACGUTT
R: ACGUGACACGUUCGGAGAATT
Positive siRNAF: UGACCUCAACUACAUGGUUTT
R: AACCAUGUAGUUGAGGUCATT

[i] F, forward; R, reverse; AQP, aquaporin; siRNA, small interfering RNA.

Transwell migration assay

Transwell migration assay was performed to measure tumor cell migration. Transwell inserts (8-µm pores; Corning, Inc.) in 24-well plates were used. H1299 cells (~100 µl; 1×105 cells/ml) in 100 µl serum-free RPMI, were added to the upper chambers, and the lower chambers were filled with 350 µl RPMI medium containing 20% FBS as the attracting agent. After 24 h of incubation at 37°C with 5% CO2, the non-migrated cells were removed from the upper side, whereas the migrated cells were fixed with 70% methanol for 10 min at room temperature, and stained with 0.1% crystal violet at room temperature for 10 min. The cells were visualized using a light inverted microscope (Olympus 1X71; Olympus Corporation) at ×10 magnification.

Wound-healing assay

H1299 cells were cultured into six-well plates for 24 h until they reached 100% confluence, and then the middle of each well was scratched using a 200 µl pipette tip. The scratched layers were washed with PBS to remove non-adherent cells, and the medium was replaced with serum-free RPMI. Wound healing was observed using light inverted microscope (Olympus 1X71; Olympus Corporation) at ×10 magnification, and evaluated by comparing the cell-free area with the initial wound region.

HUVEC tube formation assay

HUVEC tube formation was evaluated using a previously described protocol (12). The supernatant of H1299 cells was collected and stored at −20°C before use. Growth factor-reduced Matrigel (BD Biosciences) was added into 48-well plates (100 µl each) and allowed to solidify at 37°C for 30 min. (1×102 cells/ml) HUVECs with serum-free RPMI medium were resuspended in H1299 culture supernatants with 1% FBS RPMI (total 200 µl) at a 1:1 ratio, added onto a Matrigel layer and incubated at 37°C with 5% CO2. Following cell seeding, tube formation was observed every hour using light inverted microscope (Olympus 1X71; Olympus Corporation) using ×10 magnification, and cells were imaged after 8 h.

Statistical analysis

GraphPad Prism (version 6.07; GraphPad Software, Inc.) was used for all statistical analyses. Data are presented as mean ± standard deviation. Student's t-test was used to compare differences between two groups, and one-way ANOVA was employed to compare ≥3 groups, and the multiple comparisons were performed using one-way analysis, followed by Tukeys post hoc test. All experiments were performed in triplicate and P<0.05 was considered to indicate a statistically significant difference.

Results

AQP5 is upregulated in H1299 cells

To assess the pattern of AQP expression in NSCLC, the expression of six AQPs genes, including AQP 1, 3, 4, 5, 8 and 9, was evaluated in H1299 cells via RT-PCR. Among the six genes investigated, AQP5 was upregulated in H1299 cells (Fig. 1A). The expression of AQP5 was also assessed in the normal human bronchial epithelial cells 16HBE, and it was observed that AQP5 gene was expressed at a lower level compared with AQP3, with no detectable expression levels of the other AQPs genes (1, 4, 8 and 9), (Fig. 1B). The protein levels of AQP5 were assessed in both H1299 and 16HBE cells by western blot analysis. AQP5 protein was significantly upregulated in H1299 cells compared with 16HBE cells (Fig. 1C). AQP5 was therefore selected as a target for gene silencing.

Figure 1.

Expression of AQP genes in H1299 and 16HBE cells. (A) Gene expression levels of various AQPs in H1299 cells. (B) Gene expression of various AQPs in 16HBE cells. Only AQP3 and AQP5 showed detectable bands. (C) Protein expression of AQP5 in H1299 and 16HBE cells. Results shown are representative of three independent experiments, *P<0.05, **P<0.001, ***P<0.0001. GAPDH was used as internal control for gene expression, and β-actin was used as reference protein. AQP, aquaporin.

AQP5 gene silencing

H1299 cells were transfected with various siRNAs against AQP5. In total, three different siRNA sequences were tested to determine the optimal siRNA to knockdown AQP5 expression. siRNA-560 exhibited the highest downregulation of AQP5 gene, as evidenced by fluorescence imaging for determine the transfection efficiency using (FAM) conjugated to the 5′ end of the siRNAs (Fig. 2A), RT-PCR (Fig. 2B) and western blot analysis (Fig. 2C).

Figure 2.

Knockdown of AQP5 in H1299 cells and AQP5 expression. (A) H1299 cells were transfected with different siRNAs. Images were obtained using a fluorescence microscope, magnification, ×10. (B) Gene expression of AQP5 following transfection with different siRNAs. (C) Protein expression of AQP5 in H1299 cells with and without transfection. GAPDH was used as internal control for gene expression, and β-actin was used as reference protein. Results shown are representative of three independent experiments. *P<0.05, **P<0.001, ***P<0.0001 vs. siPC; #P<0.05, ##P<0.001, ###P<0.0001 vs. siNC; ^^^P<0.0001 vs. NC. siRNA, small interfering RNA; siPC, siRNA positive control targeting GAPDH; siNC, siRNA negative control; NC, untransfected cells; AQP, aquaporin.

AQP5 is involved in lung cancer cell migration

To evaluate the migration of H1299 cells following AQP5 downregulation, Transwell migration and wound closure assays were performed. A significant reduction in the closure of the wound gap was observed after AQP5 knockdown (siAQP5) compared with the NC cells (Figs. 3A and 3B). Similarly, the Transwell assay indicated that siAQP5 significantly decreased H1299 cell migration compared with the NC cells (Fig. 3C). Collectively, the present results suggested that AQP5 may be involved in NSCLC cell migration, and reducing its expression may represent a potential therapeutic treatment.

Figure 3.

AQP5 downregulation decreases migration of H1299 cells. Wound-healing assay of (A) non-transfected and (B) transfected H1299 cells. (C) NC and transfected H1299 cells migration across Transwell membrane at 24 h, magnification, ×10. ***P<0.0001 vs. NC. siRNA, small interfering RNA; NC, untransfected cells; AQP, aquaporin.

Downregulation of AQP5 inhibits angiogenesis and decreases activation of the epidermal growth factor receptor (EGFR)/ERK pathway

Vascular supply is required for cancer cells to proliferate and survive (21). Therefore, the role of AQP5 in tumor vascularisation was investigated using HUVECs. These cells exhibit the ability to grow and form tube-like structures, depending on the growth factors contained in the supernatant (22). HUVECs were treated with the supernatant of NC cultures as control medium (Fig. 4A). The supernatant of H1299 cells transfected with siAQP5 was used as the experimental sample. Increased tube formation was observed in HUVECs treated with the supernatant collected from NC H1299 cells compared with siAQP5-treated H1299 cells (Fig. 4A). The present results suggested that AQP5 knockdown reduced H1299 cell vascularisation. The expression of vascular endothelial growth factor (VEGF) in NC and siAQP5-treated H1299 cells was also assessed. The present results suggested that the expression level of VEGF was reduced in siAQP5 cells compared with NC cells (Fig. 4B). NC cells showed significantly increased EGFR and ERK1/2 phosphorylation, whereas AQP5 downregulation significantly decreased EGFR/ERK pathway activation in H1299 cells (Fig. 4C).

Figure 4.

AQP5 downregulation inhibits angiogenesis and the activity of the EGFR/ERK signaling pathway. (A) HUVEC cultured in conditioned medium isolated from untransfected and transfected H1299 cells, magnification, ×10. (B) VEGF mRNA levels in untransfected and transfected H1299 cells. (C) Knockdown of AQP5 caused a significantly decreased activity in the expression levels of protein associated with the EGFR/ERK pathway in H1299 cells. GAPDH was used as internal control for gene expression and β-actin was used as reference protein. *P<0.05, **P<0.001, ***P<0.0001 vs. NC. siRNA, small interfering RNA; HUVEC, human umbilical vein endothelial cell; NC, untransfected cells; AQP, aquaporin; EGFR, epidermal growth factor receptor; p-, phosphorylated; VEGF, vascular endothelial growth factor.

Discussion

AQPs serve important roles in vascular permeability and interstitial fluid pressure in tumors (23). An increased expression of AQP genes was found in different types of tumors, suggesting their potential to influence tumor activities in various tissues (8,23,24). Low AQP expression can inhibit the outgrowth of capillaries by decreasing VEGF expression in NSCLC (21). Therefore, AQPs may be partly responsible for tumor metastasis, and reducing their biological activity in tumors may be a promising therapeutic option (25–27). The growth, development, invasion and migration of NSCLC depend on an efficient supply of nutrients and metabolic activity (11). Water molecules are indispensable in cellular activities, especially in tumors, and an increased nutrition and water supply is required by cancerous cells. Consistent with previous findings (21), six different types of AQPs were found to be expressed in NSCLC and H1299 cells in the present study. Specifically, AQP1, 3, 4, 5, 8 and 9 were identified to be expressed in NSCLC cells. However, only AQP3 and 5 were detected in the normal lung cell line 16HBE, in contrast to other studies reporting that multiple AQPs are expressed in normal lung cells (28–30). In normal lung cells, AQP3 was significantly increased compared with AQP5; however, AQP3 and AQP5 exhibited opposite trends in NSCLCs. The present study did not investigate whether knockdown of AQP3 in NSCLC could increase the expression level of AQP5 in tumours. However, Machida et al (11) have reported that the expression of AQP3 and AQP5 in lung cancer cells is generally associated with cellular differentiation.

The role of AQP5 in lung cancer migration in vitro has been investigated in the present study. Tumor migration is a major feature of cancer, and suppressing this process is essential to reduce the spread of tumors (31). Both AQP3 and AQP5 are involved in malignant tumors (23). Woo et al (13) observed that AQP5 is involved in promoting tumor cells proliferation, whereas other researchers have reported the role of elevated AQP5 in the metastasis of colorectal, hepatocellular, squamous cell, cervical and early breast cancer (8,9,13,23,25,27,32). A high level of AQP5 has been observed in NSCLC, which positively correlates with lymph node metastasis; in addition, AQP5 expression is significantly higher in stages III and IV NSCLC (2), compared with that in stages I and II, suggesting its role in lung cancer progression (2). Woo et al (13) reported that AQP5 is a promising therapeutic target and may be involved in tumor establishment and progression more predominantly than other AQPs. AQP5 upregulation is associated with cellular differentiation and serves a major role in invading lung-cancer cells (19).

In the present study, it was observed that AQP5 was highly expressed in H1299, a NSCLC cell line. This observation is in line with previous findings suggesting the upregulation of AQP5 in lung adenocarcinoma cells (14). In clinical settings, AQP5 upregulation is considered as a sign of poor cancer prognosis (2,19). Patients with NSCLC exhibiting AQP5 upregulation present high rates of recurrence and AQP5 upregulation is associated with early disease progression, supporting the oncogenic roles of AQP5 in tumor cells (10). The EGFR/ERK signalling pathway is crucial in lung cancer metastasis (19). AQP5 expression levels are directly associated with the activity of the EGFR/ERK signalling pathway, in addition, p-ERK activates hypoxia inducible factor (HIF)-1α, which leads to the degradation of inhibitors of AQP5 transcription, and enhances the transcriptional activators of AQP5, modulating AQP5 transcription (33). An association between AQP5 and mucin 5 subtype AC gene expression has been observed, and increased AQP5 expression results in mucin hypersecretion in human pulmonary tracts (19). The present study identified a reduced migration of H1299 cells following AQP5 knockdown, suggesting that AQP5 may serve a regulatory role in the expression of migration-associated genes.

The present study suggested that AQP5 knockdown decreased tube formation in HUVECs, suggesting a role for AQP5 in angiogenesis. AQPs are water channels and exhibit significant diagnostic and prognostic potential, particularly in tumours (34). AQP3 and AQP5 were found to play crucial roles in tumour vascularisation, and AQP3 knockdown reduces the density of microvessels in NSCLC via HIF-2α (26). Inhibition of AQP5 significantly decreases the expression of VEGF, which is critical in tumour angiogenesis, suggesting that increased expression of VEGF is positively associated with angiogenesis (21). In a previous study, AQP5 downregulation in colorectal cancer cells resulted in decreased expression of VEGF and a corresponding inhibition of angiogenesis in HUVEC (35). In line with this previous study, the present study found that supernatant collected from H1299 cells following AQP5 knockdown exhibited reduced HUVEC angiogenesis. Tumors exhibit an increased vascularisation compared with normal tissues, the increased vascularisation in tumors can reduce the nutrition supply of normal tissues, decreasing their metabolic activities (21). This effect suggests that suppressing tumour-specific angiogenesis may facilitate cancer treatment. As identified in the present study, downregulation of AQP5 may repress tumor-specific vascularization. The present study did not investigate whether concomitant knockdown of AQP3 and AQP5 may synergistically decrease tumor vascularization, particularly in NSCLC. Collectively, the present results suggested that AQP5 may be involved in the regulation of lung cancer cells migration and angiogenesis via the EGFR/ERK1/2 signaling pathway, and that AQP5 knockdown may be used as a potential target for the prevention of lung cancer metastasis and angiogenesis. However, the association between AQP5 and NSCLC remains elusive, and further studies are required to verify the role of AQP5 in vivo.

Acknowledgements

Not applicable.

Funding

The present study was funded by The National Natural Science Foundation of China (grant no. 81671606), The Special Grant for Translational Medicine (Dalian Medical University; grant no. 2015010), The College Scientific Research Project of Education Department of Liaoning Province (grant no. LQ2017004), Liao Ning Science and Technology Department (grant no. 20180550789) and the Key Laboratory of Human Microecology, Homeostasis and Disease Immune Mechanisms (Dalian).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

AE, MA and WW designed and performed the experiments, analyzed the data and wrote the manuscript. HL, XO, XS, YT and BW interpreted the experiment and analyzed the data. XL and JW planned the experiments, analyzed data, modified the paper and approved the final version of the manuscript submitted for publication. All authors read and approved the final version of manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Dela Cruz CS, Tanoue LT and Matthay RA: Lung cancer: Epidemiology, etiology, and prevention. Clin Chest Med. 32:605–644. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Song T, Yang H, Ho JC, Tang SC, Sze SC, Lao L, Wang Y and Zhang KY: Expression of aquaporin 5 in primary carcinoma and lymph node metastatic carcinoma of non-small cell lung cancer. Oncol Lett. 9:2799–2804. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Grunnet M and Sorensen JB: Carcinoembryonic antigen (CEA) as tumor marker in lung cancer. Lung Cancer. 76:138–143. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Ge XJ, Zheng LM, Feng ZX, Li MY, Liu L, Zhao YJ and Jiang JY: H19 contributes to poor clinical features in NSCLC patients and leads to enhanced invasion in A549 cells through regulating miRNA-203-mediated epithelial-mesenchymal transition. Oncol Lett. 16:4480–4488. 2018.PubMed/NCBI

5 

O'Flaherty JD, Gray S, Richard D, Fennell D, O'Leary JJ, Blackhall FH and O'Byrne KJ: Circulating tumour cells, their role in metastasis and their clinical utility in lung cancer. Lung Cancer. 76:19–25. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Lemjabbar-Alaoui H, Hassan OU, Yang YW and Buchanan P: Lung cancer: Biology and treatment options. Biochim Biophys Acta. 1856:189–210. 2015.PubMed/NCBI

7 

Sholl LM, Aisner DL, Varella-Garcia M, Berry LD, Dias-Santagata D, Wistuba II, Chen H, Fujimoto J, Kugler K, Franklin WA, et al: Multi-institutional oncogenic driver mutation analysis in lung adenocarcinoma: The lung cancer mutation consortium experience. J Thorac Oncol. 10:768–777. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Ishimoto S, Wada K, Usami Y, Tanaka N, Aikawa T, Okura M, Nakajima A, Kogo M and Kamisaki Y: Differential expression of aquaporin 5 and aquaporin 3 in squamous cell carcinoma and adenoid cystic carcinoma. Int J Oncol. 41:67–75. 2012.PubMed/NCBI

9 

Moon C, Soria JC, Jang SJ, Lee J, Obaidul Hoque M, Sibony M, Trink B, Chang YS, Sidransky D and Mao L: Involvement of aquaporins in colorectal carcinogenesis. Oncogene. 22:6699–6703. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Chae YK, Woo J, Kim MJ, Kang SK, Kim MS, Lee J, Lee SK, Gong G, Kim YH, Soria JC, et al: Expression of aquaporin 5 (AQP5) promotes tumor invasion in human non small cell lung cancer. PLoS One. 3:e21622008. View Article : Google Scholar : PubMed/NCBI

11 

Machida Y, Ueda Y, Shimasaki M, Sato K, Sagawa M, Katsuda S and Sakuma T: Relationship of aquaporin 1, 3, and 5 expression in lung cancer cells to cellular differentiation, invasive growth, and metastasis potential. Hum Pathol. 42:669–678. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Mobasheri A, Airley R, Hewitt SM and Marples D: Heterogeneous expression of the aquaporin 1 (AQP1) water channel in tumors of the prostate, breast, ovary, colon and lung: A study using high density multiple human tumor tissue microarrays. Int J Oncol. 26:1149–1158. 2005.PubMed/NCBI

13 

Woo J, Lee J, Chae YK, Kim MS, Baek JH, Park JC, Park MJ, Smith IM, Trink B, Ratovitski E, et al: Overexpression of AQP5, a putative oncogene, promotes cell growth and transformation. Cancer Lett. 264:54–62. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Jo YM, Park TI, Lee HY, Jeong JY and Lee WK: Prognostic significance of aquaporin 5 expression in non-small cell lung cancer. J Pathol Transl Med. 50:122–128. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Papadopoulos MC and Saadoun S: Key roles of aquaporins in tumor biology. Biochim Biophys Acta. 1848:2576–2583. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Liu S, Zhang S, Jiang H, Yang Y and Jiang Y: Co-expression of AQP3 and AQP5 in esophageal squamous cell carcinoma correlates with aggressive tumor progression and poor prognosis. Med Oncol. 30:6362013. View Article : Google Scholar : PubMed/NCBI

17 

Park JY and Juhnn YS: cAMP signaling increases histone deacetylase 8 expression via the Epac2-Rap1A-Akt pathway in H1299 lung cancer cells. Exp Mol Med. 49:e2972017. View Article : Google Scholar : PubMed/NCBI

18 

Wang A, Zhao C, Liu X, Su W, Duan G, Xie Z, Chu S and Gao Y: Knockdown of TBRG4 affects tumorigenesis in human H1299 lung cancer cells by regulating DDIT3, CAV1 and RRM2. Oncol Lett. 15:121–128. 2018.PubMed/NCBI

19 

Zhang Z, Chen Z, Song Y, Zhang P, Hu J and Bai C: Expression of aquaporin 5 increases proliferation and metastasis potential of lung cancer. J Pathol. 221:210–220. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Wee P and Wang Z: Epidermal growth factor receptor cell proliferation signaling pathways. Cancers (Basel). 9:E522017. View Article : Google Scholar : PubMed/NCBI

21 

Nico B and Ribatti D: Aquaporins in tumor growth and angiogenesis. Cancer Lett. 294:135–138. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Sun X, Wei J, Tang Y, Wang B, Zhang Y, Shi L, Guo J, Hu F and Li X: Leptin-induced migration and angiogenesis in rheumatoid arthritis is mediated by reactive oxygen species. FEBS Open Bio. 7:1899–1908. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Guo X, Sun T, Yang M, Li Z, Li Z and Gao Y: Prognostic value of combined aquaporin 3 and aquaporin 5 overexpression in hepatocellular carcinoma. Biomed Res Int. 2013:2065252013. View Article : Google Scholar : PubMed/NCBI

24 

Watanabe T, Fujii T, Oya T, Horikawa N, Tabuchi Y, Takahashi Y, Morii M, Takeguchi N, Tsukada K and Sakai H: Involvement of aquaporin-5 in differentiation of human gastric cancer cells. J Physiol Sci. 59:113–122. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Lee SJ, Chae YS, Kim JG, Kim WW, Jung JH, Park HY, Jeong JY, Park JY, Jung HJ and Kwon TH: AQP5 expression predicts survival in patients with early breast cancer. Ann Surg Oncol. 21:375–383. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Xia H, Ma YF, Yu CH, Li YJ, Tang J, Li JB, Zhao YN and Liu Y: Aquaporin 3 knockdown suppresses tumour growth and angiogenesis in experimental non-small cell lung cancer. Exp Physiol. 99:974–984. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Zhang T, Zhao C, Chen D and Zhou Z: Overexpression of AQP5 in cervical cancer: Correlation with clinicopathological features and prognosis. Med Oncol. 29:1998–2004. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Liu YL, Matsuzaki T, Nakazawa T, Murata S, Nakamura N, Kondo T, Iwashina M, Mochizuki K, Yamane T, Takata K and Katoh R: Expression of aquaporin 3 (AQP3) in normal and neoplastic lung tissues. Hum Pathol. 38:171–178. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Mobasheri A and Marples D: Expression of the AQP-1 water channel in normal human tissues: A semiquantitative study using tissue microarray technology. Am J Physiol Cell Physiol. 286:C529–C537. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Funaki H, Yamamoto T, Koyama Y, Kondo D, Yaoita E, Kawasaki K, Kobayashi H, Sawaguchi S, Abe H and Kihara I: Localization and expression of AQP5 in cornea, serous salivary glands, and pulmonary epithelial cells. Am J Physiol. 275:C1151–C1157. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Hu J and Verkman AS: Increased migration and metastatic potential of tumor cells expressing aquaporin water channels. FASEB J. 20:1892–1894. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Jung HJ, Park JY, Jeon HS and Kwon TH: Aquaporin-5: A marker protein for proliferation and migration of human breast cancer cells. PLoS One. 6:e284922011. View Article : Google Scholar : PubMed/NCBI

33 

Kawedia JD, Yang F, Sartor MA, Gozal D, Czyzyk-Krzeska M and Menon AG: Hypoxia and hypoxia mimetics decrease aquaporin 5 (AQP5) expression through both hypoxia inducible factor-1α and proteasome-mediated pathways. PLoS One. 8:e575412013. View Article : Google Scholar : PubMed/NCBI

34 

Verkman MS: Role of aquaporin water channels in kidney and lung. Am J Med Sci. 316:310–320. 1998. View Article : Google Scholar : PubMed/NCBI

35 

Wang W, Li Q, Yang T, Li D, Ding F, Sun H and Bai G: RNA interference-mediated silencing of aquaporin (AQP)-5 hinders angiogenesis of colorectal tumor by suppressing the production of vascular endothelial growth factor. Neoplasma. 65:55–65. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Elkhider A, Wang B, Ouyang X, Al‑Azab M, Walana W, Sun X, Li H, Tang Y, Wei J, Li X, Li X, et al: Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299. Oncol Lett 19: 1665-1672, 2020.
APA
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X. ... Li, X. (2020). Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299. Oncology Letters, 19, 1665-1672. https://doi.org/10.3892/ol.2020.11251
MLA
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X., Li, H., Tang, Y., Wei, J., Li, X."Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299". Oncology Letters 19.3 (2020): 1665-1672.
Chicago
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X., Li, H., Tang, Y., Wei, J., Li, X."Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299". Oncology Letters 19, no. 3 (2020): 1665-1672. https://doi.org/10.3892/ol.2020.11251
Copy and paste a formatted citation
x
Spandidos Publications style
Elkhider A, Wang B, Ouyang X, Al‑Azab M, Walana W, Sun X, Li H, Tang Y, Wei J, Li X, Li X, et al: Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299. Oncol Lett 19: 1665-1672, 2020.
APA
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X. ... Li, X. (2020). Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299. Oncology Letters, 19, 1665-1672. https://doi.org/10.3892/ol.2020.11251
MLA
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X., Li, H., Tang, Y., Wei, J., Li, X."Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299". Oncology Letters 19.3 (2020): 1665-1672.
Chicago
Elkhider, A., Wang, B., Ouyang, X., Al‑Azab, M., Walana, W., Sun, X., Li, H., Tang, Y., Wei, J., Li, X."Aquaporin 5 promotes tumor migration and angiogenesis in non‑small cell lung cancer cell line H1299". Oncology Letters 19, no. 3 (2020): 1665-1672. https://doi.org/10.3892/ol.2020.11251
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team