Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
February-2021 Volume 21 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2021 Volume 21 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis in vitro and in vivo

  • Authors:
    • Jingjing Fan
    • Hua Jiang
    • Lin Cheng
    • Binlin Ma
    • Renbin Liu
  • View Affiliations / Copyright

    Affiliations: Department of Breast and Neck Surgery, Xinjiang Medical University Affiliated Tumor Hospital, Urumqi, Xinjiang 830011, P.R. China, Breast Cancer Center, Department of Breast and Thyroid Surgery, The Third Affiliated Hospital of Sun Yat‑sen University, Guangzhou, Guangdong 510630, P.R. China
    Copyright: © Fan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 99
    |
    Published online on: December 8, 2020
       https://doi.org/10.3892/ol.2020.12360
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The oncolytic herpes simplex virus (HSV) G47Δ can selectively eliminate glioblastoma cells via viral replication and temozolomide (TMZ) has been clinically used to treat glioblastoma. However, the combined effect of G47Δ and TMZ on cancer cells, particularly on breast cancer cells, remains largely unknown. The objective of the present study was to investigate the role and underlying mechanism of G47Δ and TMZ, in combination, in breast cancer cell tumorigenesis. The human breast cancer cell lines SK‑BR‑3 and MDA‑MB‑468 were treated with G47Δ and TMZ individually or in combination. Cell viability, flow cytometry, reverse transcription quantitative‑PCR and western blotting were performed to investigate the synergy between G47Δ and TMZ in regulating breast cancer cell behavior in vitro. The role of G47Δ and TMZ in suppressing tumorigenesis in vivo was investigated in a xenograft mouse model. G47Δ and TMZ served a synergistic role resulting in decreased breast cancer cell viability, induction of cell cycle arrest, promotion of tumor cell apoptosis and enhancement of DNA damage response in vitro. The combined administration of G47Δ and TMZ also effectively suppressed breast cancer cell‑derived tumor growth in vivo, compared with the administration of G47Δ or TMZ alone. Synergy between G47Δ and TMZ was at least partially mediated via TMZ‑induced acceleration of G47Δ replication, and such a synergy in breast cancer cells in vitro and in vivo provides novel insight into the future development of a therapeutic strategy against breast cancer.

Introduction

Breast cancer is the most common life-threatening cancer in women globally, with an annual rate of new cases reaching 126/100,000 women and a death rate of ~30% (1). Although conventional treatment options, including surgery, radiotherapy and chemotherapy, can successfully cure patients or prolong patient survival in the majority of cases, each of these therapies has limitations, such as the inability of surgery to eliminate distant metastasis, the lack of durable response to radiotherapy and drug resistance to chemotherapy (2). Therefore, there is an urgent need to develop new effective therapeutic approaches for breast cancer treatment.

Oncolytic viruses can selectively infect, replicate in, and kill cancer cells via induction of cancer cell lysis and the host immune response in infected cancer cells, which results from cancer antigen exposure in lysed cancer cells (3). Notably, oncolytic viruses do not harm healthy cells. Oncolytic virus-based therapy has been regarded as a potential novel therapeutic strategy for cancer treatment (4). Oncolytic viruses have been genetically engineered to improve both the safety of treatment and selectivity (5). Talimogene laherparepvec, a genetically modified herpes simplex virus (HSV), has been approved by the US Food and Drug Administration for clinical application in advanced melanoma therapy (6). Oncolytic HSV G47Δ is a third-generation replication-competent HSV-1 vector derived from G207 with the deletion of the infected cell protein 47 (ICP47) gene and both copies of the γ34.5 gene (7). G47Δ has been used to treat glioblastoma in clinical trials in Japan (7).

Temozolomide (TMZ) is an imidazotetrazine-derived alkylating agent used as a first-line oral drug for the treatment of malignant glioma because it is able to easily pass through the blood-brain barrier due to its low molecular weight and lipophilicity (8,9). In addition, TMZ has been used in clinical trials for the treatment of advanced metastatic melanoma (10,11). TMZ kills cancer cells via induction of DNA alkylation and methylation damage in cancer cells (12). However, certain types of cancer cells are able to repair TMZ-induced DNA damage, leading to resistance to TMZ, while the genetically modified oncolytic HSV has a decreased replication efficacy in cancer cells compared with naturally occurring HSV, which both decreased the anti-cancer efficacy of such therapies (13,14). Since the therapeutic targets of TMZ and HSV are different, a strategy using a combination of TMZ and HSV may notably enhance the efficacy of cancer therapy via a complementary mechanism.

The present study investigated the combined role of TMZ and G47Δ in regulating breast cancer cell behavior in vitro and in vivo, and a preliminary mechanism was also suggested. The results of the present study may provide valuable insight into the development of novel therapeutic approaches to treat breast cancer.

Materials and methods

Cell lines and culture

The human breast cancer cell lines SK-BR-3 and MDA-MB-468, as well as the African green monkey kidney epithelial cell line Vero, were gifts from Dr. Musheng Zeng (Sun Yat-sen University Cancer Center, Guangzhou, China). These cells were grown in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% inactivated fetal calf serum (FCS; Gibco; Thermo Fisher Scientific, Inc.), 100 IU/ml penicillin, 100 µg/ml streptomycin and 2 mM L-glutamine. All cells were maintained in a humidified incubator with 5% CO2 at 37°C.

Amplification of G47Δ

G47Δ was a gift from Dr. Samuel D. Rabkin (Harvard Medical School, Boston, MA, USA) and diluted in 1% inactivated FCS-containing PBS to infect Vero cells at a multiplicity of infection (MOI) of 0.03, followed by incubation under standard conditions (5% CO2 and 37°C) for 90 min. Viral inoculums were then removed and replaced with 3% inactivated FCS-containing DMEM, followed by incubation in 5% CO2 for 48–72 h at 34.5°C. Infected cells were collected when >90% of the cells appeared round and refractile under a light microscope (magnification, ×400) after calculation of 200 cells with two or more fused nuclei vs. the total nuclei (fused and un-fused nuclei) by two investigators and then resuspended in the virus buffer (20 mM Tris and 150 mM NaCl; pH 7.5). The resuspension solution was subjected to three rapid freeze-thaw cycles for cell lysis and virus release, followed by centrifugation at 500 × g and 4°C for 10 min. Next, the virus-containing supernatant was collected and stored in multiple aliquots at −80°C until use. The viral titer was determined via a plaque assay according to a previous studies (15,16).

Cell viability assay

SK-BR-3 and MDA-MB-468 cells were seeded into 6-well plates at a density of 3×105 cells/well and 37°C incubated for 24 h. The cells were then treated with 2 µl DMSO (mock), G47Δ (MOI, 0.01) and/or TMZ (6 mM for SK-BR-3 and 60 mM for MDA-MB-468; Sigma-Aldrich; Merck KGaA) and cultured in 2 ml DMEM containing 1% FCS at 37°C for 72 h. Next, 5 mg/ml MTT solution (Sigma-Aldrich; Merck KGaA) was added to each well, and the cell culture was incubated at 37°C for additional 4 h. The supernatant was removed carefully, and DMSO was added to dissolve the blue formazan crystals. The optical density was measured at 490 nm.

Chou-Talalay analysis of drug synergy

Chou-Talalay analysis (17,18) was performed to determine the combination index (CI) via assessment of the cell growth inhibition in G47Δ and/or TMZ-treated tumor cells using the following equation: CI=(D)1/(Dx)1 + (D)2/(Dx)2, where (Dx)1 is the dose of agent 1 (e.g. G47Δ) required to produce × percentage effect alone and (D)1 is the dose of agent 1 required to produce the same × percentage effect in combination with (D)2. Similarly, (Dx)2 is the dose of agent 2 (e.g. TMZ) required to produce × percentage effect alone and (D)2 is the dose required to produce the same effect in combination with (D)1. The denominators of the aforementioned CI equation, (Dx)1 and (Dx)2, can be determined by Dx=Dm[fa/(1-fa)]1/m, where Dm is the dose required for a 50% effect (e.g. 50% inhibition of cell growth), fa is the fraction affected by D (e.g. 0.5 if cell growth is inhibited by 50%), and m is the coefficient of sigmoidicity of the dose-effect curve. Different values of CI may be obtained to solve the equation for different values of fa (e.g. different degrees of inhibition of cell growth). CI<1 indicates synergy, CI>1 indicates antagonism and CI=1 indicates an additive effect. EnzFitter software, version 1.22 (Biosoft) was used to determine the CI values.

Flow cytometry

A preliminary experiment was performed using SK-BR3 and MDA-MB468 cells after treated with a single drug for 48 h to determine the IC50. Subsequently, these drug doses were used to assess the effects on tumor apoptosis. In brief, the cells were seeded into a 6-well plate at a density of 3×105 cells/well and cultured at 37°C for 24 h. The cells were then treated with 2 µl DMSO (control), G47Δ (MOI, 0.01), and/or TMZ (6 µM for SK-BR-3 and 60 µM for MDA-MB-468) in DMEM containing 1% FCS for 48 h or 72 h. For the cell cycle analysis, the cells were cultured for 72 h and then collected, washed with PBS three times and resuspended, followed by overnight fixation in 70% ethanol at 4°C. On the next day, the cells were incubated with RNase A at 37°C for 1 h and then stained with 1 µg/ml propidium iodide (PI) in the dark at 4°C for 30 min. Fluorescence of the stained cells was detected for cell cycle analysis via the flow cytometer FACSCanto II (BD Biosciences). The apoptosis assay was performed using an Annexin V PE/7AAD kit (BD Biosciences) according to the manufacturer's protocol. For apoptosis analysis, the cells were cultured for 48 h and then collected and incubated with 1 µg/ml FITC-Annexin V and PI in the dark at the room temperature for 10 min, and the fluorescent signals were analyzed using a FACSCanto II flow cytometer (BD Biosciences).

Reverse transcription-quantitative PCR (RT-qPCR)

SK-BR-3 and MDA-MB-468 cells were treated as aforementioned. Total RNA was isolated from cells using RNAiso Plus (Takara Biotechnology Co., Ltd.), according to the manufacturer's instructions. cDNA was synthesized via RT of RNA using PrimeScript RT Enzyme Mix and SuperScript™ III First-Strand Synthesis SuperMix (both Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The qPCR products were amplified in the 7500 Real-Time PCR system (Applied Biosystems, Foster city, CA, USA) using SYBR Premix Ex Taq (Invitrogen). The reaction conditions were: 93°C For 2 min, then 93°C for 1 min, 55°C for 2 min, for a total of 40 cycles. The primers used are presented in Table I. The relative RNA levels were determined using the 2−ΔΔCq (19) method and was normalized to β-actin.

Table I.

Gene-specific primers for quantitative PCR.

Table I.

Gene-specific primers for quantitative PCR.

GeneSequence, 5′-3′
ATMForward: ACTGGCCTTAGCAAATGC
Reverse: TTGCAGCCTCTGTTCGAT
ATRForward: TGTCTGTACTCTTCACGGCATGTT
Reverse: AAGAGGTCCACATGTCCGTGTT
H2AXForward: CAGTGCTGGAGTACCTCAC
Reverse: CTGGATGTTGGGCAGGAC
DNA-PKcForward: CTGTGCAACTTCACTAAGTCCA
Reverse: CAATCTGAGGACGAATTGCCTGADD34
GADD34Forward: GGAGGAAGAGAATCAAGCCA
Reverse: TGGGGTCGGAGCCTGAAGAT
RRM1Forward: TGGCCTTGTACCGATGCTG
Reverse: GCTGCTCTTCCTTTCCTGTGTT
RRM2Forward: GCGATTTAGCCAAGAAGTTCAGAT
Reverse: CCCAGTCTGCCTTCTTCTTGA
β-actinForward: TGGCACCCAGCACAATGAA
Reverse: CTAAGTCATAGTCCGCCTAGAAGCA

[i] H2AX, histone H2AX; GADD34, growth arrest and DNA damage-inducible protein GADD34; DNA-PKc, DNA-dependent protein kinase, catalytic subunit; RRM, ribonucleotide reductase catalytic subunit M1; RRM2, ribonucleotide reductase catalytic subunit M2.

Western blotting

Cells were harvested and lysed in the ice-cold radioimmunoprecipitation assay buffer containing 50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 0.5% SDS, 1 mM PMSF, 1 mM Na3VO4, and 0.1% β-mercaptoethanol after centrifugation at the top speed 8,000 × g for 10 min at 4°C. The protein concentration was determined via the bicinchoninic acid assay. Protein samples (20 µg each loading) were loaded and separated by SDS-PAGE in 10% gels, and were then transferred onto nitrocellulose membranes. The membranes were then blocked in 5% bovine serum albumin (BSA; Sigma-Aldrich; Merck KGaA) in Tris-based saline 0.05% Tween 20 (TBS-T) for 1 h at room temperature, followed by overnight incubation with primary antibodies [histone H2AX (H2AX; 1:1,000; cat. no. ab229914), γH2AX (1:1,000; cat. no. ab243906), ATR (1:1,000; cat. no. ab2905), ATM (1:1,000; cat. no. ab32420), DNA-dependent protein kinase, catalytic subunit (DNA-PKc; 1:1,000; cat. no. ab32566), growth arrest and DNA damage-inducible protein GADD34 (GADD34; 1:500; cat. no. ab126075), or β-actin (1:1,000; cat. no. ab8227); all from Abcam] at 4°C. Then, membranes were washed three times with TBST and incubated with horseradish peroxidase-conjugated goad anti-mouse IgG (H&L) (Cat. #ab6789, Abcam) or rabbit anti-human IgG (H&L) (Cat. #ab6759, Abcam; both at a dilution of 1:10,000) for 1 h at room temperature. After three washes with TBST, the protein bands were detected using enhanced chemiluminescence reagents (cat no. #35055; Pierce; Thermo Fisher Scientific, Inc.). The western blot imagines were captured and quantified by using a GBOX XT-16 chemiluminescent imager (Syngene) after 20-min exposure of the membranes.

Animal experiments

All animal procedures were approved by the Institutional Animal Care and Use Committee of The Third Affiliated Hospital of Sun Yat-sen University (approval no. 11400700083061). Female BALB/c nude mice with 4 weeks of age and 14–16 g body weight were housed in clean cages and maintained in specific pathogen-free ‘barrier’ facility with the controlled temperature at 23°C, the relative humidity of 40–70%, and a 12-h light/dark cycle with free access to food and water. The mice were acclimated for 7 days before the experiments. A total of 28 mice were randomly divided into four groups (n=7/group): Mock, G47Δ, TMZ and G47Δ + TMZ. Mice were intraperitoneally anesthetized with ketamine-xylazine, followed by subcutaneous inoculation with 1×106 SK-BR-3 cells in the right hindlimb. Tumor growth was monitored daily, and tumor size was measured every 4 days using a Vernier caliper. The tumor volume was calculated as a × b2/2, where a is the longest and b is the shortest tumor diameter. When the longest tumor diameter reached ~5 mm, TMZ and/or G47Δ was administered to the mice, except for those in the Mock group. For the TMZ group, TMZ was intraperitoneally administered once a week at a dose of 50 mg/kg. For the G47Δ group, G47Δ was injected intratumorally once every 3 days for a total of four times at a dose of 1×106 pfu/mouse. In the G47Δ plus TMZ group, TMZ and G47Δ were administered in combination in the aforementioned manner. The mice were sacrificed 60 days after inoculation or when the longest tumor diameter reached 18 mm via CO2 and cervical dislocation and all tumor xenografts were taken and analyzed using different assays (see details in the corresponding methods parts).

Statistical analysis

The data were expressed as the mean ± standard deviation of the triplicated experiments and were statistically analyzed using SPSS software (version 13.0; SPSS, Inc.). Comparisons between two groups were conducted using the Student's t-test and Pearson correlation analysis was used to assess correlation. Comparisons of multiple groups was analyzed using the one-way ANOVA followed by Bonferroni's correction. P<0.05 was considered to indicate a statistically significant difference.

Results

G47Δ and TMZ synergistically inhibit breast cancer cell viability in vitro

In order to investigate the combined effect of G47Δ and TMZ on breast cancer cells, the individual effects of G47Δ and TMZ on the viability of SK-BR-3 and MDA-MB-468 cells were assessed. Treatment with G47Δ or TMZ alone inhibited viability of SK-BR-3 and MDA-MB-468 cells in a dose-dependent manner, with median effective doses (ED50) of 0.09 and 0.20 MOI for G47Δ, and 36.6 and 171.9 µM for TMZ in SK-BR-3 and MDA-MB-468 cells, respectively (Fig. 1A and B). G47Δ and TMZ in combination further suppressed breast cancer cell viability in a dose-dependent manner, compared with G47Δ or TMZ alone (Fig. 1C and D), indicating a potential synergy between G47Δ and TMZ in inhibiting cell viability. In order to determine whether synergy existed between G47Δ and TMZ, the Chou-Talalay analysis was performed for multiple G47Δ/TMZ ratios. CI was 0.39–0.74 (CI, <0.9) in SK-BR-3 cells and 0.64–0.85 (CI, <0.9) in MDA-MB-468 cells (Fig. 1E and F). These results indicated that G47Δ and TMZ exhibited a synergistic inhibitory effect on breast cancer cell growth.

Figure 1.

Synergistic inhibitory effect of G47Δ and TMZ on breast cancer cell viability. The individual effect of (A) G47Δ or (B) TMZ on the proliferation of SK-BR-3 and MDA-MB-468 cells at different doses was assessed via MTT assay. The combined effect of G47Δ and TMZ on the viability of (C) MDA-MB-468 and (D) SK-BR-3 cells at different doses was determined via MTT assay. The synergistic effect between G47Δ and TMZ on inhibition of (E) MDA-MB-468 and (F) SK-BR-3 cell viability was determined via Chou-Talalay analysis. *P<0.05. TMZ, temozolomide; CI, combination index; MOI mulplicity of infection.

G47Δ and TMZ synergistically induce breast cancer cell cycle arrest in vitro

Cell cycle progression is associated with cell division and growth (20). The combined effect of G47Δ and TMZ on inhibition of breast cancer cell cycle progression was investigated. G47Δ treatment alone induced SK-BR-3 and MDA-MB-468 cell cycle arrest at the G0/G1 phase of the cell cycle (52.1±2.1 and 58.9±3.6%, respectively), whereas TMZ alone induced SK-BR-3 and MDA-MB-468 cell cycle arrest at the G2/M phase (39.9±3.7 and 30.2±4.1%, respectively) (Fig. 2). By contrast, a combination of G47Δ and TMZ notably arrested the cell cycle at the G0/G1 phase in SK-BR-3 cells (71.4±1.0 vs. G47Δ 52.1±2.1%; P=0.003) and at the G2/M phase in MDA-MB-468 cells (41.5±2.0 vs. TMZ 30.2±4.1%; P=0.012). These data indicated that G47Δ and TMZ in combination exhibited a more significant suppressive effect on breast cancer cell cycle progression than G47Δ or TMZ alone, suggesting a synergy between G47Δ and TMZ in the induction of breast cancer cell cycle arrest.

Figure 2.

Synergistic inductive effect of G47Δ and TMZ on breast cancer cell cycle arrest. (A) Cell cycle was analyzed via flow cytometry. Histograms are presented for the cell cycle analysis of (B) MDA-MB-468 and (C) SK-BR-3 cells following treatment with G47Δ and TMZ individually or in combination for 72 h. *P<0.05. TMZ, temozolomide; G+T, G47Δ + TMZ.

G47Δ and TMZ synergistically promote breast cancer cell apoptosis in vitro

Cell apoptosis is a key process during tumor development (21). Therefore, it was investigated whether G47Δ and TMZ may exhibit a synergistic effect on breast cancer cell apoptosis. G47Δ and TMZ individually markedly induced SK-BR-3 cell apoptosis, compared with the mock control group (37.10±2.30 and 25.50±2.60 vs. 1.70±0.26%, respectively) (Fig. 3). Combined G47Δ and TMZ significantly promoted SK-BR-3 cell apoptosis (59.60±2.25 vs. 37.10±2.30 and 25.50±2.60%; both P<0.05). Similarly, a combination of G47Δ and TMZ further enhanced MDA-MB-468 cell apoptosis (40.2±1.1 vs. 25.1±4.4 and 24.4±5.1%, respectively; both P<0.05 vs. control group). Collectively, these data suggested that G47Δ and TMZ synergistically decreased tumor cell proliferation via induction of breast cancer cell apoptosis.

Figure 3.

Synergistic inductive effect of G47Δ and TMZ on breast cancer cell apoptosis. Cell apoptosis was analyzed in (A) MDA-MB-468 and (B) SK-BR-3 cells treated with G47Δ and TMZ individually or in combination for 48 h via flow cytometry. Apoptotic rates of (C) MDA-MB-468 and (D) SK-BR-3 cells treated with G47Δ and TMZ individually or in combination were quantified. *P<0.05. TMZ, temozolomide; PI, propidium iodide; G+T, G47Δ + TMZ.

G47Δ and TMZ synergistically regulate the expression levels of DNA damage-associated genes in breast cancer cells

Cell cycle arrest and apoptosis are triggered by DNA damage in cells (22). Therefore, it was determined whether G47Δ and TMZ serve a synergistic role in induction of DNA damage in breast cancer cells. The results showed that G47Δ or TMZ alone induced expression of γH2AX protein but not the H2AX mRNA level; γH2AX is a sensitive molecular marker of DNA double-strand breaks (23), in SK-BR-3 cells (Figs. 4 and 5). G47Δ and TMZ in combination further augmented the individual effect of G47Δ or TMZ on the mRNA and protein expression levels of H2AX and γH2AX, respectively. In addition, G47Δ and TMZ in combination notably promoted G47Δ- or TMZ-induced expression levels of GADD34, TM, DNA-PKc, RRM1, RRM2, and ATR, which are key DNA damage response genes (24). Similar results were also observed in MDA-MB-468 cells (Figs. 4 and 5). These findings indicated that G47Δ and TMZ synergistically upregulated the expression levels of DNA damage-associated genes, and may thus induce DNA damage and trigger the DNA damage response, which in turn leads to breast cancer cell cycle arrest and apoptosis (Fig. 3).

Figure 4.

Synergistic inductive effect of G47Δ and TMZ on DNA damage in breast cancer cells. Reverse transcription-quantitative PCR was performed to assess the expression levels of DNA damage-associated genes in (A and B) SK-BR-3 and (C and D) MDA-MB-468 cells following treatment with G47Δ and TMZ individually or in combination for 48 h. *P<0.05. TMZ, temozolomide; H2AX, histone H2AX; GADD34, growth arrest and DNA damage-inducible protein GADD34; DNA-PKc, DNA-dependent protein kinase, catalytic subunit.

Figure 5.

Synergistic inductive effect of G47Δ and TMZ on DNA damage in breast cancer cells. Western blotting was used to detect expression levels of the indicated DNA damage-associated proteins in (A) SK-BR-3 and (B) MDA-MB-468 cells following treatment with G47Δ and TMZ individually or in combination for 48 h. Semi-quantification of (C) SK-BR-3 and (D) MDA-MB-468 western blotting results. *P<0.05. TMZ, temozolomide; H2AX, histone H2AX; GADD34, growth arrest and DNA damage-inducible protein GADD34; DNA-PKc, DNA-dependent protein kinase, catalytic subunit.

G47Δ and TMZ synergistically suppress breast cancer cell-derived tumor growth in vivo

In order to further investigate the combined role of G47Δ and TMZ in breast cancer cell tumorigenesis in vivo, a breast cancer xenograft model was established by inoculating SK-BR-3 cells into nude mice, which were then treated with G47Δ and TMZ individually or in combination. As shown in Fig. 6, G47Δ or TMZ alone significantly decreased the size of SK-BR-3 cell-derived tumor xenografts in a time-dependent manner, compared with the mock group [519.0±133.3 (n=6) and 591.3±41.8 (n=7) vs. 1,402.3±375.3 mm3 (n=6) at 36 days after inoculation, respectively; both P<0.05]. A combination of G47Δ and TMZ further enhanced the inhibitory effect of individual G47Δ or TMZ on tumor growth [125.0±7.6 (n=7) vs. 519.0±133.3 (n=6) and 591.3±41.8 mm3 (n=7) at 36 days after inoculation, respectively; both P<0.05 vs. control group]. These data indicated that combined treatment with G47Δ and TMZ decreased breast cancer cell-derived tumor growth more effectively than treatment with G47Δ or TMZ alone, suggesting a synergy between G47Δ and TMZ in suppressing breast cancer cell tumorigenesis in vivo.

Figure 6.

Synergistic inhibitory effect of G47Δ and TMZ on breast cancer cell tumorigenesis in vivo. Female nude mice (age, 4 weeks) were inoculated with SK-BR-3 cells, followed by treatment with G47Δ and TMZ individually or in combination when tumor xenografts reached 5 mm in the longest diameter. The tumor size was measured every 4 days after tumor cell inoculation. (A) Tumor xenografts. (B) Tumor volume. *P<0.05 vs. mock control. TMZ, temozolomide; G+T, G47Δ and TMZ.

TMZ accelerates G47Δ replication in vitro

The mechanism underlying the synergistic inhibitory effect of G47Δ and TMZ on breast cancer cell tumorigenesis was further investigated. The yield of G47Δ increased in a time-dependent manner in SK-BR-3 and MDA-MB-468 cells treated with G47Δ and TMZ together, compared with that in cells treated with G47Δ alone (Fig. 7). These findings indicated that a synergy between G47Δ and TMZ in inhibiting breast cancer cell tumorigenesis may be at least partially due to acceleration of G47Δ replication by TMZ.

Figure 7.

TMZ promotion of G47Δ replication. (A) SK-BR-3 and (B) MDA-MB-468 cells were cultured for 24 h and then treated with G47Δ alone in combination with TMZ for the indicated periods of time. G47Δ was then collected to determine the viral titer via plaque assay. *P<0.05 using Student's t-test. TMZ, temozolomide.

Discussion

Genetically modified replication-competent oncolytic HVS strains have been used as oncolytic virus therapy in which cancer cells are killed via a direct oncolytic effect of the virus and induction of host immunity (25). However, due to the highly attenuated replication ability of these genetically altered viruses, including HSV G47Δ, oncolytic virus therapy is commonly used in combination with chemotherapy or radiotherapy to improve the efficiency of cancer treatment.

In the present study, the combination of G47Δ and TMZ induced stronger cytotoxicity than G47Δ or TMZ alone in breast cancer cells. This synergy is likely due to the distinct mechanisms of G47Δ and TMZ in killing breast cancer cells. For example, TMZ induces cancer cell DNA damage/repair, as evidenced by TMZ-induced upregulation of the DNA damage response genes ATR and GADD34. By contrast, G47Δ replicates in and lyses cancer cells. A previous study demonstrated that TMZ-induced DNA repair notably enhanced HSV-mediated oncolysis in primary brain tumor cells via promotion of HSV replication (26). Therefore, TMZ treatment may induce the sensitivity of breast cancer cells to G47Δ infection, resulting in accelerated G47Δ replication and augmented cancer cell lysis. The present study confirmed that TMZ may promote G47Δ replication in breast cancer cells in vitro.

The present study also demonstrated that G47Δ and TMZ in combination synergistically induced breast cancer cell apoptosis. A previous study demonstrated that HSV can induce robust apoptosis of TMZ-resistant glioma cells both in vitro and in vivo, indicating synergy between G47Δ and TMZ (27). DNA damage promotes cell apoptosis if such DNA damage is not repaired (22,28,29). In TMZ-resistant breast cancer, repairing TMZ-induced DNA damage promotes G47Δ replication in breast cancer cells. These cells are lysed, triggering the host immune response and resulting in cytokine-induced cancer cell apoptosis (30). In addition, the synergistic role of G47Δ and TMZ in DNA damage may interfere with DNA replication in breast cancer cells, further affecting cancer cell division. The present study demonstrated that G47Δ and TMZ exhibited a synergistic effect on induction of breast cancer cell cycle arrest. The cell cycle was arrested at different phases in SK-BR-3 and MDA-MB-468 cells, which is likely due to the different genetic background between these two cell lines (31).

The synergy between G47Δ and TMZ in regulation of breast cancer cell behavior was further verified in a nude mouse xenograft model. The in vivo synergy in inhibition of breast cancer cell-derived tumor xenograft growth may be due to the effects of treatments on breast cancer cell viability, apoptosis, cycle arrest and DNA damage/repair. The present study may provide valuable information for the potential clinical application of G47Δ and TMZ in breast cancer treatment.

However, the present study has certain limitations. For example, although the combined effect of G47Δ and TMZ on breast cancer cell behaviors (due to acceleration of G47Δ replication by TMZ) was demonstrated, the underlying mechanism by which TMZ promoted G47Δ replication was not investigated in detail. Moreover, it was not assessed whether G47Δ may serve a role in increasing the sensitivity of breast cancer cells to TMZ. The present study also did not identify the optimal dose combination of G47Δ and TMZ to suppress breast cancer cell tumorigenesis in vitro and in vivo. Finally, clinical or preclinical data were not available to assess the therapeutic value of G47Δ and TMZ in combination for breast cancer development and progression, although previous studies have demonstrated anti-breast cancer activity in vitro (32–34). Further investigation is required to elucidate these points. In conclusion, the present study demonstrated that the combined administration of G47Δ and TMZ effectively suppressed breast cancer cell-derived tumor growth in vivo, compared with the administration of G47Δ or TMZ alone. Synergy between G47Δ and TMZ was at least partially mediated via TMZ-induced acceleration of G47Δ replication, and such a synergy in breast cancer cells in vitro and in vivo provides novel insight into the future development of a therapeutic strategy against breast cancer.

Acknowledgements

Not applicable.

Funding

The present study was funded in part by a grant from the Xinjiang Medical University Research and Innovation Fund Project (grant no. XYDCX201677).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JF and RL designed the research. JF performed the main experiments and drafted the paper. HJ participated in the construction of the animal models. LC analyzed the data. BM participated the study design, interpreted the data and prepared the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal procedures were approved by the Institutional Animal Care and Use Committee of The Third Affiliated Hospital of Sun Yat-sen University (approval no. 11400700083061).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

TMZ

temozolomide

HSV

herpes simplex virus

MOI

multiplicity of infection

CI

combination index

References

1 

Shah R, Rosso K and Nathanson SD: Pathogenesis, prevention, diagnosis and treatment of breast cancer. World J Clin Oncol. 5:283–298. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Tinoco G, Warsch S, Gluck S, Avancha K and Montero AJ: Treating breast cancer in the 21st century: Emerging biological therapies. J Cancer. 4:117–132. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Lou E: Oncolytic herpes viruses as a potential mechanism for cancer therapy. Acta Oncol. 42:660–671. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Chiocca EA and Rabkin SD: Oncolytic viruses and their application to cancer immunotherapy. Cancer Immunol Res. 2:295–300. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Burke J, Nieva J, Borad MJ and Breitbach CJ: Oncolytic viruses: Perspectives on clinical development. Curr Opin Virol. 13:55–60. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Rehman H, Silk AW, Kane MP and Kaufman HL: Into the clinic: Talimogene laherparepvec (T-VEC), a first-in-class intratumoral oncolytic viral therapy. J Immunother Cancer. 4:532016. View Article : Google Scholar : PubMed/NCBI

7 

Fukuhara H, Ino Y and Todo T: Oncolytic virus therapy: A new era of cancer treatment at dawn. Cancer Sci. 107:1373–1379. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Mannas JP, Lightner DD, Defrates SR, Pittman T and Villano JL: Long-term treatment with temozolomide in malignant glioma. J Clin Neurosci. 21:121–123. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Sengupta S, Marrinan J, Frishman C and Sampath P: Impact of temozolomide on immune response during malignant glioma chemotherapy. Clin Dev Immunol. 2012:8310902012. View Article : Google Scholar : PubMed/NCBI

10 

Bafaloukos D, Tsoutsos D, Kalofonos H, Chalkidou S, Panagiotou P, Linardou E, Briassoulis E, Efstathiou E, Polyzos A, Fountzilas G, et al: Temozolomide and cisplatin versus temozolomide in patients with advanced melanoma: A randomized phase II study of the hellenic cooperative oncology group. Ann Oncol. 16:950–957. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Dronca RS, Allred JB, Perez DG, Nevala WK, Lieser EA, Thompson M, Maples WJ, Creagan ET, Pockaj BA, Kaur JS, et al: Phase II study of temozolomide (TMZ) and everolimus (RAD001) therapy for metastatic melanoma: A north central cancer treatment group study, N0675. Am J Clin Oncol. 37:369–376. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Zhang J, Stevens MF and Bradshaw TD: Temozolomide: Mechanisms of action, repair and resistance. Curr Mol Pharmacol. 5:102–114. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Kondo N, Takahashi A, Mori E, Noda T, Zdzienicka MZ, Thompson LH, Helleday T, Suzuki M, Kinashi Y, Masunaga S, et al: FANCD1/BRCA2 plays predominant role in the repair of DNA damage induced by ACNU or TMZ. PLoS One. 6:e196592011. View Article : Google Scholar : PubMed/NCBI

14 

Fu X, Tao L, Wang PY, Cripe TP and Zhang X: Comparison of infectivity and spread between HSV-1 and HSV-2 based oncolytic viruses on tumor cells with different receptor expression profiles. Oncotarget. 9:21348–21358. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Baer A and Kehn-Hall K: Viral concentration determination through plaque assays: Using traditional and novel overlay systems. J Vis Exp. e520652014.PubMed/NCBI

16 

Han C and Yang C: Viral plaque analysis on a wide field-of-view, time-lapse, on-chip imaging platform. Analyst. 139:3727–3734. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Chou TC: The median-effect principle and the combination index for quantitation of synergism and antagonism. Chou TC and Rideout DC: Synergism and antagonism in chemotherapy. Academic Press; San Diego: pp. 61–102. 1991

18 

Khafif A, Schantz SP, Chou TC, Edelstein D and Sacks PG: Quantitation of chemopreventive synergism between (−)-epigallocatechin-3-gallate and curcumin in normal, premalignant and malignant human oral epithelial cells. Carcinogenesis. 19:419–424. 1998. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Vallin J and Grantham J: The role of the molecular chaperone CCT in protein folding and mediation of cytoskeleton-associated processes: Implications for cancer cell biology. Cell Stress Chaperones. 24:17–27. 2019. View Article : Google Scholar : PubMed/NCBI

21 

Morata G and Ballesteros-Arias L: Cell competition, apoptosis and tumour development. Int J Dev Biol. 59:79–86. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Roos WP and Kaina B: DNA damage-induced cell death by apoptosis. Trends Mol Med. 12:440–450. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Mah LJ, El-Osta A and Karagiannis TC: gammaH2AX: A sensitive molecular marker of DNA damage and repair. Leukemia. 24:679–686. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Thomas SE, Malzer E, Ordóñez A, Dalton LE, van't Wout EF, Liniker E, Crowther DC, Lomas DA and Marciniak SJ: p53 and translation attenuation regulate distinct cell cycle checkpoints during endoplasmic reticulum (ER) stress. J Biol Chem. 288:7606–7617. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Watanabe D: Medical application of herpes simplex virus. J Dermatol Sci. 57:75–82. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Aghi M, Rabkin S and Martuza RL: Effect of chemotherapy-induced DNA repair on oncolytic herpes simplex viral replication. J Natl Cancer Inst. 98:38–50. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Jahan N, Lee JM, Shah K and Wakimoto H: Therapeutic targeting of chemoresistant and recurrent glioblastoma stem cells with a proapoptotic variant of oncolytic herpes simplex virus. Int J Cancer. 141:1671–1681. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Norbury CJ and Zhivotovsky B: DNA damage-induced apoptosis. Oncogene. 23:2797–2808. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Borges HL, Linden R and Wang JY: DNA damage-induced cell death: Lessons from the central nervous system. Cell Res. 18:17–26. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Prestwich RJ, Errington F, Diaz RM, Pandha HS, Harrington KJ, Melcher AA and Vile RG: The case of oncolytic viruses versus the immune system: Waiting on the judgment of Solomon. Hum Gene Ther. 20:1119–1132. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Holliday DL and Speirs V: Choosing the right cell line for breast cancer research. Breast Cancer Res. 13:2152011. View Article : Google Scholar : PubMed/NCBI

32 

Melisko ME, Assefa M, Hwang J, DeLuca A, Park JW and Rugo HS: Phase II study of irinotecan and temozolomide in breast cancer patients with progressing central nervous system disease. Breast Cancer Res Treat. 177:401–408. 2019. View Article : Google Scholar : PubMed/NCBI

33 

Bobustuc GC, Kassam AB, Rovin RA, Jeudy S, Smith JS, Isley B, Singh M, Paranjpe A, Srivenugopal KS and Konduri SD: MGMT inhibition in ER positive breast cancer leads to CDC2, TOP2A, AURKB, CDC20, KIF20A, Cyclin A2, Cyclin B2, Cyclin D1, ERα and Survivin inhibition and enhances response to temozolomide. Oncotarget. 9:29727–29742. 2018. View Article : Google Scholar : PubMed/NCBI

34 

Garza-Morales R, Gonzalez-Ramos R, Chiba A, Montes de Oca-Luna R, McNally LR, McMasters KM and Gomez-Gutierrez JG: Temozolomide enhances triple-negative breast cancer virotherapy in vitro. Cancers (Basel). 10:1442018. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fan J, Jiang H, Cheng L, Ma B and Liu R: Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>. Oncol Lett 21: 99, 2021.
APA
Fan, J., Jiang, H., Cheng, L., Ma, B., & Liu, R. (2021). Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>. Oncology Letters, 21, 99. https://doi.org/10.3892/ol.2020.12360
MLA
Fan, J., Jiang, H., Cheng, L., Ma, B., Liu, R."Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>". Oncology Letters 21.2 (2021): 99.
Chicago
Fan, J., Jiang, H., Cheng, L., Ma, B., Liu, R."Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>". Oncology Letters 21, no. 2 (2021): 99. https://doi.org/10.3892/ol.2020.12360
Copy and paste a formatted citation
x
Spandidos Publications style
Fan J, Jiang H, Cheng L, Ma B and Liu R: Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>. Oncol Lett 21: 99, 2021.
APA
Fan, J., Jiang, H., Cheng, L., Ma, B., & Liu, R. (2021). Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>. Oncology Letters, 21, 99. https://doi.org/10.3892/ol.2020.12360
MLA
Fan, J., Jiang, H., Cheng, L., Ma, B., Liu, R."Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>". Oncology Letters 21.2 (2021): 99.
Chicago
Fan, J., Jiang, H., Cheng, L., Ma, B., Liu, R."Oncolytic herpes simplex virus and temozolomide synergistically inhibit breast cancer cell tumorigenesis <em>in vitro</em> and <em>in vivo</em>". Oncology Letters 21, no. 2 (2021): 99. https://doi.org/10.3892/ol.2020.12360
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team