Expression of canonical transient receptor potential channels in U-2 OS and MNNG-HOS osteosarcoma cell lines

  • Authors:
    • Florian Lässig
    • Anja Klann
    • Sander Bekeschus
    • Uwe Lendeckel
    • Carmen Wolke
  • View Affiliations

  • Published online on: February 21, 2021     https://doi.org/10.3892/ol.2021.12568
  • Article Number: 307
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

In U-2 OS and MNNG-HOS osteosarcoma cells, small interfering RNA-mediated knockdown of the angiotensin-(1-7) receptor, Mas, increases cell proliferation. Whether alterations in canonical transient receptor potential channels (TRPC) expression contribute to this effect is not clear. In the present study, a basic description of TRPC subtype expression in osteosarcoma cell lines was provided. The pharmacological modulators of the angiotensin-(1-7) receptor, Mas, AVE0991 (agonist), or D-Ala7-Ang-(1-7) (antagonist) were applied to elucidate a possible role of Mas in the regulation of TRPC mRNA levels. The contribution of other G-protein coupled receptors (GPCR) or receptor tyrosine kinases to TRCP expression was studied by applying the selective pharmacological blockers of either PI3 kinase or MEK/Erk1/2 signaling, Ly294002 and PD98059. AVE0991 and D-Ala7-Ang-(1-7) exhibited no or marginal effects on TRPC mRNA expression. Ly294002 provoked a 9.6- and 5.9-fold increase in the amounts of TRPC5 mRNA in MNNG-HOS and U-2 OS cells, respectively. Additionally, Ly294002 increased TRPC6 mRNA levels; however, it had no effect on TRPCs 1, 3 and 4. Administration of PD98059 increased the amounts of TRPC6 and TRPC4 ~2-fold. In conclusion, the present study demonstrated that Mas-dependent alterations in osteosarcoma cell line proliferation were not mediated by any changes in TRPC subtype gene expression. The data shows in principle, and consistent with the literature, that the signaling pathways examined can regulate the expression of TRPCs at the mRNA level. Therefore, direct and signaling pathway-specific pharmacological targeting of TRPC subtypes may represent an option for improving the treatment of osteosarcoma.

Introduction

Canonical transient receptor potential (TRPC) channels are non-selective cation channels that are permeable to Ca2+ and, thus, under both physiological and pathological conditions facilitate Ca2+ entry into the cell. In humans, there are seven TRPCs known which can be divided into subgroups according to their degree of homology: C1/C4/C5, C3/C6/C7 and the inactive pseudogene C2 (1,2). TRPC channels exhibit baseline activity, which, however, can be increased via stimulation of G-protein coupled receptors (GPCR) or receptor tyrosine kinases. In this way, receptor agonist-dependent activation of Gq-PLC signal transduction pathways leading to IP3-mediated Ca2+ release from internal stores (SR; ER) represents the main mechanism of generating intracellular Ca2+ transients in non-excitable cells via potentially any TRPC expressed. TRPCs are known to form heteromers in a large variety of cell types, which adds another level of complexity to the existing TRP network and complicates functional analyses. Ca2+ transients activate a variety of cellular effector processes, including proliferation, apoptosis, mitochondrial function, metabolism, migration, invasion and angiogenesis (1,3,4). Furthermore, TRPC expression is altered in tumor tissue when compared to non-malignant tissue [reviewed in ref. 1]. Against this background, it is not surprising that TRPC channels have been linked to the development and progression of cancer and represent promising targets for the pharmacological treatment of different tumor entities (59). Although the importance of calcium for the proliferation of osteosarcoma cells is well established (10,11), data on the expression and role of TRPC in osteosarcoma is scarce. It could be demonstrated in various cell models that TRPCs are involved in store operated calcium entry (SOCE) (12) and TRPC1 is one of the major components involved here (13). In line with the crucial role of Ca2+ for cytoskeletal reorganization, migration, differentiation, survival and apoptosis, and polarization, various TRPC members have been implicated in all these processes. Pharmacological inhibition or knock-down of TRPC1 was shown to reduce cell polarization of U-2 OS osteosarcoma cell line (14). It has been shown that the TRP family, including subfamilies TRPC, TRPM, and TRPV is highly expressed in human and murine osteosarcoma cell lines (15). Human osteosarcoma cell lines including U-2 OS were shown to share abundant expression of the TRPC members TRPC1, TRPC3 and TRPC6 (15).

We have shown previously that the alternative axis of the renin-angiotensin-system (RAS), ACE2/angiotensin-(17)/Mas, is expressed and functional in U-2 OS and MNNG-HOS osteosarcoma cell lines. The knock-down of Mas substantially increased the proliferation of both cell lines (16). Whether calcium transients mediate these effects on osteosarcoma proliferation is not clear. Mas has been associated with G protein-mediated Ca2+-signaling in Mas-transfected HEK293 cells (17), but other signaling pathways such as MAPK and PI3K may well contribute to Mas-dependent alterations in osteosarcoma cell proliferation or TRPC expression. In this study, we provide a basic description of TRPC expression in both osteosarcoma cell lines and, in addition, address the question if the angiotensin-(17) receptor, Mas, is involved in the regulation of TRPC expression in osteosarcoma and if this has functional implications for cell migration. Furthermore, the contribution of other GPCRs or receptor tyrosine kinases to the regulation of TRCP expression is studied by applying the selective pharmacological blockers of either PI3 kinase or MEK/Erk1/2 signaling, Ly294002 and PD98059.

Materials and methods

Cell culture

The osteosarcoma cell lines U-2 OS and MNNG-HOS were purchased from the American Type Culture Collection (ATCC). U-2 OS cells were maintained in McCoys 5A medium (PAA) and MNNG-HOS in MEM with Earles Salt (Gibco; Thermo Fisher Scientific, Inc.), both supplemented with 10% fetal calf serum, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C in a 5% CO2 humidified atmosphere. Cells were free from contamination with mycoplasma, as concluded from negative results obtained in regularly performed testing by means of the PCR Mycoplasma Testkit I/C (PromoCell).

Identification of cell lines was performed using the PowerPlex® 21 System (Promega) and the software GeneMapper® ID-X v1.4 (Applied Biosystems; Thermo Fisher Scientific, Inc.), allowing automatic identification of the gender marker amelogenin and 20 highly polymorphic chromosomal markers (short tandem repeats) by fluorescent multiplex PCR. This marker panel was used to control an eventual sample mix-up or contamination during cell culture. Amelogenin and the eight STR markers incl. the specific alleles [CSF1PO, D13S317, D16S539, D5S818, D7S820, TH01, TPOX, vWA] are published for the cell lines U-2 OS (ATCC® HTB-96™) and MNNG/HOS Cl #5 [R-1059-D] (ATCC® CRL-1547™) in the American Type Culture Collection (ATCC) database (www.ATCC.org). The pattern of these eight markers observed in our cell lines corresponded to the published alleles.

RNA preparation and reverse transcription-quantitative PCR (RT-qPCR)

For experiments to investigate the influence of the Mas receptor agonist, AVE0991 (1 µM; kindly provided by Sanofi-Aventis) or D-Ala7-(Ang(1–7) (A779) (1 µM, Sigma-Aldrich; Merck KGaA), on mRNA expression, the cells were seeded at a density of 5×105 cells/well of a 6-well plate in a final volume of 3 ml for 24 h. The dosage is based on previous studies in which 1 µM was identified to be the lowest effective dose with which insulin secretion from isolated islets can be maximally stimulated (18). RNA was prepared using the innuPrep RNA Mini Kit (Analytik Jena) according to the manufacturers instructions. cDNA synthesis and RT-qPCR were performed in a CFX96 thermocycler (Bio-Rad Laboratories) as described recently (19). Quantitative analysis was performed using ΔΔCq-method (20) included in the CFX Maestro RT-qPCR detection system software (Bio-Rad Laboratories). Size and purity of the PCR amplificates was determined by melt curve analysis. The amounts of mRNA were normalized to α-tubulin mRNA. The relative expression levels of the individual TRPCs were compared on the basis of their Cq values using a calibration curve. Assuming 100% PCR efficiency, 3.3 cycles lower Cq values correspond to a 10-fold higher number of mRNA copies. Primers were designed with the aid of NCBIs Primer Designer and were obtained from Invitrogen (Thermo Fisher Scientific, Inc.). Primer-sequences [downstream (DS) and upstream (US)], size of amplified DNA fragments in base pairs (bp), and the optimized annealing temperatures are listed in Table I.

Table I.

Primers used for reverse transcription-quantitative PCR.

Table I.

Primers used for reverse transcription-quantitative PCR.

PrimerSequence (53)Amplicon size, bpAnnealing temperature, °C
Mas-DS CAATGCCGACTGGTACTTG40762
Mas-US ACATCTCACTGGCAGGAAC
TRPC1-DS CTGACAACCGTAGTCCAAAAG17760
TRPC1-US TTCTTGCTGGCGTGCGACAAG
TRPC3-DS GTCATTCTTGAACTCCTTCTC49260
TRPC3-US AAGAAGGAGAACCTGGCGCG
TRPC4-DS CTGCTTATCAAGGAGTATAGGA12656
TRPC4-US GTCTATGTTGGAGATGCTCTAT
TRPC5-DS GTTGTAACTTGTTCTTCCTGTC21056
TRPC5-US CAGTGAGGTAGAATTAGGTGAA
TRPC6-DS CCATCGTAACATTATAGACTCC19155
TRPC6-US GTTCAATCTCTACTCCTACTAC
TRPC7-DS GAACTTCCATTCCACATCTG19464
TRPC7-US GGTCCATATTCGGCTTATCT
α-tubulin-DS CATTTCACCATCTGTTGGCTGGCTC52858
α-tubulin-US CACCCGTCTTCAGGGTTCTTGGTTT

[i] TRPC, canonical transient receptor potential channels; DS, downstream; US, upstream.

Cell migration assay

Cells were seeded at a density of 2×103 per well into 96-well plates (Eppendorf). After the cells were allowed to adhere, drugs (10 nM AVE0991, 1 µM D-Ala7-(Ang(1–7), 3.5 µM Pyr 3 (Bio-Techne GmbH) and 35 µM AC1903 (Bio-Techne GmbH) or vehicle controls were added as indicated. Cell migration was analyzed using live-cell imaging and a high-content imaging device (Operetta CLS; PerkinElmer) every 20 min for at least 6 h at 37°C and 5% CO2. The culture plates have a rim that can be filled with water to protect the cells from evaporation during live-cell imaging. Image acquisition was made using a 10× air (NA: 0.3) objective (Carl Zeiss). For each well, four fields of view were acquired. Image analysis was done by segmenting cells based on their digital phase-contrast signal intensity, followed by removing border objects and the calculation of kinetic properties based on signal overlaps between adjacent time points. For each well, approximately 500 cells were included in the analysis, which was done using Harmony 4.9 quantitative image analysis software algorithms (PerkinElmer).

Statistical analysis

Mann-Whitney tests were applied in the case of n ≥4 when two groups were compared. When three or more groups were compared, ANOVA was used prior to the use of Tukeys post hoc test. Non-parametric data were illustrated as boxplots with medians, quartiles, and an interquartile range (IQR) ± 1.5 × IQR with outliers as indicated (Tukeys method). P-values <0.05 were considered significant. All analyses were performed using GraphPad Prism version 6.03 (Graphpad Software, Inc.).

Results

TRPC family members and Mas are expressed in U-2 OS and MNNG-HOS cells

First, the expression of all human TRPC isoforms was analyzed at the mRNA level in both U-2 OS and MNNG-HOS cells under basic conditions by means of RT-qPCR. TRPCs 1, 3, 4, 5, 6 and 7 mRNAs could be detected in comparable amounts in both cell lines. As illustrated in Fig. 1A, a single amplicon of the expected size was obtained for any TRPC isoform as confirmed by agarose gel electrophoresis as well as the melting curve obtained as part of the PCR protocol (data not shown). The level of expression of the individual TRPC isoforms is very different, but the ‘TRPC profile’ shows extensive similarity between the two cell lines (Fig. 1B). By far the highest mRNA levels could be detected for TRPC1 followed by TRPC6. TRPCs 3, 4 and 5 appeared to be moderately expressed (Fig. 1B). RT-qPCR analysis of TRPC7 provided Cq-values >38 in both cell lines and, thus, this isoform is regarded as practically not expressed in MNNG-HOS and U-2 OS cells.

Next, before studying the effects of the Mas agonist, AVE0991 or of the antagonist, D-Ala7-Ang-(17) (A779), on TRPC expression, mRNA expression of the Ang-(17) receptor, Mas, was confirmed by RT-qPCR. As previously observed (13) and shown in Fig. 2A, Mas mRNA could be detected in both U-2 OS and MNNG-HOS cells, with MNNG-HOS cells showing stronger expression levels than U-2 OS. In MNNG-HOS cells, the administration of AVE0991 led to a significant [3.35 (1.57; 7.16), p<0.001] increase in Mas-mRNA levels (Fig. 2B). In U-2 OS cells, there was no such increase in Mas mRNA {1.4 [1.29 (0.39; 3.89)], p=0.92} (Fig. 2C). However, in response to the Mas receptor antagonist, D-Ala7-Ang-(17), both MNNG-HOS and U-2 OS showed an induction of Mas mRNA expression [3.25 (0.83; 5.97), p<0.05 or 2.41 (1.05; 5.42), p=0.12] (Fig. 2B and C).

Effects of AVE0991 or D-Ala7-Ang-(1–7) on the mRNA expression of TRPC family members

Next, the possible effects of a 24-h exposure of U-2 OS and MNNG-HOS cells to the Mas receptor agonist, AVE0991, or the antagonist D-Ala7-Ang-(17) on TRPC mRNA levels were investigated. In general, Mas receptor ligands provoked no or only minor alterations in TRPC mRNA expression, as summarized in Fig. 3 (AVE0991) and Fig. 4 (D-Ala7-Ang-(17). In MNNG-HOS cells, AVE0991 led to a non-significant elevation of TRPC5 mRNA levels by 70%, whereas in U-2 OS cells, a small but significant increase in amounts of TRPC3 mRNA could be observed [1.2 (0.85; 2.13), p<0.05].

D-Ala7-Ang-(17) provoked a small but significant decrease of TRCP5 mRNA amounts in MNNG-HOS cells [0.73 (0.61; 1.38), p<0.05].

Effects of Ly294002 and PD98059 on the mRNA expression of TRPC family members

The exposure of MNNG-HOS and U-2 OS osteosarcoma cells to the selective pathway inhibitors Ly294002 or PD98059, respectively, led to substantial alterations in the mRNA expression levels of individual TRPC family members.

In detail, Ly294002 provoked a profound and highly significant increase in TRPC5 mRNA amounts in both MNNG-HOS [9.6 (2.192; 11.68), p<0.0001] and U-2 OS cells [5.87 (1.32; 16.52) p<0.001]. Slightly weaker were the stimulatory effects of Ly294002 on the expression of TRPC6 in both cell lines; MNNG-HOS: 1.87[0.93; 5.27] p<0.05, U-2 OS: 2.72 [1.64; 3.38], p<0.05. In contrast, the compound did not affect the mRNA levels of TRPC1, 3 and 4 (Fig. 5).

In MNNG-HOS cells, the administration of PD98059 led to an about 2.07-fold increase in mRNA levels of TRPC4 2.07 [1.13; 4.95], p<0.01; and of TRPC6: 1.83 [1.04;4.90], p<0.05 (Fig. 6A). An increase of TRPC4 and TRPC6 mRNA amounts in U-2 OS cells did not reach statistical significance (Fig. 6B). A small but significant increase in TRPC3 mRNA amounts could be observed in U-2 OS cells: 1.29 [1.02; 2.44], p<0.05, whereas in MNNG HOS cells, this effect is only hinted at.

Effects of Ly294002 and PD98059 on the Mas mRNA expression

The administration of Ly294002 provoked a very consistent 2.4-fold increase of Mas mRNA amounts in both MNNG-HOS [2.212 (1.72; 2.89), p<0.05] and U-2 OS cells [2.38 (1.70; 4.11), p<0.001]. A similar increase could be observed in response to PD98059. Whereas a 2.1-fold increase [2.1 (1.28; 3.33), p<0.05] in Mas mRNA amounts could be observed in U-2 OS cells, a 1.4-fold [1.38 (0.93; 2.26), p=0.08] increase in MNNG-HOS cells could be observed as a tendency only (Fig. 7).

Effects of AVE0991 or D-Ala7-Ang-(1–7) and TRPC inhibitors AC1903 or Pyr3 on the migration of MNNG-HOS and U-2 OS cells

The administration of Ang-(17) has been previously shown to reduce cell migration of U-2 OS cells without affecting that of MNNG-HOS cells in a Cultrex® 24 Well Cell Migration Assay (16). In the present assay, this could be observed here as a tendency only: U-2 OS cells showed slightly less migration upon exposure to the Mas receptor agonist, AVE0991, and slightly increased migration when exposed to the antagonist, D-Ala7-Ang-(17) (A779; Fig. 8B). To assess the possible contribution of Mas-dependent TRPC activity modulation to alterations in cell migration, the inhibitors of TRPC5 or TRPC3, AC1903 or Pyr3, respectively, were applied alone or in combination with AVE0991 or A779.

In MNNG-HOS cells, the TRPC5 inhibitor, AC1903, on its own or in combination with A779 or AVE0991 did not affect cell migration (Fig. 8A). However, administration of the TRPC3 inhibitor, Pyr3, significantly increased migration [Pyr3: 30.0 (28.6; 34.6) vs. DMSO: 25.8 (24.8; 27.48), p<0.05], an effect that could be further increased by simultaneous administration of AVE0991 [Pyr3+AVE0991: 33.7 (31.9; 35.6), P=0.087 vs. Pyr3].

As shown in Fig. 8B, AC1903, although not affecting U-2 OS migration per se, caused a significant decrease of migration when applied together with A779. The administration of Pyr3 significantly reduced the migration of U-2 OS cells, an effect that could be prevented by the simultaneous administration of AVE0991.

Discussion

TRPCs transform various stimuli into appropriate cellular responses involving functions such as proliferation, migration, and survival. These processes are of paramount importance for normal growth, repair, and tissue homeostasis, and therefore their dysregulation is a feature typically observed during tumorigenesis and tumor progression. TRPCs have been associated with various diseases and, in particular, with cancer. With respect to the latter, altered expression, subcellular localization, and gene mutations of TRPC subtypes have been reported for an increasing number of tumor entities, including glioma as well as lung, breast, prostate, gastric, and hepatic cancer (reviewed in references 1,21-23). The abnormal regulation of the intracellular calcium balance certainly plays a major role here, but additional cellular processes, aside of enhancing Ca2+ entry, have been identified (22). Reinforcing this phenomenon, TRPC activity and/or expression could be modulated by inadequate signal input from aberrant GPCR or growth factor receptor activation in normal and (pre-)malignant cells. This has been observed for e.g. TRPC6, the membrane expression and activity of which appeared to be regulated by epidermal growth factor (EGF) receptor stimulation (24). Mechanistically, a number of different signal transduction pathways mediate TRPC signaling including extracellular signal-regulated kinase Erk1/2, calcium/calmodulin-dependent protein kinase IIα (CaMKIIα), and calpain (21,25). Furthermore, TRPCs 3, 4 and 5 have all been shown to contribute to cancer angiogenesis through modulating VEGF pathway (26,27).

For cancer in general it is well established that dysregulation of Ca2+ signaling promotes tumor initiation, progression, metastasis, and angiogenesis (22). Little is known about the pathological relevance of dysregulated TRPC expression or activity specifically in osteosarcoma. It was previously shown that the knock-down of the GPCR, Mas, decreased the proliferation of MNNG-HOS and U-2 OS cells. In the present study, we examined the specific question of whether and to what extent this effect can be attributed to a Mas-dependent change in the TRPC expression. In addition, we investigated whether signaling pathways typically activated by GPCR or receptor tyrosine kinases are, in principle, able to influence TRPC expression in osteosarcoma cells. Selective inhibitors of the MEK/ERK1/2 and PI3 kinase signaling pathways, PD98059 and Ly294002, were used for this purpose.

The results of the present study show that neither the Mas receptor agonist, AVE0991 nor the antagonist, D-Ala7-Ang-(17), caused substantial changes in TRPC expression. The principle effectiveness of both compounds under the conditions applied was reflected in the marked change in the Mas-mRNA concentrations they provoked in both osteosarcoma cell lines. From this, it can be concluded that Mas-dependent regulation of osteosarcoma cell proliferation is not due to altered TRPC expression. However, the TRPC inhibitors applied here were capable of modulating effects of AVE0991 and A779 on osteosarcoma cell migration, which strongly implies that Mas-receptor signaling is associated with TRPC activity (rather than expression), and migration in osteosarcoma cell lines. Supporting this view are reports demonstrating: i) a cAMP-dependent increase in stimulated TRPC6 cation currents in TRPC6-expressing HEK293 cells, which could be diminished by LY294002 or PD 98059 (28); and ii) the increase of cAMP in response to Mas receptor agonists such as Ang-(17) observed in different cells (18,29).

The increase in Mas mRNA levels in response to the antagonist very likely reflects a direct compensatory feedback mechanism, the equanimous effect of the non-peptide agonist can be explained as a similar response to functional desensitization following rapid activation of Mas (17).

The results of our study further show that inhibition of either PI3 kinase or MEK/Erk1/2 signal transduction provokes substantial changes in the mRNA expression of distinct TRPC subtypes. The administration of Ly294002 caused the strongest changes in the amounts of TRPC5-mRNA, which were induced 9.6-fold and 5.9-fold, respectively. In comparison, the induction of TRCP6 was less pronounced, whereas mRNA levels of TRPCs 1, 3 and 4 remained completely unaffected. The contribution of PI3 kinase signaling to TRPC6 expression has been described by others previously. However, in podocytes, vascular endothelial growth factor (VEGF) appeared to increase TRPC6 mRNA and protein levels, and this effect could be blocked by PI3 kinase inhibitors, including Ly294002 (30). As a more general mechanism, hormonal stimuli and growth factors via activation of TRPC activity and Ca2+ influx contribute to down-stream activation of MEK/Erk1/2 or PI3 kinase signaling (21,31). This has been shown for e.g. TRPC6 in hippocampal neurons and PC12 cells (32) and for TRPC3 in DT40 B-cells (33).

In the osteosarcoma cell lines MNNG-HOS and U-2 OS, the administration of the MEK/Erk inhibitor, PD98059, increased mRNA levels of TRPC6 whereas that of TRPC4 and TRPC3 appeared to be affected only in one of the cell lines. Erk-dependent alterations in TRPC subtype expression have been observed by others in pulmonary arterial smooth muscle cells (34). Exposure of these cells to bone morphogenetic protein (BMP) 4 increased TRPC1, TRPC4 and TRPC6 expression, and this effect was abolished by pharmacological inhibition (PD98059) as well as by siRNA-mediated knock-down of Erk1/2 (34).

Our data consistently show a stimulatory effect of the pathway inhibitors on TRPC mRNA expression, which is inconsistent with the observations of other groups described before. It could be speculated, however, that different cell types react differently. In any case, this even applies to osteosarcoma cell lines from different species that differ in terms of their TRPC expression profile (14). Furthermore, each cell type has its special equipment with G-protein-coupled receptors (GPCRs), which can then result in very unique context- and stimulus-dependent activation patterns of TRPCs. It could be speculated that it is this difference in GPCRs that led to the different responses partially observed here for U-2 OS and MNNG HOS, a finding that reflects quite well the challenge posed with treating patients with ‘individual’ osteosarcoma. In our experiments, cells were exposed to the action of the inhibitors for a relatively long time, namely 24 h. During this time, stimulatory feedback mechanisms may already be at play.

In accordance with a previous report (16), it could be demonstrated that the Mas receptor agonist AVE0991 negatively regulates U-2 OS cell migration, but is significantly increased in response to the Mas receptor antagonist A779.

In summary, the present study shows that Mas-dependent alterations in osteosarcoma cell line proliferation are not mediated by any changes in TRPC subtype gene expression. However, available data suggest that there are Mas-mediated changes in TRPC activity. TRPC activities have not been studied here, which is a clear limitation of our study. Another limitation is the use of only two cell lines, however, the previous observation that human osteosarcoma exhibit similar TRPC expression profiles (14) could be confirmed here. The results of our study show in principle and consistent with the literature, that: i) members of the TRPC family are abundantly expressed in osteosarcoma cell lines; and ii) that the cAMP-PI3K-PKB-MEK-ERK1/2 signaling pathway examined can regulate the expression of TRPCs at the level of mRNA and may well contribute to Mas-dependent changes of TRPC activity and related functions including cell migration. TRPCs potential relevance for diagnosis and, in particular, direct or signaling pathway-targeted treatment of osteosarcoma needs to be elucidated in further studies.

Acknowledgements

The authors would like to thank Mrs. Manja Möller and Mrs. Ines Schultz (Institute of Medical Biochemistry and Molecular Biology, University Medicine Greifswald, Greifswald, Germany) for their technical assistance.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors contributions

FL, SB, AK and CW performed the experiments. CW and UL were responsible for confirming the authenticity of all the raw data. FL, SB, AK, UL and CW conducted the data analyses. FL, CW and UL wrote the manuscript. UL and CW designed the study and planned experiments. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Gautier M, Dhennin-Duthille I, Ay AS, Rybarczyk P, Korichneva I and Ouadid-Ahidouch H: New insights into pharmacological tools to TR(i)P cancer up. Br J Pharmacol. 171:2582–2592. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Wu LJ, Sweet TB and Clapham DE: International Union of Basic and Clinical Pharmacology. LXXVI. Current progress in the mammalian TRP ion channel family. Pharmacol Rev. 62:381–404. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Capiod T: The need for calcium channels in cell proliferation. Recent Patents Anticancer Drug Discov. 8:4–17. 2013. View Article : Google Scholar

4 

Hodeify R, Yu F, Courjaret R, Nader N, Dib M, Sun L, Adap E, Hubrack S and Machaca K: Regulation and role of store-operated Ca2+ entry in cellular proliferation. Calcium entry channels in non-excitable cells. Kozak JA and Putney JW Jr: CRC Press/Taylor & Francis; Boca Raton, FL: pp. 215–240. 2018

5 

Bomben VC and Sontheimer HW: Inhibition of transient receptor potential canonical channels impairs cytokinesis in human malignant gliomas. Cell Prolif. 41:98–121. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Cai R, Ding X, Zhou K, Shi Y, Ge R, Ren G, Jin Y and Wang Y: Blockade of TRPC6 channels induced G2/M phase arrest and suppressed growth in human gastric cancer cells. Int J Cancer. 125:2281–2287. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Hwang JA, Hwang MK, Jang Y, Lee EJ, Kim JE, Oh MH, Shin DJ, Lim S, Ji G, Oh U, et al: 20-O-β-d-glucopyranosyl-20(S)-protopanaxadiol, a metabolite of ginseng, inhibits colon cancer growth by targeting TRPC channel-mediated calcium influx. J Nutr Biochem. 24:1096–1104. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Jiang HN, Zeng B, Zhang Y, Daskoulidou N, Fan H, Qu JM and Xu SZ: Involvement of TRPC channels in lung cancer cell differentiation and the correlation analysis in human non-small cell lung cancer. PLoS One. 8:e676372013. View Article : Google Scholar : PubMed/NCBI

9 

Gaunt HJ, Vasudev NS and Beech DJ: Transient receptor potential canonical 4 and 5 proteins as targets in cancer therapeutics. Eur Biophys J. 45:611–620. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Huang Z, Fan G and Wang D: Downregulation of calbindin 1, a calcium-binding protein, reduces the proliferation of osteosarcoma cells. Oncol Lett. 13:3727–3733. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Wang Y, Yang Z, Meng Z, Cao H, Zhu G, Liu T and Wang X: Knockdown of TRPM8 suppresses cancer malignancy and enhances epirubicin-induced apoptosis in human osteosarcoma cells. Int J Biol Sci. 10:90–102. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Berna-Erro A, Redondo PC and Rosado JA: Store-operated Ca2+ entry. Adv Exp Med Biol. 740:349–382. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Clapham DE, Runnels LW and Strübing C: The TRP ion channel family. Nat Rev Neurosci. 2:387–396. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Huang YW, Chang SJ, Harn HI, Huang HT, Lin HH, Shen MR, Tang MJ and Chiu WT: Mechanosensitive store-operated calcium entry regulates the formation of cell polarity. J Cell Physiol. 230:2086–2097. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Abed E, Labelle D, Martineau C, Loghin A and Moreau R: Expression of transient receptor potential (TRP) channels in human and murine osteoblast-like cells. Mol Membr Biol. 26:146–158. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Ender SA, Dallmer A, Lässig F, Lendeckel U and Wolke C: Expression and function of the ACE2/angiotensin(1–7)/Mas axis in osteosarcoma cell lines U-2 OS and MNNG-HOS. Mol Med Rep. 10:804–810. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Tirupula KC, Desnoyer R, Speth RC and Karnik SS: Atypical signaling and functional desensitization response of MAS receptor to peptide ligands. PLoS One. 9:e1035202014. View Article : Google Scholar : PubMed/NCBI

18 

Sahr A, Wolke C, Maczewsky J, Krippeit-Drews P, Tetzner A, Drews G, Venz S, Gürtler S, van den Brandt J, Berg S, et al: The angiotensin-(1–7)/Mas axis improves pancreatic β-cell function in vitro and in vivo. Endocrinology. 157:4677–4690. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Chilukoti RK, Mostertz J, Bukowska A, Aderkast C, Felix SB, Busch M, Völker U, Goette A, Wolke C, Homuth G, et al: Effects of irbesartan on gene expression revealed by transcriptome analysis of left atrial tissue in a porcine model of acute rapid pacing in vivo. Int J Cardiol. 168:2100–2108. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔC(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Chen J, Luan Y, Yu R, Zhang Z, Zhang J and Wang W: Transient receptor potential (TRP) channels, promising potential diagnostic and therapeutic tools for cancer. Biosci Trends. 8:1–10. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Bacsa B, Tiapko O, Stockner T and Groschner K: Mechanisms and significance of Ca2+ entry through TRPC channels. Curr Opin Physiol. 17:25–33. 2020. View Article : Google Scholar : PubMed/NCBI

23 

Chen X, Sooch G, Demaree IS, White FA and Obukhov AG: Transient receptor potential canonical (TRPC) channels: Then and now. Cells. 9:2020. View Article : Google Scholar

24 

Odell AF, Scott JL and Van Helden DF: Epidermal growth factor induces tyrosine phosphorylation, membrane insertion, and activation of transient receptor potential channel 4. J Biol Chem. 280:37974–37987. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Xu J, Wang H, Hu Y, Zhang YS, Wen L, Yin F, Wang Z, Zhang Y, Li S, Miao Y, et al: Inhibition of CaMKIIα activity enhances antitumor effect of fullerene C60 nanocrystals by suppression of autophagic degradation. Adv Sci (Weinh). 6:18012332019. View Article : Google Scholar : PubMed/NCBI

26 

Asghar MY, Magnusson M, Kemppainen K, Sukumaran P, Löf C, Pulli I, Kalhori V and Törnquist K: Transient receptor potential canonical 1 (TRPC1) channels as Regulators of sphingolipid and VEGF receptor expression: Impolications for thyroid cancer cell migration and proliferation. J Biol Chem. 290:16116–16131. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Tao X, Zhao N, Jin H, Zhang Z, Liu Y, Wu J, Bast RC Jr, Yu Y and Feng Y: FSH enhances the proliferation of ovarian cancer cells by activating transient receptor potential channel C3. Endocr Relat Cancer. 20:415–429. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Shen B, Kwan HY, Ma X, Wong CO, Du J, Huang Y and Yao X: cAMP activates TRPC6 channels via the phosphatidylinositol 3-kinase (PI3K)-protein kinase B (PKB)-mitogen-activated protein kinase kinase (MEK)-ERK1/2 signaling pathway. J Biol Chem. 286:19439–19445. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Tetzner A, Gebolys K, Meinert C, Klein S, Uhlich A, Trebicka J, Villacañas Ó and Walther T: G-protein-coupled receptor MrgD is a receptor for angiotensin-(1–7) involving adenylyl cyclase, cAMP, and phosphokinase A. Hypertension. 68:185–194. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Thilo F, Liu Y, Loddenkemper C, Schuelein R, Schmidt A, Yan Z, Zhu Z, Zakrzewicz A, Gollasch M and Tepel M: VEGF regulates TRPC6 channels in podocytes. Nephrol Dial Transplant. 27:921–929. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Jardin I, Diez-Bello R, Lopez JJ, Redondo PC, Salido GM, Smani T and Rosado JA: TRPC6 channels are required for proliferation, migration and invasion of breast cancer cell lines by modulation of Orai1 and Orai3 surface exposure. Cancers (Basel). 10:3312018. View Article : Google Scholar

32 

Heiser JH, Schuwald AM, Sillani G, Ye L, Müller WE and Leuner K: TRPC6 channel-mediated neurite outgrowth in PC12 cells and hippocampal neurons involves activation of RAS/MEK/ERK, PI3K, and CAMKIV signaling. J Neurochem. 127:303–313. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Numaga-Tomita T, Nishida M, Putney JW Jr and Mori Y: TRPC3 amplifies B-cell receptor-induced ERK signalling via protein kinase D-dependent Rap1 activation. Biochem J. 473:201–210. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Li X, Lu W, Fu X, Zhang Y, Yang K, Zhong N, Ran P and Wang J: BMP4 increases canonical transient receptor potential protein expression by activating p38 MAPK and ERK1/2 signaling pathways in pulmonary arterial smooth muscle cells. Am J Respir Cell Mol Biol. 49:212–220. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April-2021
Volume 21 Issue 4

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Lässig F, Klann A, Bekeschus S, Lendeckel U and Wolke C: Expression of canonical transient receptor potential channels in U-2 OS and MNNG-HOS osteosarcoma cell lines. Oncol Lett 21: 307, 2021
APA
Lässig, F., Klann, A., Bekeschus, S., Lendeckel, U., & Wolke, C. (2021). Expression of canonical transient receptor potential channels in U-2 OS and MNNG-HOS osteosarcoma cell lines. Oncology Letters, 21, 307. https://doi.org/10.3892/ol.2021.12568
MLA
Lässig, F., Klann, A., Bekeschus, S., Lendeckel, U., Wolke, C."Expression of canonical transient receptor potential channels in U-2 OS and MNNG-HOS osteosarcoma cell lines". Oncology Letters 21.4 (2021): 307.
Chicago
Lässig, F., Klann, A., Bekeschus, S., Lendeckel, U., Wolke, C."Expression of canonical transient receptor potential channels in U-2 OS and MNNG-HOS osteosarcoma cell lines". Oncology Letters 21, no. 4 (2021): 307. https://doi.org/10.3892/ol.2021.12568