Determination of long non‑coding RNAs associated with EZH2 in neuroblastoma by RIP‑seq, RNA‑seq and ChIP‑seq
- Authors:
- Published online on: July 13, 2020 https://doi.org/10.3892/ol.2020.11862
- Article Number: 1
-
Copyright: © Ye et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Neuroblastoma (NB) is an embryonic tumor derived from sympathetic neural crest cells (1,2). It is the most common type of extracranial solid tumor found in children and the most common type of malignant tumor found in infants and young children, with an incidence rate of 10.5 per million children younger than 14 years old (3–5). The site of the disease is concealed, and NB easily metastasizes (5). Low-risk NB has the characteristics of regression and inducing NB differentiation and maturation in vitro, while high-risk NB has high malignancy and can metastasize early (6). The prognosis of patients with NB is extremely poor, which accounts for ~12–15% of all pediatric cancer-associated deaths (7,8). In recent years, treatments for low- and medium-risk NB have improved; however, the cure rate for patients with high-risk NB remains low (9,10). It is therefore crucial to develop novel treatments for patients with high-risk NB.
Enhancer of zeste homolog 2 (EZH2) protein is the core catalytic element of polycomb repressor complex 2 (PRC2), which regulates the transcription of target genes via promoting histone H3 methylation (11–13). Previous studies have demonstrated that high expression level of EZH2 is a poor prognostic factor in various types of cancer (14,15). For example, in pancreatic cancer, EZH2-mediated microRNA-139-5p regulates epithelial-mesenchymal transition and lymph node metastasis (16). Moreover, EZH2 and EED directly regulate androgen receptor in advanced prostate cancer (17). In NB, EZH2 is highly expressed and can epigenetically silences NB tumor suppressor genes, including CASZ1, CLU, RUNX3 and NGFR, suggesting that EZH2 may be an NB molecular target (18).
Long non-coding RNAs (lncRNAs) are a type of RNA of >200 nucleotides in length that do not encode for proteins. Following their discovery, lncRNAs were considered as ‘noises’ in the genome transcription process (19,20). However, subsequent studies demonstrated that lncRNAs regulate genes at a number of levels, including epigenetic, genomic transcription and post-transcriptional levels. lncRNAs participate in cancer development and tumorigenesis by affecting tumor cell proliferation, migration, invasion, apoptosis and the cell cycle, and promoting angiogenesis (21,22). lncRNAs directly bind to EZH2, recruiting it to the promoter region of genes to repress their expression levels. lncRNAs also serve as EZH2 effectors or regulators (23–25). The present study investigated the association between lncRNAs and EZH2 using RNA immunoprecipitation (RIP)-, RNA- and chromatin IP-sequencing (ChIP-seq).
Materials and methods
Cell culture
The SH-SY5Y cell line was obtained from the American Type Culture Collection (cat. no. CRL-2266) and the 293T cell line was obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% FBS and 1% penicillin-streptomycin solution (all from Biological Industries) and placed in a humidified incubator with 5% CO2 at 37°C. Cell culture dishes were obtained from Hangzhou Xinyou Biotechnology Co., Ltd.
Construction of short hairpin (sh)RNAs and stable transfected cell lines
EZH2 shRNA plasmids [designed online (https://www.sigmaaldrich.com)] and pLKO1(Genomeditech, Shanghai, China) were selected as vectors. The shRNA target sequences were as follows: Forward shEZH2-F, 5′-CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG-3′; reverse shEZH2-R, 5′AATTCAAAAACCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGG-3′; forward shControl-F, 5′-CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTG-3′; reverse shControl-R, 5′-AATTCAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAA. Lentivirus with shEZH2 was packaged with 293T cells using transfection reagent Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Stably transfected SH-SY5Y cells with shRNA (12 µg) and control (12 µg) were acquired following puromycin selection.
Western blotting
Cell were lysed using RIPA lysis buffer (Beyotime Institute of Biotechnology) on ice, and western blotting was performed as standard (26). Following blocking with 8% skimmed milk for 1 h at room temperature, membranes were incubated with primary antibodies (EZH2; cat. no. 5246S; and β-tubulin; cat. no. 2146S; Cell Signaling Technology, Inc.) on a decolorization shaker at 4°C overnight. After washing with Tris-HCl + 0.05% Tween-20 TBST three times, membranes were incubated with secondary antibody (goat anti-rabbit IgG; 1:2,000; cat. no. CW0107; CoWin Biosciences) for 1 h at room temperature. Protein signals were detected via enhanced chemiluminescence substrate (EMD Millipore).
RIP-seq
RNA Immunoprecipitation (RIP) was performed followed as Gagliardi et al (27) In simple terms, RNA was enriched with EZH2 antibody (1:100; cat. no. 5246S; Cell Signaling Technology, Inc) in SH-SY5Y cells. Enriched RNA was broken into short fragments using fragmentation buffer (cat. no. N402-VAHTS; Vazyme Biotech Co., Ltd.) at 94°C for 5 min. Fragmented mRNA was used as a template to synthesize cDNA using random hexamers, buffer, dNTPs and DNA polymerase I (VAHTS Stranded mRNA-seq Library Prep kit for Illumina; cat. no. NR602-01; Vazyme Biotech Co., Ltd.). After the synthesis of the double-stranded cDNA, the double-stranded cDNA was purified. LC magnetic beads were used for purification and target fragment binding. The EP tube was placed on a magnetic stand (beads combined with cDNA), then the supernatant was removed, and washed twice with 80% ethanol for 30 sec each time. End-repair and library preparation was performed by the aforementioned kit (VAHTS Stranded mRNA-seq Library Prep kit for Illumina). Target size selection was performed together with magnetic purification. PCR amplification (using Amplification Mix; cat. no. N611-01; Vazyme Biotech Co., Ltd.) was then performed as following: Initial denaturation 95°C for 3 min, 12 cycles of denaturation at 98°C for 20 sec, annealing at 55°C for 15 sec, elongation at 72°C for 30 sec, and final extension 72°C for 5 min. The primer sequences of PCR were as follows: Forward, 5′AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′; reverse, 5′-CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′. Agarose electrophoresis was used for quality inspection of the constructed library. Qubit 2.0 (Invitrogen; Thermo Fisher Scientific, Inc.) was used to detect the concentration of the library, and the loading concentration of the library was 42 ng/µl with 20 µl. After library quality tests were passed, libraries were sequenced using an Novaseq 6000 sequencer (Illumina, Inc.) with PE150 model (double-ended 150 bp sequencing) according to effective concentration and target data volume. RIP-seq and subsequent bioinformatics Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed by Hangzhou Lianchuan Biotechnology Co., Ltd with the DAVID website (https://david.ncifcrf.gov/).
RNA-seq and analysis
EZH2 protein was knocked down in SH-SY5Y cells using shRNA. Total RNA was obtained from EZH2 knockdown and control groups with TRIzol® (Takara Bio, Inc.). Each group included three replicates. Illumina Paired End Sample Prep kits (Illumina, Inc.) were used to prepare libraries. Each cDNA library was sequenced using an Illumina Hiseq 4000 (cat. no. PE150; Illumina, Inc.). Differential expression levels of lncRNA and mRNA transcripts between the EZH2 knockdown and control groups were measured. RNA-seq and subsequent GO and KEGG analysis was performed by Hangzhou Lianchuan Biotechnology Co., Ltd following the previous study (28).
ChIP-seq
Cells from one 10-cm dish of 80–90% confluence cultures were sonicated 4 times for (30 sec on and 30 sec off) in precooled conditions (Fisher Sonic Dismembrator; Thermo Fisher Scientific, Inc.). DNA was disrupted into fragments of 200–1,000 bp by nucleic acid gel. Anti-EZH2 (1:100; cat. no. 5246S; Cell Signaling Technology, Inc) was used to capture chromatin fragments from cell extracts, and libraries were constructed from immunoprecipitated DNA. An Illumina sequencer was used for high-throughput sequencing of lncRNA and mRNA. ChIP-seq and subsequent GO and KEGG analysis were performed by Hangzhou Lianchuan Biotechnology Co., Ltd. The ChIP protocol was conducted as previously described by Kong et al (29).
Differential expression level analysis
Gene expression levels were estimated using fragments per kilobase of transcript per million mapped reads (FPKM) values. Cuffdiff (v2.1.1; http://cole-trapnell-lab.github.io/cufflinks/) was used to calculate FPKM values of lncRNAs and mRNAs.DAVID (https://david.ncifcrf.gov/) was used to perform GO and KEGG analysis. Official gene symbols of the significantly different genes were enriched. We followed the instructions on the website step by step until acquiring GO and KEGG terms. Significantly differentially expressed genes were obtained using P-value <0.05.
Results
RIP-seq identifies EZH2-interacting lncRNAs
RNA Immunoprecipitation (RIP) was performed using SH-SY5Y cells and western blotting was used to check IP efficiency (Fig. 1A). Both IP supernatants and inputs showed bands for the internal reference gene GAPDH, demonstrating protein extraction and the western blotting system is successful. Antibody heavy chain was detected in the IP and IgG lanes, indicating that IP was successful. Distribution statistics for peaks of each functional area of the gene demonstrated that the coding region accounted for 50% and the exon region of a non-coding gene was ~20% (Fig. 1B). By analyzing the distribution of RPKM values, the gene expression level characteristics of the sample were treated as a whole. If IP was significantly enriched compared with the input group, the total expression level of all genes in the IP group should have been higher than that in the input group (Fig. 1C). lncRNAs are >200 nucleotides in length. Length distribution statistics of known lncRNAs were determined. The results demonstrated that lncRNAs 500–1,000 and >3,500 bp in length were significantly more common than lncRNAs of other lengths in SH-SY5Y cells (Fig. 1D). A total of 2,595 lncRNAs were identified by counting peaks associated with known lncRNAs. Among these lncRNAs, 94 were identified via exclusion of processed transcripts and retained introns (Table I). GO analysis demonstrated that these lncRNAs were involved in numerous biological processes, including cellular components and molecular functions, such as metabolic process and transcription regulation(Fig. 1E). Furthermore, KEGG analysis indicated that ‘Hedgehog signaling pathway’ and ‘FoxO signaling pathway’ were enriched in SH-SY5Y cells. ‘Tight junction’, ‘apoptosis’ and ‘cell cycle’ may also be associated with these lncRNAs (Fig. 1F).
RNA-seq for mRNAs and lncRNAs
The results from western blotting demonstrated that EZH2 was significantly downregulated following shRNA transfection (Fig. 2A). By analyzing the distribution of FPKM values, the gene expression level characteristics of the sample were treated as a whole (Fig. 2B). Following EZH2 knockdown, 448 up- and 571 downregulated genes were differentially expressed compared with the normal control group (Fig. 2C and D). A heatmap of the top 100 differentially expressed genes was generated (Fig. 2E). GO analysis demonstrated that these genes were associated with ‘negative regulation of neuron apoptotic processes’, ‘nervous system development’ and ‘peripheral nervous system development’. KEGG analysis showed that enriched genes were primarily distributed in the ‘TGF-β signaling pathway’, ‘Hippo signaling pathway’ and ‘cAMP signaling pathway’. Compared with the normal control group, 32 up- and 35 downregulated lncRNAs were differentially expressed in the shEZH2 group (Fig. 3A and B; Table II). A heatmap of the top 100 differentially expressed lncRNAs (including known and novel lncRNAs) was generated (Fig. 3C). GO analysis demonstrated that these lncRNAs were involved in numerous biological processes, including ‘regulation of developmental growth’, ‘peptidyl-tyrosine phosphorylation’ and ‘histone glutamine methylation’ (Fig. 3D). KEGG analysis demonstrated that ‘Hedgehog signaling pathway’, ‘Parkinson's disease’ and ‘Alzheimer's disease’ were associated with these lncRNAs (Fig. 3E).
 | Table II.Different lncRNAs determined by RNA-sequencing following enhancer of zeste homolog 2 knockdown. |
ChIP-seq for EZH2
Due to the influence of chromosome conformation, chromosome expression levels in the active region of gene expression levels was more open. This resulted in input DNA reads exhibiting greater abundance in promoter and gene body regions, with a characteristic decrease near the transcription start site (TSS). The distribution of IP DNA is associated with EZH2 proteins, and apparent modifications such as transcription factors and H3K27me3 were enriched in the promoter and gene body regions. Through the distribution of reads in the intervals of these genes, the success of ChIP-seq experiments was verified (Fig. 4B). Analysis of peak distribution in the genomic functional area indicated that intergenic and promoter-TSS were the most frequent areas (Fig. 4A). ChIP-seq identified 634 genes located in the promoter region, including 138 long intervening non-coding RNAs (lincRNA; Table III). GO analysis demonstrated enrichment of ‘nervous system development’, ‘chemical synaptic transmission’ and ‘trans-synaptic signaling’ (Fig. 4C). KEGG analysis indicated that ‘Rap1 signaling pathway’, ‘cAMP signaling pathway’ and ‘retrograde endocannabinoid signaling’ were enriched (Fig. 4D).
Discussion
Although numerous treatments for NB currently exist, patients with NB have only 40% survival rate (2,30). A novel treatment is therefore needed to improve survival rate. EZH2 is a member of the polycomb group protein family that is upregulated in various types of cancer, including NB (31,32). Li et al (32) demonstrated that EZH2 knockdown significantly inhibits NB differentiation. Transcriptome sequencing has demonstrated that neurotrophic receptor tyrosine kinase 1 may be a target of EZH2. Chen et al (31) reported that the MYCN gene binds to the EZH2 promoter, directly promoting EZH2 expression and EZH2 inhibition of neuronal differentiation in a PRC2-dependent manner (33). Tsubota et al (34) demonstrated that EZH2 inhibitors significantly repress the growth of tyrosine hydroxylase-MYCN NB mice, and that MYCN and PRC2 targets are positively correlated in NB. EZH2 may therefore be considered as a novel target for NB treatment. Bate-Eya et al (35) demonstrated that high expression of EZH2 has a survival function independent of its methyltransferase activity in NB. Although inhibitors of EZH2 are at pre-clinical stage in many cancers, their efficacy and underlying mechanism in NB remain unknown.
In a previous study, certain lncRNAs were demonstrated to serve key roles in NB. For example, FOXD3-antisense RNA (AS) 1 is downregulated in NB tissues and cell lines; this is an independent prognostic marker for favorable outcomes for patients with NB. FOXD3-AS1 inhibits the progression of NB via repressing poly-ADP ribose polymerase 1-mediated CCCTC-binding factor activation (36). The lncRNA pancEts-1 is upregulated and is an independent prognostic factor for unfavorable NB outcomes. In addition, pancEts-1 directly interacts with heterogeneous nuclear ribonucleoprotein K to increase its interaction with β-catenin, resulting in stabilization and transactivation of β-catenin and promotion of the growth and metastasis of NB both in vitro and in vivo (37). EZH2 is a transcriptional repressor associated with lncRNA. Numerous lncRNAs are associated with EZH2 with positive or negative correlation (38,39). Since the interacting gene product enhances the co-expressed gene, positively correlated lncRNA is a potential ligand for EZH2 or has the same transcriptional machinery as EZH2 (40). Knocking down EZH2 using small interfering RNA has previously confirmed that lncRNA is negatively correlated with EZH2 expression and is inhibited by EZH2 (41). The present study demonstrated that numerous lncRNAs were associated with EZH2. RIP-seq identified 94 lncRNAs that may bind to EZH2 directly. Among lncRNAs, Chi et al (42) reported that small nucleolar host gene (SNHG) 7 facilitates NB progression via the microRNA (miR)-653-5p/signal transducer and activator of transcription 2 pathway, providing a novel therapeutic target and prognostic biomarker for NB. The lncRNA family with sequence similarity 201A may affect the radiosensitivity of esophageal squamous cell cancer by regulating ataxia telangiectasia mutated (ATM) and mTOR expression via miR-101 (43). In the present study, RNA-seq demonstrated that 32 up- and 35 downregulated lncRNAs were differentially expressed in the shEZH2 group compared with the control group. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) (44), H19 (45) and X-inactive specific transcript (XIST) (46) were some of the first reported lncRNAs associated with NB development. Koshimizu et al (47) demonstrated that expression level of the tumor marker MALAT1 is sensitive to cell surface receptor activation by oxytocin in an NB cell line. In addition, a six-center case-control study identified three single nucleotide polymorphisms (SNPs; rs2839698 G>A, rs3024270 C>G and rs217727 G>A) from the H19 gene in a Chinese population (700 people with NB and 1,516 controls) and investigated the effect of individual and combined SNPs on NB risk (48). Zhang et al (49) demonstrated that XIST downregulates the Dickkopf Wnt signaling pathway inhibitor 1 by promoting H3 histone methylation via EZH2, inhibiting proliferation, migration and invasion of NB cells and limiting tumor development. In addition, SNHG family members, SNHG5, is upregulated while SNHG15 and SNHG16 is downregulated in NB. SNHG16 is reported to facilitate proliferation, migration, invasion and autophagy of NB cells via sponging miR-542-3p and upregulating autophagy-related 5 expression levels (50). However, the involvement of these lncRNAs in NB remains unknown. Among the 138 lincRNAs identified by EZH2 ChIP-seq, cancer susceptibility 15 was identified as a tumor suppressor that can regulate numerous genes involved in neural crest development (51). GO analysis demonstrated that EZH2 participated in a number of biological processes, such as ‘nervous system development’, ‘regulation of developmental growth’ and ‘histone glutamine methylation’. KEGG analysis showed that ‘Hedgehog signaling pathway’ was enriched in both RIP-seq and RNA-seq, indicating that the pathway may be important in EZH2-associated lincRNAs.
In conclusion, the present study demonstrated that numerous lincRNAs could directly bind to EZH2. Certain lincRNAs may regulate or be regulated by EZH2. Certain lncRNAs were associated with N6-methyladenosine and may potentially encode functional polypeptides. In addition, the difficulty of EZH2-targeted drug research may be associated with these lincRNAs. These lincRNAs may provide a novel option for EZH2-centered molecular target therapy.
Acknowledgements
Not applicable.
Funding
This study received financial support from Shanghai Key Disciplines (grant no. 2017ZZ02022), National Natural Science Foundation of China (grant nos. 81771633 and 81572324) and Science Foundation of Shanghai (grant nos. 17411960600 and 15ZR1404200).
Availability of data and materials
The datasets used during the present study are available from the corresponding author upon reasonable request.
Authors' contributions
KD, DM and MY designed the study. MY, LX and JZ collected the data and performed experiments. BL, XL and JH analyzed and interpreted the data. DM and KD were involved in critical reviewing of the manuscript. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Glossary
Abbreviations
Abbreviations:
|
PRC2 |
polycomb repressor complex 2 |
|
RNA-seq |
RNA sequencing |
|
RIP-seq |
RNA immunoprecipitation sequencing |
|
ChIP-seq |
chromatin immunoprecipitation sequencing |
|
GO |
Gene Ontology |
|
KEGG |
Kyoto Encyclopedia of Genes and Genomes |
References
|
Alam MW, Boreas M, Lind DE, Cervantes-Madrid D, Umapathy G, Palmer RH and Hallberg B: Alectinib, an anaplastic lymphoma kinase inhibitor, abolishes ALK activity and growth in alk-positive neuroblastoma cells. Front Oncol. 9:5792019. View Article : Google Scholar : PubMed/NCBI | |
|
Calvo C, Storey C, Morcrette G, Akl P, Freneaux P, Pierron G, Trang H, Aerts I, Schleiermacher G, Philippe-Chomette P, et al: Metastatic neuroblastoma in a patient with ROHHAD: A new alert regarding the risk of aggressive malignancies in this rare condition. Pediatr Blood Cancer. 66:e279062019.PubMed/NCBI | |
|
Garcia M, Rodriguez-Hernandez CJ, Mateo-Lozano S, Perez-Jaume S, Goncalves-Alves E, Lavarino C, Mora J and de Torres C: Parathyroid hormone-like hormone plays a dual role in neuroblastoma depending on PTH1R expression. Mol Oncol. 13:1959–1975. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Grasso S, Cangelosi D, Chapelle J, Alzona M, Centonze G, Lamolinara A, Salemme V, Angelini C, Morellato A, Saglietto A, et al: The SRCIN1/p140Cap adaptor protein negatively regulates the aggressiveness of neuroblastoma. Cell Death Differ. 27:790–807. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Bhoopathi P, Pradhan AK, Bacolod MD, Emdad L, Sarkar D, Das SK and Fisher PB: Regulation of neuroblastoma migration, invasion, and in vivo metastasis by genetic and pharmacological manipulation of MDA-9/syntenin. Oncogene. 38:6781–6793. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Pacenta HL and Macy ME: Entrectinib and other ALK/TRK inhibitors for the treatment of neuroblastoma. Drug Des Devel Ther. 12:3549–3561. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Campbell K, Shyr D, Bagatell R, Fischer M, Nakagawara A, Nieto AC, Brodeur GM, Matthay KK, London WB and DuBois SG: Comprehensive evaluation of context dependence of the prognostic impact of MYCN amplification in neuroblastoma: A report from the International Neuroblastoma Risk Group (INRG) project. Pediatr Blood Cancer. 66:e278192019. View Article : Google Scholar : PubMed/NCBI | |
|
Yu Y, Chen F, Yang Y, Jin Y, Shi J, Han S, Chu P, Lu J, Tai J, Wang S, et al: lncRNA SNHG16 is associated with proliferation and poor prognosis of pediatric neuroblastoma. Int J Oncol. 55:93–102. 2019.PubMed/NCBI | |
|
Avitabile M, Lasorsa VA, Cantalupo S, Cardinale A, Cimmino F, Montella A, Capasso D, Haupt R, Amoroso L, Garaventa A, et al: Association of PARP1 polymorphisms with response to chemotherapy in patients with high-risk neuroblastoma. J Cell Mol Med. 24:4072–4081. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Ye M, Ma J, Liu B, Liu X, Ma D and Dong K: Linc01105 acts as an oncogene in the development of neuroblastoma. Oncol Rep. 2019.(Epub ahead of print). View Article : Google Scholar | |
|
Liu Z, Yang L, Zhong C and Zhou L: EZH2 regulates H2B phosphorylation and elevates colon cancer cell autophagy. J Cell Physiol. 235:1494–1503. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Kosalai ST, Morsy M, Papakonstantinou N, Mansouri L, Stavroyianni N, Kanduri C, Stamatopoulos K, Rosenquist R and Kanduri M: EZH2 upregulates the PI3K/AKT pathway through IGF1R and MYC in clinically aggressive chronic lymphocytic leukaemia. Epigeneticst. 14:1125–1140. 2019. View Article : Google Scholar | |
|
Pediconi N, Salerno D, Lupacchini L, Angrisani A, Peruzzi G, De Smaele E, Levrero M and Belloni L: EZH2, JMJD3, and UTX epigenetically regulate hepatic plasticity inducing retro-differentiation and proliferation of liver cells. Cell Death Dis. 10:5182019. View Article : Google Scholar : PubMed/NCBI | |
|
Kim KH and Roberts CW: Targeting EZH2 in cancer. Nat Med. 22:128–134. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Yan KS, Lin CY, Liao TW, Peng CM, Lee SC, Liu YJ, Chan WP and Chou RH: EZH2 in cancer progression and potential application in cancer therapy: A friend or foe? Int J Mol Sci. 18:11722017. View Article : Google Scholar | |
|
Ma J, Zhang J, Weng YC and Wang JC: EZH2-mediated microRNA-139-5p regulates epithelial-mesenchymal transition and lymph node metastasis of pancreatic cancer. Mol Cells. 41:868–880. 2018.PubMed/NCBI | |
|
Liu Q, Wang G, Li Q, Jiang W, Kim JS, Wang R, Zhu S, Wang X, Yan L, Yi Y, et al: Polycomb group proteins EZH2 and EED directly regulate androgen receptor in advanced prostate cancer. Int J Cancer. 145:415–426. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Wang C, Liu Z, Woo CW, Li Z, Wang L, Wei JS, Marquez VE, Bates SE, Jin Q, Khan J, et al: EZH2 mediates epigenetic silencing of neuroblastoma suppressor genes CASZ1, CLU, RUNX3, and NGFR. Cancer Res. 72:315–324. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Delas MJ, Jackson BT, Kovacevic T, Vangelisti S, Munera ME, Wild SA, Stork EM, Erard N, Knott S and Hannon GJ: lncRNA spehd regulates hematopoietic stem and progenitor cells and is required for multilineage differentiation. Cell Rep. 27:719–729.e6. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Zhong Y, Wang J, Lv W, Xu J, Mei S and Shan A: lncRNA TTN-AS1 drives invasion and migration of lung adenocarcinoma cells via modulation of miR-4677-3p/ZEB1 axis. J Cell Biochem. 120:17131–17141. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Cairns J, Ingle JN, Kalari KR, Shepherd LE, Kubo M, Goetz MP, Weinshilboum RM and Wang L: The lncRNA MIR2052HG regulates ERalpha levels and aromatase inhibitor resistance through LMTK3 by recruiting EGR1. Breast Cancer Res. 21:472019. View Article : Google Scholar : PubMed/NCBI | |
|
Schmidt K, Carroll JS, Yee E, Thomas DD, Wert-Lamas L, Neier SC, Sheynkman G, Ritz J and Novina CD: The lncRNA SLNCR recruits the androgen receptor to EGR1-bound genes in melanoma and inhibits expression of tumor suppressor p21. Cell Rep. 27:2493–2507.e4. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Jin L, Cai Q, Wang S, Wang S, Mondal T, Wang J and Quan Z: Long noncoding RNA MEG3 regulates LATS2 by promoting the ubiquitination of EZH2 and inhibits proliferation and invasion in gallbladder cancer. Cell Death Dis. 9:10172018. View Article : Google Scholar : PubMed/NCBI | |
|
Wang Y, Xie Y, Li L, He Y, Zheng D, Yu P, Yu L, Tang L, Wang Y and Wang Z: EZH2 RIP-seq identifies tissue-specific long non-coding RNAs. Curr Gene Ther. 18:275–285. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Su M, Xiao Y, Tang J, Wu J, Ma J, Tian B, Zhou Y, Wang H, Yang D, Liao QJ and Wang W: Role of lncRNA and EZH2 interaction/regulatory network in lung cancer. J Cancer. 9:4156–4165. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Kim B: Western blot techniques. Methods Mol Biol. 1606:133–139. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Gagliardi M and Matarazzo MR: RIP: RNA immunoprecipitation. Methods Mol Biol. 1480:73–86. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Xia W, Hu J, Ma J, Huang J, Jing T, Deng L, Zhang J, Jiang N, Ma D and Ma Z: Mutations in TOP2B cause autosomal-dominant hereditary hearing loss via inhibition of the PI3K-Akt signalling pathway. Febs Lett. 593:2008–2018. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Kong L, Tan L, Lv R, Shi Z, Xiong L, Wu F, Rabidou K, Smith M, He C, Zhang L, et al: A primary role of TET proteins in establishment and maintenance of De Novo bivalency at CpG islands. Nucleic Acids Res. 44:8682–8692. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Ozcelik D and Pezacki JP: Small molecule inhibition of protein disulfide isomerase in neuroblastoma cells induces oxidative stress response and apoptosis pathways. Acs Chem Neurosci. 10:4068–4075. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Chen L, Alexe G, Dharia NV, Ross L, Iniguez AB, Conway AS, Wang EJ, Veschi V, Lam N, Qi J, et al: CRISPR-Cas9 screen reveals a MYCN-amplified neuroblastoma dependency on EZH2. J Clin Invest. 128:446–462. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Li Z, Takenobu H, Setyawati AN, Akita N, Haruta M, Satoh S, Shinno Y, Chikaraishi K, Mukae K, Akter J, et al: EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications. Oncogene. 37:2714–2727. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Bellamy J, Szemes M, Melegh Z, Dallosso A, Kollareddy M, Catchpoole D and Malik K: Increased efficacy of histone methyltransferase G9a inhibitors against MYCN-amplified neuroblastoma. Front Oncol. 10:8182020. View Article : Google Scholar : PubMed/NCBI | |
|
Tsubota S, Kishida S, Shimamura T, Ohira M, Yamashita S, Cao D, Kiyonari S, Ushijima T and Kadomatsu K: PRC2-mediated transcriptomic alterations at the embryonic stage govern tumorigenesis and clinical outcome in MYCN-driven neuroblastoma. Cancer Res. 77:5259–5271. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Bate-Eya LT, Gierman HJ, Ebus ME, Koster J, Caron HN, Versteeg R, Dolman M and Molenaar JJ: Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity. Eur J Cancer. 75:63–72. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao X, Li D, Huang D, Song H, Mei H, Fang E, Wang X, Yang F, Zheng L, Huang K and Tong Q: Risk-associated long noncoding RNA FOXD3-AS1 inhibits neuroblastoma progression by repressing PARP1-mediated activation of CTCF. Mol Ther. 26:755–773. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Li D, Wang X, Mei H, Fang E, Ye L, Song H, Yang F, Li H, Huang K, Zheng L and Tong Q: Long noncoding RNA pancEts-1 promotes neuroblastoma progression through hnRNPK-mediated β-catenin stabilization. Cancer Res. 78:1169–1183. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Wu Q, Xiang S, Ma J, Hui P, Wang T, Meng W, Shi M and Wang Y: Long non-coding RNA CASC15 regulates gastric cancer cell proliferation, migration and epithelial mesenchymal transition by targeting CDKN1A and ZEB1. Mol Oncol. 12:799–813. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Sanli I, Lalevee S, Cammisa M, Perrin A, Rage F, Lleres D, Riccio A, Bertrand E and Feil R: Meg3 non-coding RNA expression controls imprinting by preventing transcriptional upregulation in cis. Cell Rep. 23:337–348. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Wang M, Guo C, Wang L, Luo G, Huang C, Li Y, Liu D, Zeng F, Jiang G and Xiao X: Long noncoding RNA GAS5 promotes bladder cancer cells apoptosis through inhibiting EZH2 transcription. Cell Death Dis. 9:2382018. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng W and Yu A: EZH2-mediated suppression of lncRNA-LET promotes cell apoptosis and inhibits the proliferation of post-burn skin fibroblasts. Int J Mol Med. 41:1949–1957. 2018.PubMed/NCBI | |
|
Chi R, Chen X, Liu M, Zhang H, Li F, Fan X, Wang W and Lu H: Role of SNHG7-miR-653-5p-STAT2 feedback loop in regulating neuroblastoma progression. J Cell Physiol. 234:13403–13412. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Chen M, Liu P, Chen Y, Chen Z, Shen M, Liu X, Li X, Li A, Lin Y, Yang R, et al: Long noncoding RNA FAM201A mediates the radiosensitivity of esophageal squamous cell cancer by regulating ATM and mTOR expression via miR-101. Front Genet. 9:6112018. View Article : Google Scholar : PubMed/NCBI | |
|
Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al: The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 39:925–938. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Dugimont T, Curgy JJ, Wernert N, Delobelle A, Raes MB, Joubel A, Stehelin D and Coll J: The H19 gene is expressed within both epithelial and stromal components of human invasive adenocarcinomas. Biol Cell. 85:117–124. 1995. View Article : Google Scholar : PubMed/NCBI | |
|
Kelley RL and Kuroda MI: Noncoding RNA genes in dosage compensation and imprinting. Cell. 103:9–12. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Koshimizu TA, Fujiwara Y, Sakai N, Shibata K and Tsuchiya H: Oxytocin stimulates expression of a noncoding RNA tumor marker in a human neuroblastoma cell line. Life Sci. 86:455–460. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Li Y, Zhuo ZJ, Zhou H, Liu J, Zhang J, Cheng J, Zhou H, Li S, Li M, He J and Xiao Y: H19 gene polymorphisms and neuroblastoma susceptibility in Chinese children: A six-center case-control study. J Cancer. 10:6358–6363. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang J, Li WY, Yang Y, Yan LZ, Zhang SY, He J and Wang JX: LncRNA XIST facilitates cell growth, migration and invasion via modulating H3 histone methylation of DKK1 in neuroblastoma. Cell Cycle. 18:1882–1892. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Wen Y, Gong X, Dong Y and Tang C: Long non coding RNA SNHG16 facilitates proliferation, migration, invasion and autophagy of neuroblastoma cells via sponging miR-542-3p and upregulating ATG5 expression. Onco Targets Ther. 13:263–275. 2020. View Article : Google Scholar : PubMed/NCBI | |
|
Russell MR, Penikis A, Oldridge DA, Alvarez-Dominguez JR, McDaniel L, Diamond M, Padovan O, Raman P, Li Y, Wei JS, et al: CASC15-S is a tumor suppressor lncRNA at the 6p22 neuroblastoma susceptibility locus. Cancer Res. 75:3155–3166. 2015. View Article : Google Scholar : PubMed/NCBI |
