Snail inhibits metastasis via regulation of E‑cadherin and is associated with prognosis in colorectal cancer
- Authors:
- Published online on: May 5, 2023 https://doi.org/10.3892/ol.2023.13857
- Article Number: 271
-
Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Colorectal cancer (CRC) is a prevalent gastrointestinal malignancy. Recent data show that it has the second highest mortality and third highest incidence worldwide (1). Despite improvements in early diagnosis and treatment techniques, developing countries are still experiencing an increase in the incidence rate and mortality of CRC (2). Additionally, patients with metastatic CRC have a poor prognosis with a median 5-year survival rate of 18.5% in the United States and 27.7% in Europe (1). Therefore, it is imperative to identify effective biomarkers and therapeutic targets to improve patient prognosis.
Epithelial-mesenchymal transition (EMT) is a key process in embryonic development. Studies have shown that it contributes to tumor progression. EMT causes epithelial cells to acquire fibroblast-like characteristics, decreases intercellular adhesion and increases motility (3,4). Snail, a member of the zinc finger transcription factor Snail family, induces EMT by downregulating EMT-associated genes, including E-cadherin (E-cad), claudin, occludin, protein associated with mouse musculus veli-7, membrane-associated guanylate kinase homolog (MAGUK) p55 family member and Pals1-associated tight junction (PATJ) crumbs cell polarity complex component (4,5). E-cad, a cadherin protein family member, is a component of adhesion junctions and the primary organizer of the epithelial phenotype (6,7). Studies have shown that the loss of E-cad expression is associated with tumor progression and metastasis and induced expression of E-cad in cancer cells can prevent tumor progression and invasion (5,8).
The present study investigated the role of Snail and E-cad in CRC and demonstrated that they can individually predict CRC prognosis, with their joint prediction having a greater combined effects that can more accurately predict patient prognosis.
Materials and methods
Patients and cancer tissue samples
Data of 470 patients with CRC were collected from Yixing People's Hospital affiliated to Yangzhou University in the present study. The patients underwent radical colon cancer surgery at the Department of Oncology of Yixing People's Hospital between January 2006 and December 2010 and were followed up for at least 5 years. The mean age of 470 patients is 63, these are 282 males and 188 females. The clinicopathological features are shown in our previously published article (9). Overall survival (OS) was the primary end point, which was calculated from the date of surgery to the date of death or final follow-up.
The Ethics Committee of Yixing Hospital approved the present study, which was performed according to the principles of the Declaration of Helsinki. The human and animal experiments were approved by the Ethics Committee of Yixing Hospital Affiliated to Yangzhou University (approval no. YXYLL-2015-42). All patients provided written informed consent for use of their tissues.
Construction of tissue microarray (TMA) and immunohistochemistry
Tumor tissues were selected from paraffin blocks and confirmed by hematoxylin and eosin staining. TMA construction was performed using cancer tissues and corresponding adjacent tissue (5 cm from cancer tissue). Each point on the TMA chip had a diameter of 1.5 mm to accommodate both tumor and non-tumor tissue. TMA chips were placed in a 55°C incubator for 10 min and cooled at room temperature. These chips were placed in a cryostat and 4 µm thick slices were produced. The slices were placed in water at 45°C for 2 min, baked at 58°C for 18 h and stored at −20°C for future use.
The immunostaining was performed as described previously (10). Rabbit monoclonal antibodies, including anti-C-terminus of Hsc70-interacting protein (CHIP; 1:100; no. 1132; Cell Signaling Technology, Inc.) and Gal1 (cat. no. ab108389; 1:100; Abcam), were incubated at 4°C overnight. The staining score of the tissue controls were pre-evaluated to ensure the quality control of immunostaining for each microarray slide.
Evaluation of immunostaining
Two pathologists who were blinded to the clinical data scored the staining of Snail or E-cad in the tissue. The presence of Snail or E-cad in cancer and adjacent tissue was evaluated using the semi-quantitative immunoreactivity score (IRS) reported previously (11). Intensity of immunostaining was categorized as 0–3 (0, negative; 1, weak; 2, moderate; 3, strong). Proportion of immunoreactive cells was categorized as 1, (0–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). The product of these scores was used to calculate IRS ranging from 0 to 12. To determine the optimum cutoff value of Snail or E-cad IRS for 1-, 3- and 5-year OS rate, receiver operator characteristic (ROC) analysis was used. The optimum cutoff point for CHIP IRS was 4 since it had the best predictive value for survival.
Cell lines and animals
HCT 116 and HT 29 CRC cells were obtained from Procell Life Science & Technology Co., Ltd. These cells were cultured in RPMI-1640 medium supplemented with 10% FBS (Beyotime Biotechnology) and 1% penicillin/streptomycin. All cells were incubated at 37°C with 5% CO2. These cells were authenticated by short tandem repeat profiling.
Female BALB/c nude mice were obtained from the Comparative Medicine Laboratory Animal Center [license no. scxk (SU) 2012–0004] of Yangzhou University. The mice (age, 6–8 weeks) were kept in specific pathogen-free conditions and cared for according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
A total of ~2×106 HCT 116 stable cells and control cells (0.2 ml/mouse; 5 mice/group) were implanted subcutaneously into the flank of each mouse. After 21 days, the mice were sacrificed. All nude mice were euthanized by cervical dislocation and all animal experiments were conducted under the animal use license of Yangzhou University (no. SYXK2022-0044).
Reverse transcription-quantitative PCR (RT-qPCR)
TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from CRC tissue and cells. cDNA was synthesized using a PrimeScript™ RT kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. SYBR Green qPCR analysis (Applied Biosystems) was performed using the Applied Biosystems 7500 real-time PCR system (Roche Applied Science). The method of quantification was 2−ΔΔCq (12). The sequences of the primers were as follows (5′□3′): E-cad forward, CGAGAGCTACACGTTCACGG and reverse, GGGTGTCGAGGGAAAAATAGG; Snail forward, CCTCGCTGCCAATGCTCATCTG and reverse, CTCTGCCACCCTGGGACTCTC and GAPDH forward, ACGGATTTGGTCGTATTGGG and reverse, CGCTCCTGGAAGATGGTGAT (all Sangon Biotech Co., Ltd.).
Western blotting
Cells or tissues were lysed with cold lysis buffer supplemented with a protease inhibitor (Beyotime Biotechnology) on ice for 30 min. The total protein concentration was measured using the Bicinchoninic Acid Protein assay kit (Thermo Fisher Scientific, Inc.). Protein (80 µg/lane) was separated by SDS-PAGE on 10% gels. Subsequently, protein was transferred to the PVDF membrane, which was incubated with antibodies. The protocol was executed in the aforementioned manner. Rabbit monoclonal anti-E-cad (cat. no. ab40772; 1:1,000;Abcam), rabbit monoclonal anti-Snail (cat. no. ab216347; 1:1,000; Abcam) and mouse monoclonal anti-β-actin (cat. no. AF0003; 1:2,000; Beyotime Biotechnology) were used as the primary antibodies. ImageJ software (v 1.44; National Institutes of Health) was used to normalize expression to the expression of β-actin and the band strength of each protein was semi-quantified.
Wound scratch assay
HCT 116 cells (~5×105) were added into each well of a marked six-well plate to ensure that the plate was fully covered. After 24 h, a sterile pipette tip was used to scratch a horizontal line perpendicular to the bottom of the plate and the cells were washed with PBS three times. Serum-free RPMI-1640 medium (Beyotime Biotechnology) was added and cells were cultured in a 37°C 5% CO2 incubator. The process of tumor cell migration was observed and photographed at 50× magnification 0, 24 and 48 h after wounding.
High content cell migration experiment
The cells were plated in 96-well plates (2,000 cells/well). When the cells grew to 80% confluence, the fresh RPMI-1640 medium supplemented with 10% FBS was refreshed. Under the conditions of 37°C and 5% CO2, the migration of cells was observed using an Operetta CLS high connotation cell imaging system (PerkinElmer). The cells were scanned and images were captured every 10 min for 12 h. The cell migration curve was constructed.
Lentiviral (LV) infection
LV vector (Shanghai GenePharma Co., Ltd.) was used to knockdown or increase with Snail or E-cad expression. LV-Snail, LV-Snail-control (ctrl), LV-Snail-short hairpin RNA (shRNA) and LV-Snail-shRNA-ctrl; LV-E-cad, LV-E-cad-ctrl, LV-E-cad-shRNA and LV-E-cad-shRNA-ctrl were transfected into HT 29 and HCT 116 cells at a MOI of 20 with 10 µg/ml Polybrene (Shanghai GeneChem Co., Ltd.). The cells were maintained with normal RPMI-1640 culture medium at 37°C with 5% CO2 for 24 h after lentiviral infection 8 h. After 24 h, the cells were incubated in RPMI-1640 with 2 µg/ml puromycin. The sequences of the shRNAs and shRNA-control were as follows (5′→3′): Snail: CCACTCAGATGTCAAGAAGTA and ctrl: TTCTCCGAACGTGTCACGTTT. E-cad: CAUGGAUAACCAGAAUAAATT and UUCUCCGAACGUGUCACGUTT.
Statistical analysis
The association between Snail and E-cad expression and clinicopathological data was evaluated using Fisher's exact test. IRS expression of Snail and E-cad in tumor and corresponding non-tumor tissue was compared using Wilcoxon signed-rank test (grouping). Kaplan-Meier (log-rank test) survival analysis was used to determine differences in OS (13). Univariate or multivariate Cox regression analysis was used to estimate the hazard ratio (HR) and 95% CI. STATA software (v10.1; StataCorp LP) was used to analyze all experimental data. Data were analyzed by one-way ANOVA followed by Tukey's post hoc test. Mann-Whitney U was used as non-parametric test to compare unpaired data. P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated in triplicate.
Results
Snail and E-cad expression in CRC vs. non-cancerous tissue
The present study used eight pairs of primary CRC and adjacent normal tissues to detect the protein expression levels of Snail and E-cad by western blotting. The protein expression levels of E-cad were lower in tumor compared with adjacent normal tissues, while expression levels of Snail were higher in tumor tissue (Fig. 1A). RT-qPCR was used to detect the mRNA levels of Snail and E-cad, which were higher and lower, respectively, in tumor compared with corresponding normal tissues (Fig. 1B and C).
To confirm Snail and E-cad expression in CRC tissue, immunohistochemical staining was performed (Figs. 1D and E and 2A and B). Expression levels of Snail were markedly upregulated in cancer compared with adjacent normal tissues. Similarly, the expression levels of E-cad were downregulated in tumor compared with adjacent non-tumor tissue (Fig. 2C and D).
Association between Snail and E-cad expression and clinicopathological data in patients with CRC
The present study analyzed the association between Snail and E-cad expression and clinicopathological characteristics of 465 patients with CRC. Snail expression was significantly associated with the depth of invasion, lymph node metastasis, TNM stage and distal metastasis (Table I; P<0.05). Similarly, expression levels of E-cad were significantly associated with pathological classification, lymph node metastasis, TNM stage and distal metastasis (Table II; P<0.05).
 | Table I.Association between expression levels of Snail and clinicopathological features of patients with colorectal cancer (n=469). |
| Table II.Association between expression levels of E-cad and clinicopathological features in patients with colorectal cancer (n=465). |
High Snail and low E-cad expression is associated with shorter survival time in patients with CRC
Kaplan-Meier analysis showed that high Snail expression or low E-cad expression in cancer tissue was significantly associated with poorer 5-year survival rates in patients with CRC (both P<0.001; log-rank test; Fig. 3C and D). Furthermore, univariate and multivariate Cox regression analyses revealed that Snail or E-cad were independent prognostic factors for patients with CRC. The results of the univariate Cox regression analysis demonstrated that Snail and E-cad expression were associated with OS in patients with CRC (Table III). Additionally, multivariate Cox regression analysis revealed that Snail and E-cad expression was an independent prognostic factor in patients with CRC (Table IV; Snail: HR, 0.181; 95% CI, 0.128-0.255; P<0.001; E-cad: HR, 0.212; 95% CI, 0.148-0.303; P<0.001).
| Table III.Univariate Cox regression analysis of Snail and E-cad expression predicting survival in patients with colorectal cancer (n=470). |
| Table IV.Multivariate Cox regression analysis of Snail, E-cad, Snail + E-cad expression and clinicopathological variables predicting survival in patients with colorectal cancer. |
Combined Snail and E-cad expression has greater predictive ability of OS in patients with CRC
The survival rate of the Snail low expression and E-cad high expression groups was higher than that of other groups (P<0.001, log-rank test; Fig. 3E). To verify whether Snail combined with E-cad had a great predictive effect on the prognosis of patients with CRC, the clinical risk score (TNM stage, histological type and tumor diameter), Snail expression, E-cad expression and Snail + E-cad expression were used for time-dependent ROC analysis. The results suggested that for patients with CRC, the clinical risk score combined with Snail and E-cad expression had a greater contribution than any of these markers alone (Fig. 3F).
Snail promotes CRC cell migration by decreasing E-cad
Previous studies have shown an association between Snail and E-cad expression and lymph node metastasis, TNM stage and distant metastasis in CRC (4,5). To investigate the effects of Snail and E-cad on CRC cells, lentivirus was used to generate stable cell lines of HCT 116 and HT 29 (Fig. 4A). There following groups were established under normal culture conditions: Overexpression LV-Snail, overexpression LV-E-cad, knockdown LV-Snail-shRNA, knockdown LV-E-cad-shRNA and corresponding control groups. Wound healing and high content cell migration assay were used to detect changes in cell migration. The migration of LV-Snail cells was significantly increased compared with the corresponding control group, while the migration of LV-Snail-shRNA cells was decreased (Fig. 4B-F).
Subsequently, the present study detected expression levels of Snail and E-cad in each group after lentivirus infection by western blotting. The data showed that E-cad expression was decreased in each group following infection with LV-Snail lentivirus compared with respective control groups. Following infection with LV-Snail-shRNA lentivirus, the expression levels of E-cad were elevated (Fig. 5A and B). The present study altered expression levels of E-cad by secondary lentivirus infection. Cell migration was decreased after re-infection with LV-E-cad lentivirus to increase the expression levels of E-cad in LV-Snail CRC cells. By contrast, LV-E-cad-shRNA cell migration was enhanced following infection with LV-E-cad-shRNA lentivirus (Fig. 5C and D).
Snail promotes CRC cell proliferation in vivo
To study the effect of Snail on the proliferation of CRC cells in vivo, stable LV-Snail and LV-Snail-ctrl HCT 116 cells were subcutaneously injected into nude mice. The mice were sacrificed after 21 days. There was much more vascular-rich cancer tissue in LV-Snail group than in the control group (Fig. 6A). The tumor volume of each group was measured every week. The diameter of the largest tumor tissue was ~6 mm. The tumor volume was larger in LV-Snail group than in the control group (Fig. 6B; P<0.01). Expression levels of CD31 were detected in tissue by IHC. The data revealed that the expression levels of CD31 in the transplanted tumors in the LV-Snail group were higher than those in the control group (Fig. 6C and D; P<0.01), which suggested that Snail served a notable role in promoting the angiogenesis of CRC cells in vivo.
Discussion
CRC is one of the most common types of cancer of the digestive system. In 2020, there were ~1.9 million new cases of CRC worldwide, resulting in >900,000 deaths (1). Although the incidence and mortality rate of CRC have decreased steadily in previous years, there is an upward trend in the incidence and mortality rates of individuals <50 years old (14–17). Tumor metastasis is a complicated process involving tumor cells invading the microenvironment, entering the blood, migration, angiogenesis and proliferation. Postoperative recurrence and metastasis are the primary reasons for the low survival rate of patients with CRC (18). Therefore, it is imperative to find molecular markers that can predict the prognosis of patients with CRC.
EMT is a process in which epithelial cells lose epithelioid features and switch to invasive mesenchymal cells, manifested by decreased expression levels of epithelial genes, such as E-cad and occludin, and increased expression of mesenchymal genes, such as N-cad and Vimentin (19). EMT is mainly involved in embryo development, wound healing, cancer cell metastasis and drug resistance (20,21).
E-cad protein primarily exists in epithelial cells and regulates cell adhesion in tissue. Reduction of E-cad expression usually indicates the beginning of EMT. Studies have demonstrated that expression of E-cad can inhibit tumor progression and invasion, and thus E-cad is considered a classical tumor inhibitor (4,5,8).
Snail is a member of the zinc finger transcription factor Snail family. This family encodes transcriptional inhibitors and shares a conserved C-terminal domain containing 4–6 C2H2 type zinc fingers that bind to the E-box motif (5′-CANNTG-3′) of the target gene promoter (22). Snail is a primary inducer of EMT and has been associated with recurrence, metastasis and poor prognosis of breast cancer (23,24). Additionally, Snail is involved in acquisition of tumor stem cell features and inhibits estrogen receptor signaling (25,26), thus decreasing recurrence-free survival in patients with low-grade breast cancer (27). To the best of our knowledge, however, research on the role of Snail in CRC is currently lacking.
The present study suggested that Snail could promote the proliferation and migration of CRC cells in vitro. Furthermore, Snail was found to be a poor prognostic marker for patients with CRC. Based on our CRC database analysis, it was concluded that Snail and E-cad were independent prognostic markers. Next, the present study attempted to analyze whether these two indicators had a greater combined effect in predicting CRC prognosis. Notably, Snail and E-cad had a greater combined effect based on Kaplan-Meier survival and ROC curve analysis of clinical variables.
The present study was only a retrospective study of a single center; a multi-center study should be performed in the future to expand the sample size. In future, prospective studies should be performed and database analysis conclusions should be verified using cell phenotype experiments and animal models of transplanted and metastatic tumors in vivo.
In conclusion, the present study demonstrated that Snail and E-cad were prognostic molecular biomarkers in patients with CRC. Snail promoted proliferation of CRC cells in vivo and in vitro. Notably, the present study identified a greater combined effect of Snail and E-cad in predicting prognosis. Further research into the role of these proteins may improve the survival of patients with CRC.
Supplementary Material
Supporting Data
Acknowledgements
Not applicable.
Funding
The present study was supported by Top Talent Support Program for Young and Middle-aged People of Wuxi Health Committee (grant. no. WX2022); Wuxi City Health Planning Commission project (grant. no. Q202168); the Natural Science Foundation of Jiangsu Province (grant. no. BK20191149) and Scientific Research Project of Maternal and Child Health Care Association of Jiangsu Province (grant. no. FYX202119)
Availability of data and materials
The datasets generated and/or analyzed during the current study are available in the SUB13034094 repository, [https://www.ncbi.nlm.nih.gov/biosample/34085159 to https://www.ncbi.nlm.nih.gov/biosample/34085290.
Authors' contributions
WMW, YZ and JS conceived and designed the study and methodology. WMW, JJ, ZZ, YFW and KM performed the experiments and acquired the data. JJ, ZZ, YFW, KM, JPJ and XZ analyzed and interpreted the data. WMW, JJ, ZZ and JPJ wrote, reviewed and revised the manuscript. YZ and JS provided study supervision. All authors have read and approved the final manuscript. WMW and YZ confirm the authenticity of all the raw data.
Ethics approval and consent to participate
The Ethics Committee of Yixing Hospital approved the present study, which was performed according to the principles of the Declaration of Helsinki. The human and animal experiments were approved by the Ethics Committee of Yixing Hospital Affiliated to Yangzhou University (approval no. YXYLL-2015-42).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests
References
|
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 71:209–249. 2021. View Article : Google Scholar : PubMed/NCBI | |
|
Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global patterns and trends in colorectal cancer incidence and mortality. Gut. 66:683–691. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Thiery JP and Sleeman JP: Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol. 7:131–142. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Aigner K, Dampier B, Descovich L, Mikula M, Sultan A, Schreiber M, Mikulits W, Brabletz T, Strand D, Obrist P, et al: The transcription factor ZEB1 (deltaEF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene. 26:6979–6988. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Whiteman EL, Liu CJ, Fearon ER and Margolis B: The transcription factor snail represses Crumbs3 expression and disrupts apico-basal polarity complexes. Oncogene. 27:3875–3879. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Gumbiner B, Stevenson B and Grimaldi A: The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J Cell Biol. 107:1575–1587. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Gumbiner BM: Regulation of cadherin-mediated adhesion in morphogenesis. Nat Rev Mol Cell Biol. 6:622–634. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Navarro P, Gómez M, Pizarro A, Gamallo C, Quintanilla M and Cano A: A role for the E-cadherin cell-cell adhesion molecule during tumor progression of mouse epidermal carcinogenesis. J Cell Biol. 115:517–533. 1991. View Article : Google Scholar : PubMed/NCBI | |
|
Wang W, Li D, Xiang L, Lv M, Tao L, Ni T, Deng J, Gu X, Masatara S, Liu Y and Zhou Y: TIMP-2 inhibits metastasis and predicts prognosis of colorectal cancer via regulating MMP-9. Cell Adh Migr. 13:273–284. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Wang W, Chen Y, Deng J, Zhou J, Gu X, Tang Y, Zhang G, Tan Y, Ge Z, Huang Y, et al: Cullin1 is a novel prognostic marker and regulates the cell proliferation and metastasis in colorectal cancer. J Cancer Res Clin Oncol. 141:1603–1612. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wang S, Wu X, Chen Y, Zhang J, Ding J, Zhou Y, He S, Tan Y, Qiang F, Bai J, et al: Prognostic and predictive role of JWA and XRCC1 expressions in gastric cancer. Clin Cancer Res. 18:2987–2996. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wang T, Gao X, Chen S, Li D, Chen S, Xie M, Xu Z and Yang G: Genome-wide identification and expression analysis of ethylene responsive factor family transcription factors in Juglans regia. PeerJ. 9:e124292021. View Article : Google Scholar : PubMed/NCBI | |
|
Austin H, Henley SJ, King J, Richardson LC and Eheman C: Changes in colorectal cancer incidence rates in young and older adults in the United States: What does it tell us about screening. Cancer Causes Control. 25:191–201. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Bhandari A, Woodhouse M and Gupta S: Colorectal cancer is a leading cause of cancer incidence and mortality among adults younger than 50 years in the USA: A SEER-based analysis with comparison to other young-onset cancers. J Investig Med. 65:311–315. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Howlader N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, et al: SEER cancer statistics review, 1975–2012. National Cancer Institute; Bethesda, MD: 2014 | |
|
Singh KE, Taylor TH, Pan CG, Stamos MJ and Zell JA: Colorectal cancer incidence among young adults in California. J Adolesc Young Adult Oncol. 3:176–184. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Young JP, Win AK, Rosty C, Flight I, Roder D, Young GP, Frank O, Suthers GK, Hewett PJ, Ruszkiewicz A, et al: Rising incidence of early-onset colorectal cancer in Australia over two decades: Report and review. J Gastroenterol Hepatol. 30:6–13. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wang L, Cho KB, Li Y, Tao G, Xie Z and Guo B: Long noncoding RNA (lncRNA)-mediated competing endogenous RNA networks provide novel potential biomarkers and therapeutic targets for colorectal cancer. Int J Mol Sci. 20:57582019. View Article : Google Scholar : PubMed/NCBI | |
|
Lamouille S, Xu J and Derynck R: Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 15:178–196. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Hay ED: An overview of epithelio-mesenchymal transformation. Acta Anat (Basel). 154:8–20. 1995. View Article : Google Scholar : PubMed/NCBI | |
|
Kalluri R and Weinberg RA: The basics of epithelial- mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Nieto MA: The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 3:155–166. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Chen WJ, Wang H, Tang Y, Liu CL, Li HL and Li WT: Multidrug resistance in breast cancer cells during epithelial-mesenchymal transition is modulated by breast cancer resistant protein. Chin J Cancer. 29:151–157. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Moody SE, Perez D, Pan TC, Sarkisian CJ, Portocarrero CP, Sterner CJ, Notorfrancesco KL, Cardiff RD and Chodosh LA: The transcriptional repressor snail promotes mammary tumor recurrence. Cancer Cell. 8:197–209. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Ye Y, Xiao Y, Wang W, Yearsley K, Gao JX and Barsky SH: ERalpha suppresses slug expression directly by transcriptional repression. Biochem J. 416:179–187. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Ye Y, Xiao Y, Wang W, Yearsley K, Gao JX, Shetuni B and Barsky SH: ERalpha signaling through slug regulates E-cadherin and EMT. Oncogene. 29:1451–1462. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kurrey NK, Jalgaonkar SP, Joglekar AV, Ghanate AD, Chaskar PD, Doiphode RY and Bapat SA: Snail and slug mediate radioresistance and chemoresistance by antagonizing p53-mediated apoptosis and acquiring a stem-like phenotype in ovarian cancer cells. Stem Cells. 27:2059–2068. 2009. View Article : Google Scholar : PubMed/NCBI |
