Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades

  • Authors:
    • Tian An
    • Xin-Qing Zhang
    • Yu-Fei Liu
    • Juan Lian
    • Yan-Xiang Wu
    • Bo-Han Lv
    • Cong Liang
    • Chun-You Chen
    • Qi-Shuai Yu
    • Meng-Hua Ma
    • Yin-Qian Wang
    • Guang-Jian Jiang
    • Tao Fan
  • View Affiliations / Copyright

    Affiliations: School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 100029, P.R. China, Department of Neurosurgery, ChuiYangLiu Hospital Affiliated to Tsinghua University, Beijing 100022, P.R. China, Beijing University of Chinese Medicine Third Affiliated Hospital, Beijing 100029, P.R. China, Department of Neurosurgery, Sanbo Brain Hospital, Capital Medical University, Beijing 100093, P.R. China, Department of Endocrinology, Workers Hospital of Tangshan City, Tangshan, Hebei 063000, P.R. China
    Copyright: © An et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 371
    |
    Published online on: October 21, 2020
       https://doi.org/10.3892/ol.2020.12234
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs (miRNAs) are involved in the development of several types of tumor; however, their role in spinal gliomas remains unknown. The present study aimed to identify potentially novel spinal cord gliomas (SCG)‑associated miRNAs and to characterize their roles in the development and progression of SCG. miRNA expression levels in low‑grade SCG (classed as stage I‑II SCG based on the World Health Organization grading system), high‑grade SCG (classed as stage IV SCG based on the World Health Organization grading system) and 5 control cases were measured using a miRNA expression microarray. Subsequently, blood samples from the spinal cord of patients with differing grades of SCG were screened for differentially expressed miRNAs (DEmiRNAs). Compared with the control group, 7 upregulated and 36 downregulated miRNAs were identified in the low‑grade SCG group and a total of 70 upregulated and 20 downregulated miRNAs were identified in the high‑grade SCG group (P≤0.05, fold change >2). Gene Ontology analysis revealed that the regulation of cellular metabolic processes, negative regulation of biological processes and axon guidance were primarily involved. Moreover, pathway analysis showed that the target genes of DEmiRNAs were enriched in tumor‑related signaling pathways, such as the MAPK and Wnt signaling pathway. The results suggest that DEmiRNAs in peripheral blood may serve as novel target markers with high specificity and sensitivity for the diagnosis of SCG.

Introduction

The World Health Organization (WHO) classifies human spinal cord gliomas (SCGs) into four different grades (I–IV), according to the increase in malignancy (1). Low-grade SCGs (classed as WHO stage I–II) have a tendency for local recurrence and may trend towards the development of high-grade SCG (classed as WHO stage IV) (2). Post-surgery, patients with low-grade SCG usually exhibit recurrence of tumors within months or years, whereas patients with high-grade SCG, also known as glioblastoma, have a median survival period of only 1 year (3,4). Therefore, studies exploring the mechanism underlying occurrence and progression of SCG may assist in improving our understanding of the biological behavior of SCG and thus result in improved treatment strategies.

MicroRNAs (miRNAs/miRs) are a class of endogenous non-coding small RNAs (~22 nucleotides in length) which negatively regulate target genes at the post-transcriptional level by incomplete binding to the target gene (5,6). miRNAs, which are hypothesized to serve as targets for tumor therapy, can promote cell proliferation, inhibit apoptosis, promote angiogenesis and serve a regulatory role in tumor pathogenesis (7–9). Furthermore, miRNAs may be involved in tumor resistance and may be a valuable diagnostic and prognostic factor for patients with SCG (10).

To the best of our knowledge, the expression of miRNAs in SCG has not been extensively studied, particularly regarding miRNAs which may be implicated in the development of SCG. The present study used miRNA microarrays to detect differentially expressed (DE)miRNAs in the blood of patients with different grades of SCG. The identification of novel DEmiRNAs may provide novel insights into the progression and treatment of SCG.

Materials and methods

Study patients and blood samples

The present study was approved and supervised by The Ethics Committees of Beijing University of Chinese Medicine (Beijing, China) and Sanbo Brain Hospital, Capital Medical University (Beijing, China). Written informed consent was obtained from all patients prior to the study start. According to the WHO (2016) (1) classification of neurological tumors, a total of 10 patients with SCG who underwent surgical treatment at Sanbo Brain Hospital, without preoperative chemotherapy or radiotherapy were recruited between February 2016 to December 2016, and blood samples were collected from low-grade or high-grade SCG cases. In addition, blood was collected from five patients with benign tumors as a control. Arterial blood was stored in liquid nitrogen immediately after extraction.

Microarray determination

Total miRNAs were labeled and hybridized according to the manufacturers' protocol (Qiagen China Co., Ltd.). The slides were scanned using the Axon GenePix 4000B microarray scanner (Molecular Devices, LLC.). The scanned images were imported into GenePix Pro version 6.0 (Molecular Devices, LLC.) for grid alignment and data extraction. After median normalization, significant DEmiRNAs between the two groups were identified based on the fold change (FC) values and P-value.

Reverse transcription quantitative (RT-q)PCR

Total RNA was extracted as previously described (11). Total RNA was extracted from the blood of patients with SCG and control patients using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific Inc.). The RNA quantity and quality were determined using a NanoDrop spectrophotometer (ND-1000, NanoDrop Technologies; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using the cDNA Reverse Transcription kit (Invitrogen; Thermo Fisher Scientific Inc.), with 2 µg total RNA. qPCR was subsequently performed using SYBR Premix ExTaq and the MX3000 instrument (Kangchen BioTech Co., Ltd.), according to the manufacturer's protocol. RT-qPCR was performed using a 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.), accordingly to the manufacturer's protocol. The sequences of the primers used are presented in Table I. mRNA expression levels were quantified using the 22−ΔΔCq method (11) and normalized to the internal reference gene U6.

Table I.

miRNA and mRNA primers for quantitative PCR analysis.

Table I.

miRNA and mRNA primers for quantitative PCR analysis.

PrimerSequence
U6
  Forward 5′-GCTTCGGCAGCACATATACTAAAAT-3′
  Reverse 5′-CGCTTCACGAATTTGCGTGTCAT-3′
hsa-miR-3189-3p
  Forward 5′-CCGCGCCCTTGGGTCTGATG-3′
  Reverse 5′-ATCCAGTGCAGGGTCCGAGG-3′
  miRNA specific primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCC
hsa-miR-4527
  Forward 5′-AGCCGCGTGGTCTGCAAACACAT-3′
  Reverse 5′-ATCCAGTGCAGGGTCCGAGG-3′
  miRNA specific primer GTCGTATCCGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGTC

[i] miR, microRNA.

Differential miRNA target gene prediction

MirDB (version 5; http://www.mirdb.org) and TargetScan (version 7.1; http://www.targetscan.org) databases were used to predict and analyze the target genes of the abnormally expressed miRNAs. The final results from the prediction utilized the overlapping regions of the gene obtained between the two databases.

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses

The GO database (http://geneontology.org) includes molecular function, cellular component and biological processes as the three categories to stratify function. GO analysis was used to obtain the significantly enriched GO articles and corresponding genes in order to deduce the biological functions of DEmiRNAs in SCG.

Using the KEGG database (https://www.kegg.jp), the pathways most associated with the DEmiRNAs were determined.

Statistical analysis

SPSS software (version 20.0; IBM, Corp.) was used for statistical analysis. The results are expressed as the mean ± standard error of the mean. Unpaired Student's t-test was used to calculate the P-value between the normalized signals of the two sets of samples and the standardized signal values were used to calculate the FC (FC>2, P<0.05). A Fisher's exact test was used to identify which pathways and GO entries were significantly associated with the DEmiRNAs. P<0.05 was considered to indicate a statistically significant difference.

Results

Patient characteristics

A total of 10 patients with SCG, consisting of five patients with high-grade SCG and five patients with low-grade SCG were recruited. Blood samples were collected and staged according to the WHO (2016) classification of neurological tumors. Basic information on the patients, including age, sex and tumor location are presented in Table II.

Table II.

Clinical characteristics of the patients.

Table II.

Clinical characteristics of the patients.

Patient no.Age, yearsSexTumor pathology classificationTumor gradeTumor location
2534328FemaleGlioblastoma, NOSIVT10-L1
2660015MaleGlioblastoma, NOSIVC5-7
26600(2)17MaleGlioblastoma, NOSIVT1-5
2855314FemaleGlioblastoma, NOSIVT1-8
2837811MaleGlioblastoma, NOSIVT9-12
2605148MaleAstrocytoma, NOSIIC1-3
50635347FemaleAstrocytoma, NOSIIT5-7
51169145FemaleAstrocytoma, NOSIIC6-T1
2711017MaleHair cell astrocytomaIT1-2
50355013MaleHair cell astrocytomaIT1-4
138FemaleArnold-chiari deformityControlCraniotomy
236MaleAtlantoaxial dislocationControlC1-3
325FemaleAtlantoaxial dislocationControlC1-3
419FemaleHemifacial spasmControlCraniotomy
513MaleTraumaControlT1-3

[i] C, cervical; L, lumbar; T, thoracic; NOS, not otherwise specified.

DEmiRNAs in the blood of patients with SCG

Compared with the normal group, there were 156 upregulated miRNAs and 84 downregulated miRNAs (FC>2) in the low-grade SCG group (Table SI). Among these, seven upregulated miRNAs and 36 downregulated miRNAs were statistically significant (P<0.05; Tables III and IV). In the high-grade group, 251 upregulated miRNAs and 35 downregulated miRNAs were identified (FC>2). Of these, 70 upregulated and 20 downregulated miRNAs were statistically significant (P<0.05, FC>2; Table SII). The number of DEmiRNAs in the high-grade group was higher compared with the low-grade SCG group, in terms of the expression profiles of miRNAs in the blood of the tumor patients (Fig. 1A). The top 10 most upregulated and downregulated genes are listed in Tables V and VI.

Figure 1.

DEmiRNAs in arterial blood between the high-grade and low-grade SCG groups compared with the control group. Hierarchical clustering analysis of the differentially expressed miRNAs in the serum of patients with (A) high-grade or (B) low-grade SCG. FC>2; P<0.05; n=5. Expression values are expressed in different colors, red for upregulated expression and green for downregulated expression. Volcano plots constructed using the FC and P-values for patients with (C) low-grade and (D) high-grade SCG. The vertical line corresponds to a 2-fold up or downregulation of expression in the serum of both groups and the horizontal line represents the P-value. Red points represent DEmiRNAs with statistical significance whereas black points represent DEmiRNAs with no statistical significance. DEmiRNAs, differentially expressed microRNAs; SCG, spinal cord glioma; FC, fold change; I_II_B, low grade SCG; IV_B SCG, high grade.

Table III.

Upregulated miRNAs in the blood of patients with low grade spinal cord glioma.

Table III.

Upregulated miRNAs in the blood of patients with low grade spinal cord glioma.

Patient IDmiRNAFold changeP-value
168870hsa-miR-12462.12960.0002c
46808 hsa-miR-4485-3p14.77510.0013b
168558 hsa-miR-5585-3p2.58190.0072b
168568hsa-miR-12902.17570.0078b
147701hsa-miR-491-3p3.17540.0111a
46221 hsa-miR-519d-3p2.12410.0304a
148377 hsa-miR-3653-3p2.27350.0446a

a P<0.05

b P<0.01

c P<0.001. miR, microRNA.

Table IV.

Top 10 downregulated miRNAs in blood of patients with low grade spinal cord glioma.

Table IV.

Top 10 downregulated miRNAs in blood of patients with low grade spinal cord glioma.

Patient IDmiRNAFold change P-valuea
146159hsv1-miR-H4-3p0.14150.0237
147707hsa-miR-31540.14850.0130
147796hsa-miR-43270.16430.0375
11004 hsa-miR-203a-3p0.22810.0138
148278 hsa-miR-138-2-3p0.23550.0128
146163hsa-miR-224-3p0.24540.0375
46567hsa-miR-31760.24560.0248
147627hsa-miR-42940.27400.0199
169013 hsa-miR-5195-5p0.28490.0245
168684 hsa-miR-5010-5p0.29850.0248

a All P<0.05. miR, microRNA.

Table V.

Top 10 upregulated miRNAs in blood of patients with high grade glioma.

Table V.

Top 10 upregulated miRNAs in blood of patients with high grade glioma.

Patient IDmiRNAFold change P-valuea
169006hsa-miR-452714.72660.0274a
169029hsa-miR-44716.81630.0107a
42551hsa-miR-122-3p6.06840.0207a
169249 hsa-miR-4482-5p5.49770.0413a
42941 hsa-miR-218-1-3p5.30110.0396a
168860 hsa-miR-4766-5p5.10450.0381a
146157hsv1-miR-H4-5p4.59250.0274a
169223 hsa-miR-4680-3p4.43460.0256a
46808 hsa-miR-4485-3p4.33250.0254a
169369hsa-miR-44904.18750.0058b

a P<0.05

b P<0.001. miR, microRNA.

Table VI.

Top 10 downregulated miRNAs in blood of patients with high grade glioma.

Table VI.

Top 10 downregulated miRNAs in blood of patients with high grade glioma.

Patient IDmiRNAFold change P-valuea
147195hsa-miR-18a-5p0.27220.0249a
42956hsa-miR-545-5p0.27650.0123a
147334 hsa-miR-3613-5p0.28770.0152a
11053hsa-miR-32-5p0.35430.0472a
147845 hsa-miR-3173-3p0.35500.0015b
145968hsa-let-7d-5p0.37230.0014b
147817hsa-miR-31960.37550.0450a
148620hsa-miR-454-3p0.38250.0108a
42932hsa-miR-9200.39470.0000c
17752hsa-let-7f-5p0.40820.0415a

a P<0.05

b P<0.01

c P<0.001. miR, microRNA.

To validate the results of the microarray analysis, two DEmiRNAs were randomly chosen for RT-qPCR; miR-3189-3p was upregulated in both the low-grade and the high-grade group and miR-4527 was upregulated in the high-grade group. The results obtained from RT-qPCR were consistent with those of the microarray analysis and showed statistical significance (P<0.05; Fig. 2). All of the data on dysregulated expression of the DEmiRNAs identified are presented in Tables SI and SII.

Figure 2.

Validation of the microarray data using RT-qPCR. Comparison of the results from RT-qPCR and microarray analysis for miR-3189-3p and miR-4527. The results obtained from these two methods were consistent. n=6. RT-qPCR, reverse transcription quantitative PCR; miR, microRNA; SCG, spinal cord glioma.

Target prediction for the DEmiRNAs in the low-grade and high-grade groups

The top 18 and 20 miRNAs in the low-grade and high-grade groups, respectively, were selected for prediction of their target genes, based on the FC values for the DEmiRNAs. A total of 348 and 728 target genes for the upregulated and downregulated miRNAs, respectively in the low-grade group were identified (Table SIII). In addition, 772 and 1,731 target genes were predicted for the upregulated and downregulated miRNAs, respectively, in the high-grade group (Table SIV). The network diagram of the 4 downregulated miRNAs associated with spinal glioma development, and their target genes from the low-grade (hsa-miR-3154, hsa-miR-4327, hsa-miR-203a-3p and hsa-miR-138-2-3p) and high-grade (hsa-miR-18a-5p, hsa-miR-545-5p, hsa-miR-3613-5p and hsa-miR-32-5p) blood sample groups are presented in Figs. 3 and 4, respectively.

Figure 3.

Differentially expressed miRNA-mRNA networks of hsa-miR-3154, hsa-miR-4327, hsa-miR-203a-3p and hsa-miR-138-2-3p in patients with low grade spinal cord glioma. Square red nodes and round blue nodes represent downregulated miRNAs and mRNAs, respectively, and edges between two nodes represents an association. miR, microRNA.

Figure 4.

Differentially expressed miRNA-mRNA network of hsa-miR-18a-5p, hsa-miR-545-5p, hsa-miR-3613-5p and hsa-miR-32-5p in patients with high-grade spinal cord glioblastoma. The square, red nodes and the round, blue nodes represent the downregulated miRNAs and mRNAs, respectively, and edges between two nodes represent a potential link. miR, microRNA.

GO analysis of the DEmiRNAs in the low-grade and high-grade groups

GO analysis of the differentially expressed genes was performed. The results of the low-grade group showed that the coding genes adjacent to the downregulated miRNAs were primarily involved in the ‘negative regulation of biological process’ and ‘positive regulation of intracellular transport’, and the upregulated miRNAs were primarily enriched in ‘axon guidance’ and ‘neuron projection guidance’. In addition, the most enriched GO targets for the high-grade group were ‘regulation of cellular metabolic process’ (downregulated) and ‘axon development’ (upregulated) (Figs. 5 and 6; Tables SV and SVI).

Figure 5.

Top 10 enriched GO terms for the DEmiRNAs in the serum samples of patients with low-grade spinal cord glioblastoma. (A) Upregulated and (B) downregulated DEmiRNAs. The abscissa represents the GO term, from left to right, for the biological process, cellular component and molecular function. The ordinate indicates the GO term. GO, Gene Ontology; miRNA, microRNA; DEmiRNAs, differentially expressed miRNAs.

Figure 6.

Top 10 enriched GO terms for the DEmiRNAs in the serum samples of patients with high-grade spinal cord glioblastoma. (A) Upregulated and (B) Downregulated DEmiRNAs. The abscissa represents the GO term, from left to right, for the biological process, cellular component and molecular function. The ordinate indicates the GO term. GO, Gene Ontology; miRNA, microRNA; DEmiRNAs, differentially expressed miRNAs.

Pathway analysis of the DEmiRNAs in the low-grade and high-grade groups

Based on the KEGG database, the significance levels of the differentially expressed gene pathways were analyzed. Results showed that the downregulated miRNAs in the low-grade group were primarily involved in the ‘FoxO signaling pathway’, and the upregulated genes were primarily involved in ‘Osteoclast differentiation’ and the ‘Wnt signaling pathway’. Furthermore, the differentially expressed genes in the high-grade group were primarily involved in the ‘circadian rhythm’, ‘Longevity regulating pathway’, ‘mTOR signaling pathway’ and ‘Signaling pathways regulating pluripotency of stem cells’ (Fig. 7). The top 10 pathways in which the DEmiRNAs were involved in are listed in descending order of the enrichment factors in Fig. 7.

Figure 7.

Top 10 enriched pathways based on Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of the DEmiRNAs in SCG blood samples. Red represents upregulated miRNAs, while blue represents downregulated miRNAs and the size of the circle corresponds to the number of miRNAs. (A) Signaling pathways associated with upregulated DEmiRNAs in patients with low-grade SCG. (B) Downregulated DEmiRNAs in patients with low-grade SCG. (C) Upregulated DEmiRNAs in patients with high-grade SCG. (D) Downregulated DEmiRNAs in patients with high-grade SCG. miRNA, microRNA DE, differentially expressed; SCG, spinal cord glioma.

Similarities between identified DEmiRNAs in the low-grade and high-grade groups

To examine the differences in miRNA expression between the low-grade and high-grade groups, the DEmiRNA data for both groups were compared, and DEmiRNAs that were present in both groups were selected. A total of 27 upregulated miRNAs were present in the blood samples of both groups. Among these, the expression levels of 12 DEmiRNAs were higher in the low-grade group compared with the high-grade group, whereas the other 15 DEmiRNAs were more highly expressed in the high-grade group compared with the low-grade group (P<0.05; Table VII).

Table VII.

Co-expression of differentially expressed miRNAs between blood samples from patients with low-grade or high-grade spinal glioma.

Table VII.

Co-expression of differentially expressed miRNAs between blood samples from patients with low-grade or high-grade spinal glioma.

Patient IDmiRNALow grade, FCHigh grade, FC
42530 hsa-let-7a-2-3p3.250.9672.010.692
42551hsa-miR-122-3p5.070.0686.068.409
46633hsa-miR-12672.778.8443.180.956
46363hsa-miR-12722.277.3762.086.202
148536hsa-miR-1-5p2.235.5543.068.592
146165hsa-miR-19732.203.7962.687.838
148338 hsa-miR-3064-3p3.556.3033.537.826
147651hsa-miR-31234.102.2313.878.089
11058hsa-miR-3254.038.3912.888.924
11083 hsa-miR-371a-3p2.065.4783.602.984
168768 hsa-miR-4423-5p22.8592.520.848
169029hsa-miR-44711.165.3546.816.256
169247hsa-miR-4477a8.457.0663.624.097
168801hsa-miR-4477b8.578.1373.521.554
46808 hsa-miR-4485-3p1.477.5124.332.511
169369hsa-miR-44905.428.902418.754
168917hsa-miR-4511214.9712.591.108
29379hsa-miR-452-5p2.131.9563.120.335
169223 hsa-miR-4680-3p5.799.037443.464
169335 hsa-miR-4699-5p2.611.289325.914
168910 hsa-miR-4735-5p2.191.1872.564.797
169048hsa-miR-47362.331.1752.060.894
168860 hsa-miR-4766-5p4.579.3275.104.469
169154hsa-miR-48032.315.5422.705.104
168896 hsa-miR-548ao-3p2.169.1322.038.673
17626hsa-miR-5752.654.7892.269.628
33407hsa-miR-6263.676.4643.089.695

[i] FC, fold change; miR, microRNA.

Discussion

SCG is a tumor of the central nervous system with a relatively low incidence, accounting for 10% of all types of tumor of the entire spinal canal, with an annual incidence of ~0.22/100,000 in the USA (12). SCG occurrence and development are thought to be the result of the combined influence of genetic and environmental factors that are regulated by multiple genes. With developments in the fields of tumor molecular biology and molecular genetics, multiple molecular changes, including abnormal expression and mutations in miRNAs, have been discovered (13,14). These genetic changes may improve early diagnosis of cancer and typing and prognosis of patients. Therefore, the search for novel, sensitive and specific biomarkers associated with development of SCG are important for early diagnosis, prognostic evaluation and clinical treatment.

At present, a number of studies have focused on the role and abnormal expression of miRNAs in the progression of glioma, but there are fewer studies investigating specific miRNA expression profiles (15,16). The expression of miRNAs in peripheral blood has been associated with different types of tumor and tissue specificity, which has allowed them to be used as a diagnostic criterion (17). In the present study, miRNA microarray technology was used to compare the expression of miRNAs in the blood of patients with SCG with patients with a benign tumor. The miRNA expression profiles for the different grades of SCG were screened to identify differentially expressed miRNAs which may serve a role in the development of SCG, and thus may serve as biomarkers for specific stages of SCG.

In the present study, 43 and 90 miRNAs were abnormally expressed in the low-grade and high-grade groups, respectively, compared with the matched control group. Certain miRNAs were not abnormally expressed in the low-grade group, but were abnormally expressed in the high-grade group, and these miRNAs may be closely associated with malignant progression of SCG and may serve as useful biomarkers to aid in diagnosis and prognosis of patients. Additionally, whilst the majority of the abnormally expressed miRNAs identified in the low-grade and high-grade groups were different, 27 DEmiRNAs were observed in both groups. Therefore, it is hypothesized that these miRNAs may be involved in the pathogenesis of SCG and their specific mechanism of action will be the focus of future studies.

As an mRNA may be regulated by multiple miRNAs, and one miRNA may regulate multiple mRNAs (18), differentially expressed miRNAs from the low-grade and high-grade groups were selected to construct the miRNA-mRNA networks, enabling further investigation of potential associations at the mRNA and protein levels. Pathway knowledge can provide disease marker information crucial for diagnosis, drug choice and patient treatment (19). The GO and KEGG analysis of the target genes revealed that the target genes of these miRNAs were enriched in processes and signaling pathways associated with the nervous system and tumors. KEGG signaling pathway analysis revealed a number of target genes enriched in tumor-related signaling pathways, such as the FoxO, MAPK and Wnt signaling pathways. Abnormal activation of the Wnt signaling pathway is a ubiquitous change observed in numerous different types of cancer, including gliomas, and it affects the proliferation and invasion of glioma cells (20,21). Abnormalities in the MAPK signaling pathway serves a role in the invasion and metastasis of glioma cells and in the maintenance of biological processes, such as the dryness of glioma stem cells (22–25).

The DEmiRNAs investigated in the present study, some of which have been reported in previous studies, regulate the expression of protein-coding genes and affect several biological functions, serving a role in the occurrence and development of diseases. Studies have shown that miR-1246 may be involved in the development of autoimmune diseases and acts as a transfer messenger that leads to DNA damage by directly inhibiting the ligase 4 gene (26,27). The plasma expression levels of miR-1246 has been used as a diagnostic biomarker for hepatocellular carcinoma (28,29), and miR-1246 regulates the progression of breast and prostate cancer, highlighting the potential of miR-1246 in miRNA-based therapies (30,31). In the present study, the expression levels of hsa-miR-1246 were significantly higher in the low-grade group compared with the control group, demonstrating that hsa-miR-1246 expression levels are dysregulated in SCG and therefore highlighting hsa-miR-1246 as a potential target for treatment of SCG.

Several abnormally expressed miRNA molecules identified in the present study have not been reported in previous studies. In the present study, it was shown that miR-4680 was abnormally expressed in SCG, with high expression levels in both the low-grade and high-grade groups for the first time, to the best of our knowledge. Using TargetScan version 7.1, 137 potential target genes associated with miR-4680 were identified. A total of 348 target genes, based on miR-4680 were associated with gliomas, such as cyclin-dependent kinase 6 (CDK6) which is involved in survival of glioma cells (32). Following small interfering RNA mediated downregulation of CDK6 expression levels, tumor cells were arrested in the G1/S phase and cell proliferation was inhibited (32). These newly discovered and aberrantly expressed miRNAs may provide insight into the mechanisms underlying the development of SCG, and their role in SCG progression requires further investigation.

In conclusion, the present study compared DEmiRNAs in low-grade and high-grade groups with the control group and identified several miRNAs which may serve a role in the progression of SCG. These identified miRNAs may serve as novel biomarkers or molecular targets for clinical diagnosis and treatment of patients with SCG.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was funded by The National Natural Science Foundation of China (grant no. NSFC81774171), The Tangshan Science and Technology Innovation Team Training Program (grant nos. 18130219A and 19130201C) and The Collaborative innovation project of Chaoyang District in Beijing (grant no. CYXC1719).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding authors upon reasonable request.

Authors’ contributions

GJJ and TF designed the experiments. TA analyzed and interpreted the data. JL, XQZ, YXW, QSY, YFL and TA performed the experiments. CYC, CL, YQW, MHM and BHL interpreted the data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved and supervised by The Ethics Committees of Beijing University of Chinese Medicine and Sanbo Brain Hospital, Capital Medical University (Beijing, China). Written informed consent was obtained from all patients prior to the study start.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

miRNA

microRNA

SCG

spinal cord gliomas

GBM

glioblastoma

DEmiRNAs

differentially expressed miRNAs

DEgenes

differentially expressed genes

GO

gene ontology

BP

biological processes

KEGG

Kyoto Encyclopedia of Genes and Genomes

CDK6

cyclin-dependent kinase 6

FC

Fold change

References

1 

Louis DN, Perry A, Reifenberger G, von Deimling A, Figarella-Branger D, Cavenee WK, Ohgaki H, Wiestler OD, Kleihues P and Ellison DW: The 2016 World Health Organization classification of tumors of the central nervous system: A summary. Acta Neuropathol. 131:803–820. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Appin CL and Brat DJ: Molecular pathways in gliomagenesis and their relevance to neuropathologic diagnosis. Adv Anat Pathol. 22:50–58. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Tanaka S, Louis DN, Curry WT, Batchelor TT and Dietrich J: Diagnostic and therapeutic avenues for glioblastoma: No longer a dead end? Nat Rev Clin Oncol. 10:142013. View Article : Google Scholar : PubMed/NCBI

4 

Kalpathy-Cramer J, Gerstner ER, Emblem KE, Andronesi O and Rosen B: Advanced magnetic resonance imaging of the physical processes in human glioblastoma. Cancer Res. 74:4622–4637. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Dlouhá D and Hubáček JA: Regulatory RNAs and cardiovascular disease-with a special focus on circulating microRNAs. Physiol Res. 66 (Suppl 1):S21–S38. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Gregory RI and Shiekhattar R: MicroRNA biogenesis and cancer. Cancer Res. 65:3509–3512. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Xu HS, Zong HL, Shang M, Ming X, Zhao JP, Ma C and Cao L: MiR-324-5p inhibits proliferation of glioma by target regulation of GLI1. Eur Rev Med Pharmacol Sci. 18:828–832. 2014.PubMed/NCBI

8 

Duan R, Han L, Wang Q, Wei J, Chen L, Zhang J, Kang C and Wang L: HOXA13 is a potential GBM diagnostic marker and promotes glioma invasion by activating the Wnt and TGF-β pathways. Oncotarget. 6:27778–27793. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Cui R, Guan Y, Sun C, Chen L, Bao Y, Li G, Qiu B, Meng X, Pang C and Wang Y: A tumor-suppressive microRNA, miR-504, inhibits cell proliferation and promotes apoptosis by targeting FOXP1 in human glioma. Cancer Lett. 374:1–11. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Gu Y, Zhang Z, Yin J, Ye J, Song Y, Liu H, Xiong Y, Lu M, Zheng G and He Z: Epigenetic silencing of miR-493 increases the resistance to cisplatin in lung cancer by targeting tongue cancer resistance-related protein 1(TCRP1). J Exp Clin Cancer Res. 36:1142017. View Article : Google Scholar : PubMed/NCBI

11 

Mo FF, An T, Zhang ZJ, Liu YF, Liu HX, Pan YY, Miao JN, Zhao DD, Yang XY, Zhang DW, et al: Jiang Tang Xiao Ke Granule Play an anti-diabetic role in diabetic mice pancreatic tissue by regulating the mRNAs and MicroRNAs associated with PI3K-Akt signaling pathway. Front Pharmacol. 8:7952017. View Article : Google Scholar : PubMed/NCBI

12 

Milano MT, Johnson MD, Sul J, Mohile NA, Korones DN, Okunieff P and Walter KA: Primary spinal cord glioma: A surveillance, epidemiology, and end results database study. J Neurooncol. 98:83–92. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Jansen M, Yip S and Louis DN: Molecular pathology in adult gliomas: Diagnostic, prognostic, and predictive markers. Lancet Neurol. 9:717–726. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Riddick G and Fine HA: Integration and analysis of genome-scale data from gliomas. Nat Rev Neurol. 7:439–450. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Schratt GM, Tuebing F, Nigh EA, Kane CG, Sabatini ME, Kiebler M and Greenberg ME: A brain-specific microRNA regulates dendritic spine development. Nature. 439:283–289. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Davis-Dusenbery BN and Hata A: MicroRNA in cancer: The involvement of aberrant MicroRNA biogenesis regulatory pathways. Genes Cancer. 1:1100–1114. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Molina-Pinelo S, Suárez R, Pastor MD, Nogal A, Márquez-Martín E, Martín-Juan J, Carnero A and Paz-Ares L: Association between the miRNA signatures in plasma and bronchoalveolar fluid in respiratory pathologies. Dis Markers. 32:221–230. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Sud N, Zhang H, Pan K, Cheng X, Cui J and Su Q: Aberrant expression of microRNA induced by high-fructose diet: Implications in the pathogenesis of hyperlipidemia and hepatic insulin resistance. J Nutr Biochem. 43:125–131. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Jiang G, Ma Y, An T, Pan Y, Mo F, Zhao D, Liu Y, Miao JN, Gu YJ, Wang Y and Gao SH: Relationships of circular RNA with diabetes and depression. Sci Rep. 7:72852017. View Article : Google Scholar : PubMed/NCBI

20 

Wang K, Wang X, Zou J, Zhang A, Wan Y, Pu P, Song Z, Qian C, Chen Y, Yang S and Wang Y: miR-92b controls glioma proliferation and invasion through regulating Wnt/beta-catenin signaling via Nemo-like kinase. Neuro Oncol. 15:578–588. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Zhang H, Qi Y, Geng D, Shi Y, Wang X, Yu R and Zhou X: Expression profile and clinical significance of Wnt signaling in human gliomas. Oncol Lett. 15:6102018.PubMed/NCBI

22 

Guo G, Yao W, Zhang Q and Bo Y: Oleanolic acid suppresses migration and invasion of malignant glioma cells by inactivating MAPK/ERK signaling pathway. PLoS One. 8:e720792013. View Article : Google Scholar : PubMed/NCBI

23 

Dong L, Qi N, Ge RM, Cao CL, Lan F and Shen L: Overexpression of CD133 promotes the phosphorylation of Erk in U87MG human glioblastoma cells. Neurosci Lett. 484:210–214. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Wang BQ, Yang B, Yang HC, Wang JY, Hu S, Gao YS and Bu XY: MicroRNA-499a decelerates glioma cell proliferation while accelerating apoptosis through the suppression of Notch1 and the MAPK signaling pathway. Brain Res Bull. 142:96–106. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Wang R, Deng D, Shao N, Xu Y, Xue L, Peng Y, Liu Y and Zhi F: Evodiamine activates cellular apoptosis through suppressing PI3K/AKT and activating MAPK in glioma. Onco Targets Ther. 11:1183–1192. 2018. View Article : Google Scholar : PubMed/NCBI

26 

Ishibe Y, Kusaoi M, Murayama G, Nemoto T, Kon T, Ogasawara M, Kempe K, Yamaji K and Tamura N: Changes in the expression of circulating microRNAs in systemic lupus erythematosus patient blood plasma after passing through a plasma adsorption membrane. Ther Apher Dial. 22:278–289. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Mo LJ, Song M, Huang QH, Guan H, Liu XD, Xie DF, Huang B, Huang RX and Zhou PK: Exosome-packaged miR-1246 contributes to bystander DNA damage by targeting LIG4. Br J Cancer. 119:492–502. 2018. View Article : Google Scholar : PubMed/NCBI

28 

Moshiri F, Salvi A, Gramantieri L, Sangiovanni A, Guerriero P, De Petro G, Bassi C, Lupini L, Sattari A, Cheung D, et al: Circulating miR-106b-3p, miR-101-3p and miR-1246 as diagnostic biomarkers of hepatocellular carcinoma. Oncotarget. 9:15350–15364. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Wang Y, Zhang C, Zhang P, Guo G, Jiang T, Zhao X, Jiang J, Huang X, Tong H and Tian Y: Serum exosomal microRNAs combined with alpha-fetoprotein as diagnostic markers of hepatocellular carcinoma. Cancer Med. 7:1670–1679. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Bhagirath D, Yang TL, Bucay N, Sekhon K, Majid S, Shahryari V, Dahiya R, Tanaka Y and Saini S: MicroRNA-1246 is an exosomal biomarker for aggressive prostate cancer. Cancer Res. 78:1833–1844. 2018. View Article : Google Scholar : PubMed/NCBI

31 

Li XJ, Ren ZJ, Tang JH and Yu Q: Exosomal MicroRNA MiR-1246 promotes cell proliferation, invasion and drug resistance by targeting CCNG2 in breast cancer. Cell Physiol Biochem. 44:1741–1748. 2017. View Article : Google Scholar : PubMed/NCBI

32 

Chen SM, Chen HC, Chen SJ, Huang CY, Chen PY, Wu TW, Feng LY, Tsai HC, Lui TN, Hsueh C and Wei KC: MicroRNA-495 inhibits proliferation of glioblastoma multiforme cells by downregulating cyclin-dependent kinase 6. World J Surg Oncol. 11:872013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
An T, Zhang X, Liu Y, Lian J, Wu Y, Lv B, Liang C, Chen C, Yu Q, Ma M, Ma M, et al: Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades. Oncol Lett 20: 371, 2020.
APA
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B. ... Fan, T. (2020). Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades. Oncology Letters, 20, 371. https://doi.org/10.3892/ol.2020.12234
MLA
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B., Liang, C., Chen, C., Yu, Q., Ma, M., Wang, Y., Jiang, G., Fan, T."Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades". Oncology Letters 20.6 (2020): 371.
Chicago
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B., Liang, C., Chen, C., Yu, Q., Ma, M., Wang, Y., Jiang, G., Fan, T."Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades". Oncology Letters 20, no. 6 (2020): 371. https://doi.org/10.3892/ol.2020.12234
Copy and paste a formatted citation
x
Spandidos Publications style
An T, Zhang X, Liu Y, Lian J, Wu Y, Lv B, Liang C, Chen C, Yu Q, Ma M, Ma M, et al: Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades. Oncol Lett 20: 371, 2020.
APA
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B. ... Fan, T. (2020). Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades. Oncology Letters, 20, 371. https://doi.org/10.3892/ol.2020.12234
MLA
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B., Liang, C., Chen, C., Yu, Q., Ma, M., Wang, Y., Jiang, G., Fan, T."Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades". Oncology Letters 20.6 (2020): 371.
Chicago
An, T., Zhang, X., Liu, Y., Lian, J., Wu, Y., Lv, B., Liang, C., Chen, C., Yu, Q., Ma, M., Wang, Y., Jiang, G., Fan, T."Microarray analysis of aberrant microRNA expression patterns in spinal cord gliomas of different grades". Oncology Letters 20, no. 6 (2020): 371. https://doi.org/10.3892/ol.2020.12234
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team