Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
August-2022 Volume 24 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2022 Volume 24 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer

  • Authors:
    • Zhengang Duan
    • Lei Cai
    • Jin Cao
    • Wei Wu
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The 986 Air Force Hospital, Xi'an, Shaanxi 710000, P.R. China, Department of Digestive Surgery, Xi'an International Medical Center Hospital, Xi'an, Shaanxi 710100, P.R. China, Department of Endocrinology, Xi'an International Medical Center Hospital, Xi'an, Shaanxi 710100, P.R. China, Department of Gastroenterology, Xi'an International Medical Center Hospital, Xi'an, Shaanxi 710100, P.R. China
    Copyright: © Duan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 269
    |
    Published online on: June 20, 2022
       https://doi.org/10.3892/ol.2022.13389
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

High expression of polo‑like kinase 4 (PLK4) promotes tumorigenesis and is correlated with poor prognosis in several kinds of cancer. However, the prognostic value of PLK4 in colorectal cancer (CRC) has not been elucidated. The aim of the present study was to investigate the association between PLK4 and the prognosis and effect of PLK4 inhibition on chemosensitivity in CRC. A total of 142 patients with CRC were enrolled, and 142 pairs of CRC and para‑carcinoma tissues were used to measure PLK4 protein expression using immunohistochemistry (IHC). Among them, 69 pairs were used to detect PLK4 mRNA expression using reverse transcription‑quantitative PCR. In addition, PLK4‑small interfering RNA (siRNA) was transfected into CRC cells, followed by 5‑fluorouracil (5‑FU) treatment for it was a fundamental chemotherapy for CRC. In addition, western blotting was used to detect PLK4 protein expression among human colonic epithelial cell and human CRC cell lines, including HCT‑116, LoVo, SW480 and HT‑29, as well as nuclear translocation of β‑catenin. The IHC score and mRNA expression of PLK4 were higher in CRC tissues compared with para‑carcinoma tissues (both P<0.001). Furthermore, the IHC score of tumor PLK4 was not correlated with pathological grade (P=0.585), T stage (P=0.357), N stage (P=0.107225) or tumor‑node‑metastasis (TNM) stage (P=0.093). The mRNA expression of tumor PLK4 was positively correlated with N stage (P=0.019) and TNM stage (P=0.004), but not with pathological grade (P=0.498) or T stage (P=0.112). Of note, the high protein expression of tumor PLK4 was an independent factor for poor overall survival (OS; P=0.048). In addition, PLK4 was elevated in CRC cell lines; PLK4‑siRNA reduced the 50% inhibitory concentration value of 5‑FU in HCT‑116 (4.4±0.1 µM vs. 7.6±1.4 µM) and LoVo cells (5.5±0.6 µM vs. 9.9±1.8 µM) (both P<0.05). Besides, PLK4‑siRNA decreased nuclear translocation of β‑catenin. In conclusion, the high expression of tumor PLK4 was associated with advanced TNM stage and shorter OS in patients with CRC. In addition, targeting PLK4 improved chemosensitivity in CRC cells.

Introduction

Colorectal cancer (CRC), a common digestive tract cancer, has the third highest incidence and second highest mortality rates among malignant carcinomas worldwide (1–3). Although technological advances in surgical resection, chemotherapy/chemoradiotherapy and immunotherapy have led to increases in CRC-related survival rate (4–7), tumor recurrence and metastasis still result in a poor prognosis in patients with CRC (8,9). Traditional clinicopathological parameters (i.e., pathological grade and tumor stage), tumor markers (i.e., carcinoembryonic antigen and defective DNA mismatch repair) and molecular biomarkers (i.e., adenomatous polyposis coli and vascular endothelial growth factor) have been used in the prognostic evaluation of CRC (10–12). To further improve the management of patients with CRC and prediction of the risk for relapse, identifying more potential predictors and therapeutic targets is critical.

Polo-like kinase 4 (PLK4), a serine/threonine kinase, is a regulator of centriole duplication through its autophosphorylation (13,14), while its aberrant expression induces centrosome duplication in cancer cells, and this is potentially associated with tumor progression (15,16). Indeed, PLK4 overexpression increases the proliferative and invasive ability of CRC cells through the Wnt/β-catenin signaling pathway (17). On the other hand, inhibiting PLK4 suppresses cell proliferation, migration and invasion in hepatocellular carcinoma (18). Meanwhile, PLK4 downregulation induces cell cycle arrest at the G1 phase by activating the p38/p53/p21 pathway in bladder cancer (19). In addition, the high PLK4 expression not only reflects an advanced cancer stage, but is also predictive of a poor prognosis in several cancer types, such as epithelial ovarian cancer, lung cancer and neuroblastoma (20–22). However, the association between PLK4 and CRC prognosis is not clear.

In the present study, the PLK4 levels were compared between CRC tumor and paired adjacent tissues with the objective of investigating its potential in reflecting clinicopathological features, as well as its prognostic value in patients with CRC. The small interfering RNA (siRNA)-mediated downregulation of PLK4 was also induced to explore the effect of PLK4 on chemosensitivity in CRC cells.

Materials and methods

Patients

In the present study, 142 patients with CRC (age ranged 42–80 years) who received surgical resection in our hospitals between July 2013 and June 2017 were retrospectively analyzed. The patient data from the hospital database were screened using the following criteria: i) Diagnosis of CRC based on pathological examination; ii) adult patients aged >18 years; iii) tumor-node-metastasis (TNM) stage I–III; iv) surgical treatment including laparoscopic surgery and radical excision; v) no neoadjuvant therapy; vi) surgically-removed CRC and para-carcinoma tissues were retrievable; vii) clinical data corresponding to surgical specimens of patients were available; and viii) follow-up records were accessible for survival assessment. This study was implemented with the approval of the Institutional Review Board of Xi'an International Medical Center Hospital, and all patient data were analyzed following anonymization; therefore, patient informed consent was waived by the Institutional Review Board.

Acquisition of data and specimens

Clinicopathological data were collected from the patients' medical records, and survival information, which was used for the evaluation of overall survival (OS), was obtained from the follow-up records. Formalin-fixed and paraffin-embedded (FFPE) specimens (CRC and para-carcinoma tissues) of 142 patients were collected from the specimen library to assess the protein expression of PLK4. Only 69 patients had fresh-frozen specimens stored in liquid nitrogen, which were also collected from the specimen library to evaluate PLK4 mRNA expression.

Assessment of PLK4 protein expression

Immunohistochemistry (IHC) was performed to assess the PLK4 protein expression, as previously reported (23). Briefly, the FFPE specimens were cut into slices, followed by deparaffinization and rehydration, followed by H2O2 (Sigma-Aldrich) treatment at room temperature for 10 min to quench endogenous peroxidases. Next, heat-induced antigen retrieval was performed. Following blocking, the slices were incubated with anti-PLK4 antibody (1:5,000; PA5-80907; Thermo Fisher Scientific, Inc.) at 4°C overnight and HRP-conjugated goat anti-rabbit IgG H&L secondary antibody (1:60; 32460; Thermo Fisher Scientific, Inc.) at room temperature at 1 h. Diaminobenzidine (room temperature for 10 sec; Sigma-Aldrich) and hematoxylin (room temperature for 5 min; Sigma-Aldrich) were used for staining and counterstaining, respectively. Following IHC staining, PLK4 protein expression was assessed under a microscope (Eclipse Ti-U; Nikon Corporation). The IHC results were quantified by scoring the staining intensity and density as previously described (24). The staining intensity was scored as 0 (negative), 1 (weak), 2 (moderate) and 3 (strong), and the staining density of positive cells was scored as 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). The representative images for each score of staining intensity and density in the IHC staining in tumor tissues were shown in Fig. S1. The IHC score was calculated by multiplying the two scores. Two pathologists assessed the IHC score independently. If the two pathologists gave different IHC scores for the same specimen, then the mean IHC score of this specimen was calculated and recorded.

Evaluation of PLK4 mRNA expression

Reverse transcription-quantitative PCR (RT-qPCR) was performed in 69 paired CRC and para-carcinoma tissues to determine PLK4 mRNA expression. Total RNA was extracted using RNeasy Protect Mini Kit (Qiagen GmbH) and then converted to cDNA (25°C for 3 min, 45°C for 10 min, 85°C for 5 min) using a QuantiNova Reverse Transcription Kit (Qiagen GmbH). RT-qPCR (95°C for 2 min, then 40 cycles of 95°C for 5 sec and 60°C for 10 sec) was conducted using a QuantiNova SYBR Green PCR Kit (Qiagen GmbH). The primers used in this study were designed as previously described (25) and listed as follows: forward primer for PLK4, 5′-CCTTATCACCTCCTCCTTC-3′; reverse primer for PLK4, 5′-CCAAGTCCTTCATTTGTAACC-3′; forward primer for GAPDH, 5′-ACATCATCCCTGCCTCTAC-3′; reverse primer for GAPDH, 5′-CCTGCTTCACCACCTTCT-3′. PLK4 mRNA expression was analyzed using the 2−ΔΔCq method (26) with GAPDH as an internal control.

Chemosensitivity experiment

A further in vitro experiment was conducted to verify the effect of PLK4 on the chemosensitivity of CRC cells to 5-fluorouracil (5-FU), since all stage III patients and most stage II patients received capecitabine monotherapy or XELOX (capecitabine combined with oxaliplatin) regimen following surgery. Human colonic epithelial cell (HCoEpic) (2950) was purchased from ScienCell Research Laboratories, lnc. Human CRC cell lines including HCT-116 (CBP60028) and LoVo (CBP60032) were purchased from Nanjing Cobioer Biotechnology Co., Ltd., SW480 (CCL-228) and HT-29 (HTB-38) were purchased from ATCC. The HCoEpic and SW480 cells were cultured in Leibovitz's L-15 medium (Gibco; Thermo Fisher Scientific, Inc.) with FBS. The HCT-116 and HT-29 cells were cultured in McCoy's 5a medium (Gibco; Thermo Fisher Scientific, Inc.) with FBS. The LoVo cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) with FBS. All cells were maintained in a humidified incubator supplied with 95% air and 5% CO2 at 37°C. The PLK4-siRNA and corresponding negative control (NC) siRNA were designed by Shanghai GenePharma Co., Ltd. The sequence (5′->3′) of PLK4 siRNA was: SS, ACACAUAAUUGCUAUCUUCAA; AS, ACACAUAAUUGCUAUCUUCAA. The sequence (5′->3′) of NC siRNA was: SS, GAAUUAAUUAAAGAUGGCCCGUUGUACU'; AS, UCAUCGAAGUUAUAGGGAUACAUUACGUGAUC. PLK4-siRNA (50 pM) and NC-siRNA (50 pM) were respectively transfected into the HCT-116 and the LoVo cells using Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, Inc.) at 37°C for 48 h. Following transfection, the cells in each cell line were categorized as PLK4-siRNA, NC-siRNA and blank control cells (without transfection). The cells were then treated with 5-FU (Merck KGaA) at the following concentrations: 0, 1, 2, 4, 8 and 16 µM for 48 h, which was based on previous studies with some modification (27,28). Following treatment, Cell Counting Kit-8 reagent (Beyotime Institute of Biotechnology) was added to the cells, followed by incubation at 37°C for 2 h. Finally, absorbance was measured at 450 nm using a microplate reader, and cell viability at different concentrations of 5-FU was calculated. In addition, the 50% inhibitory concentration (IC50) was calculated using Probit regression.

Western blot

The protein level of PLK4 in HCoEpic and CRC cells, as well as nuclear translocation of β-catenin in HCT-116 and LoVo cells after transfection were determined by western blot. Protein of the cells was extracted using a nucleoprotein extraction kit (Sangon Biotech Co., Ltd.) or RIPA reagent (Sangon Biotech Co., Ltd.) and quantified using an enhanced BCA protein assay kit (Beyotime Institute of Biotechnology). Subsequently, the protein (20 µg) was separated using 4–20% SDS-PAGE, followed by transferring onto nitrocellulose membranes (Pall Life Sciences). Then, the membranes were blocked with 5% BSA (Sigma-Aldrich; Merck KGaA) at room temperature for 1 h, and incubated with primary antibodies [β-catenin antibody (Cell Signaling Technology, Inc; 8480; 1:1,000), histone H3 antibody (Cell Signaling Technology, Inc; 4499; 1:2,000), PLK4 antibody (Cell Signaling Technology, Inc; 71033, 1:1,000) and GAPDH (Cell Signaling Technology, Inc; 2118; 1:1,000)] at 4°C overnight, followed by an HRP-linked goat anti-rabbit IgG antibody (Cell Signaling Technology, Inc; 7074; 1:3,000) at room temperature for 1 h. Then, the brands were visualized with ECL-PLUS reagents (Thermo Fisher Scientific, Inc.) and analyzed by ImageJ software (v1.5; NIH).

Statistical analysis

High PLK4 protein expression was assigned an IHC score of >3, and low PLK4 protein expression an IHC score of ≤3. The median PLK4 mRNA expression in CRC tissues was used to classify patients into the high and low PLK4 mRNA expression groups. The IHC score and mRNA expression of PLK4 were compared between CRC and para-carcinoma tissues using a paired t-test or Wilcoxon signed-rank test. The proportion of patients with a high and low PLK4 protein expression were compared between CRC and para-carcinoma tissues using the McNamar's test. The association between the PLK4 expression and tumor characteristics was analyzed using Kruskal-Wallis followed by Dunn's test. The OS was illustrated using a Kaplan-Meier curve and analyzed using a log-rank test. Multivariate Cox's proportional hazard model regression analysis was performed to identify prognostic factors. In the in vitro experiment, the PLK4 expression between the between HCoEpic and CRC cells, the PLK4 expression between groups after transfection, cell viability and β-catenin expression were analyzed using one-way ANOVA followed by Dunnett's or Tukey's multiple comparisons test; IC50 between PLK4-siRNA and NC-siRNA cells were analyzed using a Student's t-test. P<0.05 was considered to indicate a statistically significant difference. Data analysis and graphing were conducted using SPSS 22.0 (IBM Corp.) and GraphPad Prism 7.01 (GraphPad Software Inc.).

Results

Baseline characteristics

A total of 142 patients with CRC were enrolled in the present study [mean age, 65.3±10.3 years; 55 (38.7%) females and 87 (61.3%) males]. Of those, 21 (14.8%) had pathological grade 1, 99 (69.7%) patients had grade 2 and 22 (15.5%) patients had grade 3 CRC. In addition, 3 (2.1%) patients had T1 stage, 15 (10.6%) patients had T2 stage, 122 (85.9%) patients had T3 stage and 2 (1.4%) patients had T4 stage CRC. A total of 90 (63.4%) patients had N0 stage, 35 (24.6%) patients had N1 stage and 17 (12.0%) patients had N2 stage CRC. Finally, 18 (12.7%) had TNM stage I, 72 (50.7%) stage II and 52 (36.6%) stage III CRC. Other detailed clinical features are shown in Table I.

Table I.

Clinical features of the patients.

Table I.

Clinical features of the patients.

ItemsCRC patients (n=142)
Age (years), mean±SD65.3±10.3
Gender, No. (%)
  Female55 (38.7)
  Male87 (61.3)
Pathological grade, No. (%)
  Grade 121 (14.8)
  Grade 299 (69.7)
  Grade 322 (15.5)
Tumor size (cm), median (IQR)4.5 (3.5-5.0)
LYN positive, No. (%)
  No90 (63.4)
  Yes52 (36.6)
Number of LYN positive, median (IQR)2.0 (1.0-4.0)
T stage, No. (%)
  T13 (2.1)
  T215 (10.6)
  T3122 (85.9)
  T42 (1.4)
N stage, No. (%)
  N090 (63.4)
  N135 (24.6)
  N217 (12.0)
TNM stage, No. (%)
  I18 (12.7)
  II72 (50.7)
  III52 (36.6)
Adjuvant chemotherapy, No. (%)
  No40 (28.2)
  Yes102 (71.8)

[i] CRC, colorectal cancer; SD, standard deviation; IQR, interquartile range; LYN, lymph node; TNM, tumor-node-metastasis.

PLK4 is highly expressed in CRC tissues

The PLK4 expression in the NC, para-carcinoma and CRC tissues was detected using IHC staining (Fig. 1A). In addition, the IHC score of PLK4 in CRC tissues was increased compared with that in para-carcinoma tissues (mean value: 5.2±2.7 vs. 3.1±2.2, P<0.001; Fig. 1B). In addition, a PLK4 IHC score of 3 was used as the cut-off value for determining high and low PLK4 protein expression. Further analysis revealed that PLK4 protein expression was increased in CRC compared with para-carcinoma tissues (P<0.001; Fig. 1C). In addition, PLK4 mRNA expression in CRC tissues was elevated compared with that in para-carcinoma tissues [median, 2.680 (2.099-3.586) vs. 1.000 (0.659-1.537); P<0.001; Fig. 1D).

Figure 1.

Comparison of PLK4 between para-carcinoma and CRC tissues. (A) IHC staining for PLK4 in the negative control, para-carcinoma and CRC tissues. (B) PLK4 IHC score in para-carcinoma and CRC tissues. Paired-samples t-test was applied. (C) Distribution of CRC patients with a different PLK4 expression in para-carcinoma and CRC tissues. P-value representing the difference of the proportion of PLK4 protein high and low expressions between para-carcinoma and CRC tissues. McNamar's test was applied. (D) PLK4 mRNA expression in para-carcinoma and CRC tissues. Wilcoxon signed-rank test was applied. PLK4, polo-like kinase 4; CRC, colorectal cancer; IHC, immunohistochemistry.

Tumor PLK4 is associated with advanced tumor properties

Tumor PLK4 protein expression was not associated with pathological grade, T stage, N stage, or TNM stage (all P>0.05; Fig. 2A-D). Meanwhile, the high tumor PLK4 mRNA expression was associated with more advanced N stage (P=0.019) and TNM stage (P=0.004), but not with pathological grade or T stage (both P>0.050; Fig. 2E-H).

Figure 2.

Correlation between tumor PLK4 expression and tumor features. Association between tumor PLK4 protein expression and (A) pathological grade, (B) T stage, (C) N stage or (D) TNM stage; the relationship of tumor PLK4 mRNA expression with (E) pathological grade, (F) T stage, (G) N stage or (H) TNM stage. Kruskal-Wallis followed by Dunn's test was applied. PLK4, polo-like kinase 4; IHC, immunohistochemistry; TNM, tumor-node metastases.

Tumor PLK4 is correlated with poor prognosis

A high tumor PLK4 protein expression was correlated with a short OS (P=0.022). The 1-, 3- and 5-year OS rates were 93.6, 75.5 and 61.7%, respectively, in patients with a high PLK4 protein expression, and 97.9, 87.5 and 77.1% in patients with a low PLK4 protein expression (Fig. 3A). Tumor PLK4 mRNA expression was not correlated with OS (P=0.056). The 1-, 3- and 5-year OS rate was 94.3, 77.1 and 62.9% in patients with a high PLK4 mRNA expression, and 97.1, 88.2 and 79.4% in patients with a low PLK4 mRNA expression (Fig. 3B).

Figure 3.

Correlation between tumor PLK4 and OS. Association between tumor (A) protein and (B) mRNA PLK4 expression and OS. Kaplan-Meier method by log-rank test was applied. PLK4, polo-like kinase 4; OS, overall survival.

In addition, multivariate Cox's proportional hazards regression analysis revealed that tumor PLK4 protein expression (high vs. low, HR=1.862, P=0.048), age (≥65 years vs. <65 years; HR=2.226, P=0.006), higher pathological grade (HR=2.568, P<0.001), tumor size (≥5 cm vs. <5 cm; HR=2.943, P<0.001), LYN positivity (yes vs. no; HR=2.473, P=0.001) were identified as independent factors for a poor OS (Fig. 4).

Figure 4.

Multivariate Cox-regression analysis for OS. OS, overall survival; PLK4, polo-like kinase 4; HR, hazard ratio; CI, confidence interval; LYN, lymph node.

PLK4-siRNA improves 5-FU sensitivity in CRC cells

The protein level of PLK4 was increased in HCT-116, LoVo and SW480 cells compared with HCoEpic (all P<0.05; Fig. 5A and B); since it was increased more predominantly, the HCT-116 and LoVo cells were chosen for further experiments. In the HCT-116 cell line, PLK4-siRNA reduced mRNA level of PLK4 (P<0.001; Fig. 6A) as well as its protein level (P<0.001, Fig. S2A and B); and it markedly reduced relative cell viability in cells treated with 2–16 µM 5-FU (all P<0.05). Meanwhile, the IC50 value of 5-FU in PLK4-siRNA cells was decreased compared with that in NC-siRNA cells (4.4±0.1 µM vs. 7.6±1.4 µM; P=0.019; Fig. 6B and C). In the LoVo cell line, PLK4-siRNA also decreased mRNA level of PLK4 (P<0.001; Fig. 6D) as well as its protein level (P<0.001, Fig. S2A and B). Besides, a relative decrease in cell viability was observed in PLK4-siRNA cells compared with NC-siRNA cells treated with 4–16 µM 5-FU (all P<0.05), and the IC50 value of 5-FU in PLK4-siRNA-transfected cells was reduced compared with that in NC-siRNA cells (5.5±0.6 µM vs. 9.9±1.8 µM; P=0.014; Fig. 6E and F). In addition, the nuclear translocation level of β-catenin was reduced in PLK4-siRNA-transfected cells was reduced compared with that in NC-siRNA cells (both P<0.01; Fig. 7A and B).

Figure 5.

PLK4 expression in HCoEpic and CRC cells. (A) Representative images of PLK4 detection by western blot. (B) Comparison of PLK4 expression between HCoEpic and CRC cells. One-way ANOVA followed by Dunnett's multiple comparisons test was applied among HCoEpic, HT-29, HCT-116, LoVo and SW480 cells. PLK4, polo-like kinase 4; CRC, colorectal cancer.

Figure 6.

Effect of PLK4-siRNA on 5-FU sensitivity in CRC cell lines. (A) Comparison of the mRNA expression of PLK4 among blank control, NC-siRNA and PLK4-siRNA-treated HCT-116 cells. One-way ANOVA followed by Tukey's multiple comparisons test was applied. (B) Comparison of cell viability among blank control, NC-siRNA and PLK4-siRNA-treated HCT-116 cells groups. One-way ANOVA followed by Dunnett's multiple comparisons test was applied. (C) Changes in the IC50 value of 5-FU between NC-siRNA and PLK4-siRNA-treated HCT-116 cells. Student's t-test was applied. (D) Comparison of the mRNA expression of PLK4 among blank control, NC-siRNA and PLK4-siRNA-treated LoVo cells. One-way ANOVA followed by Tukey's multiple comparisons test was applied. (E) Comparison of cell viability among blank control, NC-siRNA and PLK4-siRNA-treated LoVo cell groups. One-way ANOVA followed by Dunnett's multiple comparisons test was applied. (F) Changes in the IC50 value of 5-FU between NC-siRNA and PLK4-siRNA-treated LoVo cells. Student's t-test was applied. PLK4, polo-like kinase 4; 5-FU, 5-fluorouracil; CRC, colorectal cancer; IC50, 50% inhibitory concentration; siRNA, short interfering RNA; NC, negative control.

Figure 7.

Effect of PLK4-siRNA on β-catenin nuclear translocation in CRC cell lines. (A) Detection of β-catenin in the nuclei of CRC cells. (B) Comparison of β-catenin in the nuclei of CRC cells. One-way ANOVA followed by Tukey's multiple comparisons test was applied. PLK4, polo-like kinase 4; CRC, colorectal cancer; siRNA, short interfering RNA; NC, negative control.

Discussion

The PLK family members show distinct effect on cancer progression, among which PLK1 critically regulates cell cycles in various malignancies, while PLK4 may have less effect on this (29). Previous studies have implied that PLK4 may serve as a potential treatment target in cancers (30–32). Meanwhile, high PLK4 expression is associated with poor clinical and pathological features in cancer patients (23,25,33). For instance, high PLK4 is associated with LYN metastasis, distant metastasis or surrounding recurrence in patients with breast cancer (25). Furthermore, high PLK4 expression is associated with a large tumor size, LYN metastasis and advanced TNM stage in patients with non-small cell lung cancer (23). In hepatocellular carcinoma patients, high PLK4 expression was associated with a more advanced TNM stage (34). However, the role of PLK4 in CRC has not been elucidated. In the present study, PLK4 protein and mRNA expression levels were higher in CRC compared with para-carcinoma tissues, while tumor PLK4 was positively correlated with TNM stage, which was consistent with the results of previous studies on other tumors (23,34). There are several potential reasons for these findings. i) PLK4 reflected the increased proliferation rate of cells, which is a common characteristic of CRC cells but not of para-carcinoma cells; thus, PLK4 expression was upregulated in CRC tissues compared with para-carcinoma tissue. ii) PLK4 upregulation may cause centrosome amplification, which facilitates tumor progression (16). iii) PLK4 may promote CRC invasion and metastasis by regulating actin-related protein 2/3-mediated actin cytoskeleton or Tec kinase phosphorylation (35,36), and suppress CRC apoptosis through the Ataxia telangiectasia and Rad3-related-checkpoint kinase 1 signaling pathway (34,37). Meanwhile, CRC progression, invasion and metastasis may cause larger tumor size and lymph node metastasis, thus PLK4 was positively correlated with TNM stage in patients with CRC.

PLK4 is a potential predictor of poor outcomes in cancer patients (38,39). For instance, upregulated expression of PLK4 is correlated with worse progression-free survival and OS in breast cancer patients (25). Meanwhile, the high PLK4 mRNA expression was associated with a shorter OS in patients with high-grade glioma (35). Bladder cancer patients with high PLK4 expression have a lower OS than those with a low PLK4 expression (19). In the present study, tumor PLK4 protein expression was negatively correlated with OS, but tumor PLK4 mRNA expression was not. Furthermore, high tumor PLK4 protein expression was an independent predictive factor for a shorter OS. The reasons for this may be: i) the high expression of tumor PLK4 was correlated with a higher TNM stage, indirectly leading to a poor prognosis in patients with CRC; ii) PLK4 reduced chemosensitivity through inhibitor of NF-κB kinase subunit ε (IKBKE) signaling to influence the efficacy of adjuvant chemotherapy, which can reduce the OS of patients with CRC (40); iii) PLK4 may promote CRC stemness and induce epithelial-mesenchymal transition by regulating the Wnt/β-catenin signaling pathway, increasing the risk of CRC recurrence (17,41).

It has been confirmed that suppressing PLK4 not only decreases viability of CRC cells, but also increases chemosensitivity in several types of cancer (17,39,40). For instance, PLK4 affects temozolomide (TMZ) sensitivity, while PLK4 inhibitor could enhance TMZ sensitivity through the phosphorylation of IKBKE in glioblastoma (40). PLK4 inhibitor increases conventional chemotherapeutic DNA-damaging agents (doxorubicin or etoposide) sensitivity in rhabdoid tumors and medulloblastomas (39). Considering that PLK4 is associated with a poor prognosis in patients with CRC, the effect of PLK4-siRNA on 5-FU sensitivity was evaluated. Consistent with previous studies, PLK4-siRNA enhanced the 5-FU susceptibility in the HCT-116 and LoVo cell lines. This may have been due to the fact that the suppression of PLK4 may increase the anti-tumor effect of 5-FU by inhibiting the Wnt/β-catenin signaling pathway, which is a key pathway causing chemoresistance in several cancer types (17,42). Furthermore, it was observed that PLK4 knockdown suppressed the nuclear translocation of β-catenin in CRC cells, which could explain the effect of PLK4 on chemosensitivity in CRC cells.

The present study had certain limitations: i) Only CRC patients with TNM stage I–III were recruited; therefore, our conclusion is not suitable for TNM stage IV patients. ii) Further proof on the potential mechanism of PLK4 in CRC progression is required. iii) The samples size of this study was somewhat small.

In conclusion, the high expression of tumor PLK4 is associated with an advanced TNM stage and shorter OS in patients with CRC. Therefore, targeting PLK4 improves chemosensitivity in CRC cells.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

Funding: Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WW and ZD contributed substantially to the conception and design of the study. LC and WW contributed substantially to the acquisition, analysis and interpretation of the data, and was involved in the drafting of the manuscript. ZD and WW confirm the authenticity of all the raw data. LC and JC contributed substantially to the interpretation of the data and was involved in the critical revisions of the manuscript for important intellectual content. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

This study was conducted with approval from the Institutional Review Board of Xi'an International Medical Center Hospital (approval no. 2021013). All patients' data were analyzed following desensitization and therefore patient' informed consent was waved by the Institutional Review Board.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Liu S, Cao Q, An G, Yan B and Lei L: Identification of the 3-lncRNA signature as a prognostic biomarker for colorectal cancer. Int J Mol Sci. 21:93592020. View Article : Google Scholar

2 

Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global patterns and trends in colorectal cancer incidence and mortality. Gut. 66:683–691. 2017. View Article : Google Scholar

3 

Wilkins T, McMechan D and Talukder A: Colorectal cancer screening and prevention. Am Fam Physician. 97:658–665. 2018.PubMed/NCBI

4 

Salibasic M, Pusina S, Bicakcic E, Pasic A, Gavric I, Kulovic E, Rovcanin A and Beslija S: Colorectal cancer surgical treatment, our experience. Med Arch. 73:412–414. 2019. View Article : Google Scholar : PubMed/NCBI

5 

Koi M and Carethers JM: The colorectal cancer immune microenvironment and approach to immunotherapies. Future Oncol. 13:1633–1647. 2017. View Article : Google Scholar

6 

Nozawa H, Sonoda H, Ishii H, Emoto S, Murono K, Kaneko M, Sasaki K, Nishikawa T, Shuno Y, Tanaka T, et al: Postoperative chemotherapy is associated with prognosis of stage IV colorectal cancer treated with preoperative chemotherapy/chemoradiotherapy and curative resection. Int J Colorectal Dis. 35:177–180. 2020. View Article : Google Scholar : PubMed/NCBI

7 

Wang GR, Wang ZW and Jin ZY: Application and progress of texture analysis in the therapeutic effect prediction and prognosis of neoadjuvant chemoradiotherapy for colorectal cancer. Chin Med Sci J. 34:45–50. 2019. View Article : Google Scholar : PubMed/NCBI

8 

Zhang F, Zhang Y, Zhao W, Deng K, Wang Z, Yang C, Ma L, Openkova MS, Hou Y and Li K: Metabolomics for biomarker discovery in the diagnosis, prognosis, survival and recurrence of colorectal cancer: A systematic review. Oncotarget. 8:35460–35472. 2017. View Article : Google Scholar

9 

Jin M and Frankel WL: Lymph node metastasis in colorectal cancer. Surg Oncol Clin N Am. 27:401–412. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Ijsselsteijn R, Jansen JG and de Wind N: DNA mismatch repair-dependent DNA damage responses and cancer. DNA Repair (Amst). 93:1029232020. View Article : Google Scholar : PubMed/NCBI

11 

Konishi T, Shimada Y, Hsu M, Tufts L, Jimenez-Rodriguez R, Cercek A, Yaeger R, Saltz L, Smith JJ, Nash GM, et al: Association of preoperative and postoperative serum carcinoembryonic antigen and colon cancer outcome. JAMA Oncol. 4:309–315. 2018. View Article : Google Scholar

12 

Das V, Kalita J and Pal M: Predictive and prognostic biomarkers in colorectal cancer: A systematic review of recent advances and challenges. Biomed Pharmacother. 87:8–19. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Zhao Y and Wang X: PLK4: A promising target for cancer therapy. J Cancer Res Clin Oncol. 145:2413–2422. 2019. View Article : Google Scholar

14 

Maniswami RR, Prashanth S, Karanth AV, Koushik S, Govindaraj H, Mullangi R, Rajagopal S and Jegatheesan SK: PLK4: A link between centriole biogenesis and cancer. Expert Opin Ther Targets. 22:59–73. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Godinho SA, Picone R, Burute M, Dagher R, Su Y, Leung CT, Polyak K, Brugge JS, Théry M and Pellman D: Oncogene-like induction of cellular invasion from centrosome amplification. Nature. 510:167–171. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Kim DH, Ahn JS, Han HJ, Kim HM, Hwang J, Lee KH, Cha-Molstad H, Ryoo IJ, Jang JH, Ko SK, et al: Cep131 overexpression promotes centrosome amplification and colon cancer progression by regulating Plk4 stability. Cell Death Dis. 10:5702019. View Article : Google Scholar : PubMed/NCBI

17 

Liao Z, Zhang H, Fan P, Huang Q, Dong K, Qi Y, Song J, Chen L, Liang H, Chen X, et al: High PLK4 expression promotes tumor progression and induces epithelialmesenchymal transition by regulating the Wnt/β-catenin signaling pathway in colorectal cancer. Int J Oncol. 54:479–490. 2019. View Article : Google Scholar

18 

Meng L, Zhou Y, Ju S, Han J, Song C, Kong J, Wu Y, Lu S, Xu J, Yuan W, et al: A cis-eQTL genetic variant in PLK4 confers high risk of hepatocellular carcinoma. Cancer Med. 8:6476–6484. 2019. View Article : Google Scholar : PubMed/NCBI

19 

Yang Z, Sun H, Ma W, Wu K, Peng G, Ou T and Wu S: Down-regulation of Polo-like kinase 4 (PLK4) induces G1 arrest via activation of the p38/p53/p21 signaling pathway in bladder cancer. FEBS Open Bio. 11:2631–2646. 2021. View Article : Google Scholar : PubMed/NCBI

20 

He Y, Wang H, Yan M, Yang X, Shen R, Ni X, Chen X, Yang P, Chen M, Lu X, et al: High LIN28A and PLK4 coexpression is associated with poor prognosis in epithelial ovarian cancer. Mol Med Rep. 18:5327–5336. 2018.PubMed/NCBI

21 

Pu JT, Hu Z, Zhang DG, Zhang T, He KM and Dai TY: MiR-654-3p suppresses non-small cell lung cancer tumourigenesis by inhibiting PLK4. Onco Targets Ther. 13:7997–8008. 2020. View Article : Google Scholar : PubMed/NCBI

22 

Zhang N, Liu FL, Ma TS and Zhang ZZJ: LncRNA SNHG1 contributes to tumorigenesis and mechanism by targeting miR-338-3p to regulate PLK4 in human neuroblastoma. Eur Rev Med Pharmacol Sci. 23:8971–8983. 2019.

23 

Zhou Q, Fan G and Dong Y: Polo-like kinase 4 correlates with greater tumor size, lymph node metastasis and confers poor survival in non-small cell lung cancer. J Clin Lab Anal. 34:e231522020. View Article : Google Scholar

24 

Hu Z, Gu X, Zhong R and Zhong H: Tumor-infiltrating CD45RO+ memory cells correlate with favorable prognosis in patients with lung adenocarcinoma. J Thorac Dis. 10:2089–2099. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Li Z, Dai K, Wang C, Song Y, Gu F, Liu F and Fu L: Expression of polo-like kinase 4(PLK4) in breast cancer and its response to taxane-based neoadjuvant chemotherapy. J Cancer. 7:1125–1132. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Fohlen A, Bordji K, Assenat E, Gongora C, Bazille C, Boulonnais J, Naveau M, Breuil C, Pérès EA, Bernaudin M and Guiu B: Anticancer drugs for intra-arterial treatment of colorectal cancer liver metastases: In-vitro screening after short exposure time. Pharmaceuticals (Basel). 14:6392021. View Article : Google Scholar : PubMed/NCBI

28 

Li J, Mo R and Zheng L: MicroRNA-490-3p inhibits migration and chemoresistance of colorectal cancer cells via targeting TNKS2. World J Surg Oncol. 19:1172021. View Article : Google Scholar

29 

Liu X: Targeting polo-like kinases: A promising therapeutic approach for cancer treatment. Transl Oncol. 8:185–195. 2015. View Article : Google Scholar

30 

Parsyan A, Cruickshank J, Hodgson K, Wakeham D, Pellizzari S, Bhat V and Cescon DW: Anticancer effects of radiation therapy combined with polo-like kinase 4 (PLK4) inhibitor CFI-400945 in triple negative breast cancer. Breast. 58:6–9. 2021. View Article : Google Scholar

31 

Zhang X, Wei C, Liang H and Han L: Polo-like kinase 4′s critical role in cancer development and strategies for Plk4-targeted therapy. Front Oncol. 11:5875542021. View Article : Google Scholar

32 

Garvey DR, Chhabra G, Ndiaye MA and Ahmad N: Role of polo-like kinase 4 (PLK4) in epithelial cancers and recent progress in its small molecule targeting for cancer management. Mol Cancer Ther. 20:632–640. 2021. View Article : Google Scholar : PubMed/NCBI

33 

Wang J, Zuo J, Wang M, Ma X, Gao K, Bai X, Wang N, Xie W and Liu H: Pololike kinase 4 promotes tumorigenesis and induces resistance to radiotherapy in glioblastoma. Oncol Rep. 41:2159–2167. 2019.PubMed/NCBI

34 

Bao J, Yu Y, Chen J, He Y, Chen X, Ren Z, Xue C, Liu L, Hu Q, Li J, et al: MiR-126 negatively regulates PLK-4 to impact the development of hepatocellular carcinoma via ATR/CHEK1 pathway. Cell Death Dis. 9:10452018. View Article : Google Scholar : PubMed/NCBI

35 

Kazazian K, Go C, Wu H, Brashavitskaya O, Xu R, Dennis JW, Gingras AC and Swallow CJ: Plk4 promotes cancer invasion and metastasis through Arp2/3 complex regulation of the actin cytoskeleton. Cancer Res. 77:434–447. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Yeung SF, Zhou Y, Zou W, Chan WL and Ching YP: TEC kinase stabilizes PLK4 to promote liver cancer metastasis. Cancer Lett. 524:70–81. 2021. View Article : Google Scholar

37 

Zhu Y, Liu Z, Qu Y, Zeng J, Yang M, Li X, Wang Z, Su J, Wang X, Yu L and Wang Y: YLZ-F5, a novel polo-like kinase 4 inhibitor, inhibits human ovarian cancer cell growth by inducing apoptosis and mitotic defects. Cancer Chemother Pharmacol. 86:33–43. 2020. View Article : Google Scholar

38 

Marina M and Saavedra HI: Nek2 and Plk4: Prognostic markers, drivers of breast tumorigenesis and drug resistance. Front Biosci (Landmark Ed). 19:352–365. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Sredni ST, Bailey AW, Suri A, Hashizume R, He X, Louis N, Gokirmak T, Piper DR, Watterson DM and Tomita T: Inhibition of polo-like kinase 4 (PLK4): A new therapeutic option for rhabdoid tumors and pediatric medulloblastoma. Oncotarget. 8:111190–111212. 2017. View Article : Google Scholar

40 

Zhang Z, Wang Z, Huang K, Liu Y, Wei C, Zhou J, Zhang W, Wang Q, Liang H, Zhang A, et al: PLK4 is a determinant of temozolomide sensitivity through phosphorylation of IKBKE in glioblastoma. Cancer Lett. 443:91–107. 2019. View Article : Google Scholar

41 

Zhang Y, Kang M, Zhang B, Meng F, Song J, Kaneko H, Shimamoto F and Tang B: m6A modification-mediated CBX8 induction regulates stemness and chemosensitivity of colon cancer via upregulation of LGR5. Mol Cancer. 18:1852019. View Article : Google Scholar : PubMed/NCBI

42 

Zhang J, Miller Z, Musich PR, Thomas AE, Yao ZQ, Xie Q, Howe PH and Jiang Y: DSTYK promotes metastasis and chemoresistance via EMT in colorectal cancer. Front Pharmacol. 11:12502020. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Duan Z, Cai L, Cao J and Wu W: Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer. Oncol Lett 24: 269, 2022.
APA
Duan, Z., Cai, L., Cao, J., & Wu, W. (2022). Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer. Oncology Letters, 24, 269. https://doi.org/10.3892/ol.2022.13389
MLA
Duan, Z., Cai, L., Cao, J., Wu, W."Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer". Oncology Letters 24.2 (2022): 269.
Chicago
Duan, Z., Cai, L., Cao, J., Wu, W."Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer". Oncology Letters 24, no. 2 (2022): 269. https://doi.org/10.3892/ol.2022.13389
Copy and paste a formatted citation
x
Spandidos Publications style
Duan Z, Cai L, Cao J and Wu W: Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer. Oncol Lett 24: 269, 2022.
APA
Duan, Z., Cai, L., Cao, J., & Wu, W. (2022). Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer. Oncology Letters, 24, 269. https://doi.org/10.3892/ol.2022.13389
MLA
Duan, Z., Cai, L., Cao, J., Wu, W."Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer". Oncology Letters 24.2 (2022): 269.
Chicago
Duan, Z., Cai, L., Cao, J., Wu, W."Polo‑like kinase 4 is associated with advanced TNM stages and reduced survival and its inhibition improves chemosensitivity in colorectal cancer". Oncology Letters 24, no. 2 (2022): 269. https://doi.org/10.3892/ol.2022.13389
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team