Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
January 2013 Volume 29 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 29 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells

  • Authors:
    • Xue-Mei Liao
    • Kwok-Nam Leung
  • View Affiliations / Copyright

    Affiliations: Biochemistry Programme, School of Life Sciences, The Chinese University of Hong Kong, Hong Kong, SAR, P.R. China
  • Pages: 371-379
    |
    Published online on: October 19, 2012
       https://doi.org/10.3892/or.2012.2094
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Neuroblastoma is the most common extracranial solid tumor found in infancy and childhood. Current multimodal therapies such as surgery, chemotherapy, radiotherapy and stem cell transplantation often cause inevitable severe side-effects, therefore, it is necessary to develop novel drugs with higher efficacy on neuroblastoma cells and minimal side-effects on normal cells. Indirubin-3'-oxime (I3M), an indigo alkaloid, was found to exhibit potent antitumor activities on various types of cancer cells. However, its modulatory effects on human neuroblastoma and the underlying mechanisms remain poorly understood. As mitochondrial biogenesis and function play critical roles in cell growth and survival, in the present study the effects of I3M on mitochondrial functions and their correlation to the anticancer effect of I3M on human neuroblastoma cells were investigated. I3M was found to inhibit the growth of the human neuroblastoma LA-N-1, SH-SY5Y and SK-N-DZ cells in a dose- and time-dependent manner, but exhibited little, if any, direct cytotoxicity on normal cells. Mechanistic studies showed that I3M specifically decreased the expression of the mitochondrial regulators ERRγ and PGC-1β and resulted in decreased mitochondrial mass and altered mitochondrial function characterized by a reduction in mitochondrial membrane potential and elevation of reactive oxygen species levels in LA-N-1 cells. I3M also increased the level of CDK inhibitor p27Kip1 and reduced the levels of CDK2 and cyclin E in LA-N-1 cells, leading to cell cycle arrest at the G0/G1 phase. Collectively, these results suggest that mitochondrial dysfunction might be an important mechanism underlying the I3M-induced cell cycle arrest.

Introduction

Neuroblastoma, a malignant neoplasm of the sympathetic nervous system, is thought to arise from the neural crest cells (1). It is the most common and fatal extracranial solid tumor in childhood and accounts for 8–10% of all childhood cancers. Children with localized neuroblastoma can be cured with surgery and/or chemotherapy. Approximately 50% of neuroblastoma patients have high-risk disease with widespread tumor dissemination. For these children, current treatment modalities consist of intensive chemotherapy, surgery, radiotherapy, stem cell transplantation, differentiation therapy and immunotherapy (2). However, these treatments often cause severe and inevitable side-effects and relapse frequently occurs in high-risk patients despite aggressive multimodal therapy. Neuroblastoma currently accounts for ~15% of childhood cancer-related mortality rates and is a major problem in pediatric oncology (2). It is important to develop novel drugs which are potent in inhibiting the proliferation of cancer cells while exhibiting minimal cytotoxicity towards the normal cells. The use of new promising therapeutic compounds derived from natural products or Chinese herbs has attracted much interest as an alternative in cancer treatment.

Indirubin, a 3, 2′-bisindole isomer of indigo, is an active ingredient of Danggui Longhui Wan used in Traditional Chinese Medicine for the treatment of chronic diseases such as chronic myelogenous leukemia (3). In the past decade, a number of indirubin analogs have been synthesized to optimize this promising drug scaffold. Indirubin-3′-oxime (I3M) (Fig. 1) is a cell-permeable derivative of indirubin commercially available with increased kinase inhibitory effects (4) and increased solubility (5). Previous studies identified indirubin and I3M as potent inhibitors of cyclin-dependent kinases (CDKs) (6,7) and glycogen synthase kinase-3β (GSK-3β) (5,7). I3M has been reported to inhibit cell proliferation and arrest the cell cycle progression of various cancer cells (6,8,9). It was also shown to induce apoptosis in human cervical cancer HeLa cells, colon cancer HCT116 cells, hepatoma HepG2 cells and renal cell cancer cell lines in a time- and dose-dependent manner (10,11). Aside from the induction of apoptosis, I3M was found to induce necrosis in nocodazole-synchronized SV-40 transformed human breast epithelial HBL-100 cells (9). Previously, I3M was reported to exhibit antitumor effects against benzo(α)pyrene-induced lung cancer in A/J mice through its apoptotic action (12). However, the modulatory effects and the detailed molecular action mechanisms of I3M on human neuroblastoma cells have yet to be studied.

Figure 1

Chemical structure of indirubin-3′-oxime.

Functional mitochondria act as a primary source of energy output and are required for all cellular activities. It is known that mitochondria are involved in a wide range of cellular processes, such as cell signaling, cellular differentiation, cell death, as well as the control of the cell cycle and cell growth (13). Recent studies revealed that mitochondrial biogenesis and function are intimately linked to cell cycle progression. For instance, knockdown of human mitochondrial transcription termination factor 4 (hMTERF4) in human cervical carcinoma HeLa cells induced accumulation of sub-G1 phase cells, whereas its overexpression promoted cell proliferation (14). In a series of experiments expanding on this theme in Drosophila, it was demonstrated that mutation in the cytochrome oxidase subunit Va led to a reduction in ATP production in the cell and arrested it in the G1 phase (15), and loss of function of Pdsw, a subunit of mitochondrial complex I, led to increased reactive oxygen species (ROS) production and blocked the cell in G1-S transition through reduction in cyclin E protein and upregulation of the CDK inhibitor p27Kip1 protein (16). The constitutively active nuclear hormone receptors, estrogen-related receptor α and γ (ERRα and ERRγ), together with their co-activators, the peroxisome proliferator-activated receptor-γ (PPARγ) co-activator-1α and -1β (PGC-1α and PGC-1β), are thought to regulate mitochondrial biogenesis and oxidative phosphorylation (17); they govern several important aspects of mitochondrial function (18).

In this study, we hypothesized that I3M might induce cell cycle arrest in the human neuroblastoma LA-N-1 cells which might be mediated through the triggering of mitochondrial dysfunction. Our present findings clearly show that I3M altered mitochondrial biogenesis and function, and finally resulted in cell cycle arrest in human neuroblastoma LA-N-1 cells at the G0/G1 phase.

Materials and methods

Cell culture and reagents

Human neuroblastoma cell line LA-N-1 was purchased from RIKEN BioResource Center Cell Bank (Japan), while SH-SY5Y, SK-N-DZ, human embryonic kidney HEK-293 and human hepatocyte-like WRL-68 cell lines were purchased from the American Type Culture Collection (ATCC, USA). LA-N-1 cells were cultured in RPMI-1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco), 1% antibiotics (100 U/ml penicillin G, 100 μg/ml streptomycin sulfate and 0.25 μg/ml amphotericin B in 0.85% saline). SH-SY5Y cells were grown in DMEM/F12 medium (Gibco) supplemented with 15% FBS, 1% antibiotics, 1 mM sodium pyruvate and 1 mM MEM with non-essential amino acids (NEAA) solution. SK-N-DZ and HEK 293 cells were cultured in DMEM medium supplemented with 10% FBS and 1% antibiotics. WRL-68 cells were cultured in MEM medium (Gibco) supplemented with 10% FBS and 1% antibiotics. The primary embryonic cortical neurons from SD rats were kindly provided by Professor K.F. Lau, School of Life Sciences, The Chinese University of Hong Kong. The primary embryonic cortical neurons were cultured in MEM medium supplemented with 5% FBS, glucose (18 mM), L-glutamine (2 mM), insulin (5 μg/ml), progesterone (0.02 μM), putrescine (100 μM), selenium (30 pM), β-mercaptoethanol (25 μM) and 1% antibiotics. All cell lines were cultured at 37°C in a humidified incubator supplied with 5% CO2. I3M was purchased from Sigma-Aldrich (USA). Stock solution of I3M (10 mM) was prepared by dissolving the powdered form of I3M (with a molecular weight of 277.28 and >98% purity) in 100% dimethyl sulfoxide (DMSO; Sigma, USA) and stored in the dark at −20°C until use. All other chemicals were purchased from Sigma unless otherwise stated.

Cell growth assay

Cell growth was measured using both the colorimetric MTT assay and fluorometric cell proliferation assay. Cells were seeded in 96-well plates, cultured overnight and then treated with different concentrations of I3M. Following treatment for the indicated periods of time, cell growth was measured using the MTT assay and recorded by a Benchmark microplate reader (Bio-Rad Laboratories, USA) as previously described (19). In addition, cell proliferation was measured using the CyQUANT® NF Cell Proliferation Assay kit (Molecular Probes, Invitrogen Corp., USA) and recorded by a fluorescence plate reader (Tecan Polarion, USA) (20).

Colony-forming assay

Cell colony-forming ability was determined as previously described (21). Briefly, the 6-well tissue culture plates were pretreated with poly-D-lysine hydrobromide for 4 h and washed once with deionized water. Then, 400 cells were added into each well of a 6-well plate and allowed to settle overnight. Cells were treated with I3M for 24 h. On the following day, the medium was replaced with completed RPMI medium. The medium was changed every 3 days. After 6 days, colonies were fixed with methanol and stained with Hemacolor staining solutions. Colonies were counted and the percentage of colonies relative to solvent-treated control was calculated.

Apoptosis assay

The Cell Death Detection ELISAPLUS kit (Roche Applied Science, Switzerland) was used to quantify the enrichment of cytoplasmic nucleosomes which reflects the induction of apoptosis in the cells. LA-N-1 cells were seeded in 96-well plates at a density of 1.5×104 cells per well. On the following day, cells were treated with solvent control (0.1% DMSO) or different concentrations of I3M for 48 h. Doxorubicin (0.2 μM) was used as positive control. Procedures were performed according to the manufacturer’s instructions and absorbance was measured at 405 nm with reference to 490 nm by a Benchmark microtiter plate reader (Bio-Rad Laboratories) after color development, which was proportional to the amount of nucleosomes present in the samples. The results were expressed as enrichment factor which represents the relative levels of mono- and oligo-nucleosomes compared with the solvent control.

Cell cycle analysis

LA-N-1 cells were seeded in 60-mm dishes at a density of 9×105 cells per dish and incubated overnight. After synchronizing in plain RPMI medium for 24 h, cells were treated with different concentrations of I3M for 48 h. Following treatment, cells were fixed with 70% ethanol, treated with 50 μg/ml RNase A (Sigma), stained with 40 μg/ml propidium iodide (Sigma) and analyzed by the FACSCanto flow cytometer (BD Biosciences, USA) for DNA synthesis and cell cycle status. The percentages of cells in the G0/G1, S and G2/M cell cycle phases were calculated by the ModFit 3.0 program (BD Biosciences).

Quantitative real-time PCR

Total RNA from LA-N-1 cells was extracted by TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. The first-strand cDNA was generated with random primers (Invitrogen) by M-MLV reverse transcription kits (Invitrogen). Quantitative real-time PCR analysis was performed with SYBR premix Ex Taq kit (Takara, China) using ABI-7500 Real-Time PCR System (Applied Biosystems, USA). Relative gene expression was normalized to β-actin level. The sequences of primers used are listed in Table I.

Table I

Primer sequences used for RT-PCR based on human genes and shown from 5′- to 3′-.

Table I

Primer sequences used for RT-PCR based on human genes and shown from 5′- to 3′-.

β-actin-forward CAGGAGATGGCCACTGCCGCA
β-actin-reverse CTCCTTCTGCATCCTGTCAGCA
CDK2-forward TTGGGCTATTTGGACTCAGG
CDK2- reverse AAGGGTGGTGGAGGCTAACT
Cyclin E-forward CGTGCGTTTGCTTTTACAGA
Cyclin E- reverse CTGGAGGTGGCTGGTGTACT
ERRγ-forward AATGAATGTGAAAGGCTGTG
ERRγ-reverse TAGTTGTGTGTGAATGTATGGG
PGC-1β-forward CTCATACGCTACATGCACAC
PGC-1β-reverse GCCAAGACCAGCAGCTC
ATP5b-forward TGTTGGCAGTGAGCATTACG
ATP5b-reverse ACCTGTGAAGACCTCAGCAAC
Tfam-forward AAGATTCCAAGAAGCTAAGGGTGA
Tfam-reverse CAGAGTCAGACAGATTTTTCCAGTTT
SOD1-forward ATTCTGTGATCTCACTCTCAGG
SOD1-reverse TCGCGACTAACAATCAAAGT
SOD2-forward GGGGCACGTGTTAAGGATGT
SOD2-reverse AGAATCTTGAGTTTCCTTCACCG
Western blot analysis

Cell pellets were collected at the indicated time points and total proteins were extracted by cell lysis buffer. Protein concentration was measured by the Bradford reagent (Sigma). Protein extracts were analyzed by 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis and blotted onto polyvinylidene fluoride membranes. Membranes were blocked with 5% non-fat dairy milk in Tris-buffered saline (20 mM Tris, 150 mM NaCl, pH 7.4) with 0.05% Tween-20 and incubated with mouse anti-human CDK2 antibody (Cell Signaling Technology, USA), rabbit anti-human-ERRα, -ERRγ, -PGC-1α and -PGC-1β antibodies (Cell Signaling Technology), rabbit anti-human cyclin E antibody (Santa Cruz Biotechnology, USA), or mouse anti-human β-actin antibody (Sigma) followed by HRP-conjugated secondary antibody (GE Healthcare UK Ltd., UK) and developed with the ECL reagent (Santa Cruz Biotechnology).

Mitochondrial mass assay

Mitotracker Green (Invitrogen) was added and quantified as described by Liao et al(22). Briefly, I3M-treated cells were incubated in serum-free medium (pre-warmed to 37°C) containing 150 nM Mitotracker Green FM for 20 min in the dark. After staining, the cells were washed twice with cold PBS and suspended in 500 μl PBS. Subsequently, cells were analyzed on a FACSCanto flow cytometer with excitation at 488 nm and emission at 516 nm. Data were processed using the CellQuest program (BD Biosciences).

Reactive oxygen species assay

ROS production in mitochondria was measured by a cell-permeable fluorogenic probe MitoSOX™ Red (Invitrogen) that is selectively targeted to the mitochondria, where it specifically reacts with superoxide anion as previously described (22). Briefly, I3M-treated cells were loaded with 5 μM MitoSOX Red for 10 min at 37°C, washed with PBS, and the fluorescence was detected with the FACSCanto flow cytometer with excitation at 488 nm and emission at 580 nm. Data were processed using the CellQuest program.

Mitochondrial membrane potential determination

Mitochondrial membrane potential (ΔΨm) was analyzed by a fluorescent dye JC-1 (Invitrogen). JC-1 is capable of selectively entering mitochondria where it forms monomers and emits green fluorescence when ΔΨm is relatively low. At high ΔΨm, JC-1 aggregates and gives red fluorescence. Briefly, I3M-treated cells were incubated in serum-free medium (pre-warmed to 37°C) containing 4 μM JC-1 for 20 min in the dark. After staining, the cells were washed once with cold PBS and suspended in 500 μl PBS. Green (525 nm) and red (590 nm) fluorescence were detected on a FACSCanto flow cytometer. Data were processed by using the CellQuest program.

Statistical analysis

All assays were performed at least three times and the data are presented as the mean ± SD. The Student’s t-test was used to determine the significant difference between the drug-treated group and the control group. P<0.05 is regarded as statistically significant. Asterisks indicate significant differences: *P<0.05, **P<0.01, ***P<0.001.

Results

Indirubin-3′-oxime inhibits the growth and colony formation of human neuroblastoma cells in vitro

To examine the effect of I3M on the growth of human neuroblastoma cells, the MTT assay, CyQUANT NF cell proliferation assay and colony-forming assay were performed. Three human neuroblastoma cell lines LA-N-1, SH-SY5Y and SK-N-DZ, were exposed to increasing concentrations of I3M for 24, 48 and 72 h and the relative cell number was monitored by MTT assay. As shown in Fig. 2A, I3M dose- and time-dependently reduced the growth of the three cell lines. The 50% inhibitory concentration (IC50) values of I3M on LA-N-1, SH-SY5Y and SK-N-DZ cells after 48-h treatment were 3.27±0.9, 18.15±1.91 and 5.4±0.28 μM respectively, indicating that I3M has the highest potency on LA-N-1 cells. I3M also inhibited the proliferation of LA-N-1, SH-SY5Y and SK-N-DZ cells in a dose-dependent manner after 48-h treatment (Fig. 2B). It has been shown that the colony-forming ability of drug-treated tumor cells is related to their tumorigenicity in vivo(23). I3M was found to decrease the colony-forming ability of LA-N-1 cells dose-dependently (Fig. 2C). A drug with a high therapeutic index indicates that it is potent in inhibiting the proliferation of cancer cells while exhibiting little or minimal cytotoxicity towards the normal cells. In this study, I3M was found to exhibit little, if any, direct cytotoxicity on the normal cells such as rat primary embryonic cortical neuronal cells, human embryonic kidney HEK-293 cells and human hepatocyte-like WRL-68 cells at or below 10 μM concentrations (Fig. 2D).

Figure 2

Growth-inhibitory effect of I3M on human neuroblastoma cells vs. normal cells. LA-N-1 cells (1.5×104 cells/well), SH-SY5Y cells (104 cells/well) or SK-N-DZ cells (104 cells/well) were treated with solvent control (0.1% DMSO) or various concentrations of I3M. (A) After treatment for 24, 48 or 72 h, the relative cell number was measured by the MTT assay. (B) After treatment for 48 h, relative cell proliferation was measured using the CyQUANT NF Cell Proliferation Assay kit. (C) LA-N-1 cells (400 cells/well) in 6-well plates were treated with I3M for 24 h. After 6 days, colonies were fixed, counted and shown as percentage of solvent-treated control in 3 independent experiments. (D) Rat primary embryonic cortical neurons (106 cells/well), human embryonic kidney HEK-293 cells (8×103 cells/well) or human hepatocyte-like cell line WRL-68 cells (5×103 cells/well) were treated with solvent control or various concentrations of I3M for 48 h and the relative cell number was determined by the MTT assay. Data are expressed as the means ± SD. **P<0.01; ***P<0.001.

Indirubin-3′-oxime induces G0/G1 cell cycle arrest in LA-N-1 cells

Since I3M caused a significant inhibition of cell growth in the human neuroblastoma LA-N-1 cells, the underlying mechanisms were investigated. The possible mechanisms of I3M leading to its potent anti-proliferative effect is its ability to induce apoptosis or interrupt the normal cell cycle progression. Initially, the Cell Death Detection ELISAPLUS kit was used to determine whether I3M could induce apoptosis in the neuroblastoma LA-N-1 cells. I3M failed to induce significant apoptosis of the LA-N-1 cells at concentrations that are inhibitory for the growth of the cells (Fig. 3). Next, we investigated whether the I3M-induced cell growth inhibition was due to an arrest at a specific point of the cell cycle. It was found that at concentrations >2.5 μM, I3M significantly induced cell cycle arrest at the G0/G1 phase, accompanied by a significant decrease in the percentage of cells in the S and G2/M phase (Fig. 4A). The effects of I3M on the expression of the G0/G1 phase regulatory proteins including cyclins, cyclin-dependent kinases (CDKs) and CDK inhibitors in LA-N-1 cells were then examined. As shown in Fig. 4B, the I3M-treated cells exhibited an increase in p27Kip1, and a decrease in the protein levels of CDK2 and cyclin E compared to the corresponding untreated control. Using the technique of real-time polymerase chain reaction, it was shown that the mRNA levels of CDK2 and cyclin E decreased in a dose-dependent manner following treatment with I3M (Fig. 4C and D).

Figure 3

I3M does not induce apoptosis in LA-N-1 cells. LA-N-1 cells were seeded in 96-well plates at a density of 1.5×104 cells per well. On the following day, cells were treated with solvent control (0.1% DMSO) or different concentrations of I3M for 48 h. Doxorubicin (0.2 μM) was used as positive control. The released cytoplasmic mono- and oligo-nucleosomes were quantified by the Cell Death Detection ELISAPLUS kit according to the manufacturer’s instructions. Enrichment factor represents the relative levels of mono- and oligo-nucleosomes compared with solvent control. **P<0.01.

Figure 4

I3M induces cell cycle arrest at the G0/G1 phase in LA-N-1 cells. (A) LA-N-1 cells were seeded in 60-mm dishes (9×105 cells per dish) and incubated overnight. Cell cycle distribution of cells treated without or with I3M for 48 h was analyzed by flow cytometry using the ModFit program. (B) LA-N-1 cells were incubated either with solvent control (0.1% DMSO) or with various concentrations of I3M for 48 h. Protein levels of p27Kip1, CDK2 and cyclin E were assayed by western blots with β-actin as an internal control. mRNA expression levels of CDK2 (C) and cyclin E (D) were detected using quantitative real-time PCR (qRT-PCR) after 24 h of I3M treatments. **P<0.01; ***P<0.001.

Indirubin-3′-oxime causes mitochondrial dysfunction in LA-N-1 cells

The roles of mitochondrial biogenesis and function in cell growth and proliferation have been investigated. Mitochondrial function is known to play a pivotal role in the maintenance of cellular homeostasis. Previous studies have shown that mitochondrial dysfunction causes cell cycle arrest in neuronal PC12 cells (24). In the present study, whether the I3M-mediated growth suppression of LA-N-1 cells was correlated with mitochondrial biogenesis and function was examined. The changes in mitochondrial mass were measured by staining the cells with a fluorescent MitoTracker Green dye that stains the mitochondria independent of its ΔΨm. It was found that I3M dose-dependently reduced the mitochondrial mass (Fig. 5A). Correspondingly, the expression levels of mitochondrial transcription factor A (Tfam) and ATP synthase (ATP5b) that are involved in regulating mitochondrial mass and ATP production, respectively, were significantly reduced by I3M (Fig. 5B and C). It would be of interest to examine if I3M altered mitochondrial function in addition to reducing the mitochondrial mass in the human neuroblastoma LA-N-1 cells. First, the effect of I3M on the ΔΨm of LA-N-1 cells was studied. A fluorescent dye JC-1, which gives a red fluorescence when ΔΨm is high and green fluorescence when ΔΨm is low, was used to determine the overall electron transport chain activity. Indeed, quantification measurements indicated that I3M dose-dependently decreased the red to green fluorescence ratio, indicating a decrease in ΔΨm (Fig. 6). Decreased ΔΨm inhibits ATP generation, results in oxidative stress and leads to mitochondrial dysfunction. In order to demonstrate that I3M could result in oxidative stress in LA-N-1 cells, the ability of I3M to induce the generation of ROS was examined. Using a fluorescent MitoSOX Red dye, which selectively targets the mitochondria and reacts with superoxide anion, it was found that I3M elevated mitochondrial ROS levels in LA-N-1 cells dose-dependently (Fig. 5D). An endogenous antioxidant system that protects cells against ROS is characterized by superoxide dismutases (SODs). We also checked the mRNA expression levels of SOD1 and SOD2 in I3M-treated cells and found that it selectively suppressed the expression of SOD2, which resides in the mitochondria, but not SOD1 that is found mainly in intracellular cytoplasmic spaces (25) (Fig. 5E and F).

Figure 5

I3M reduces mitochondrial mass and elevated mitochondrial ROS in LA-N-1 cells. LA-N-1 cells were seeded in 24-well plates at a density of 1.5×105 cells per well and incubated overnight. (A) Mitochondrial mass of cells treated with I3M for 48 h were stained by Mitotracker Green and quantified. The amount of mitochondrial mass in the solvent-treated control was set as 100%. (D) Mitochondrial ROS levels of cells treated with I3M for 48 h were stained by MitoSOX Red and quantified. The amount of mitochondrial ROS in the solvent-treated control was set as 1. The mRNA expression levels of Tfam (B), ATP5b (C), SOD1 (E) and SOD2 (F) were detected using qRT-PCR after 24 h of I3M treatment. The relative level for the solvent-treated control was set as 1. **P<0.01; ***P<0.001.

Figure 6

I3M decreases mitochondrial membrane potential (ΔΨm) in LA-N-1 cells. LA-N-1 cells were seeded in 24-well plates at a density of 1.5×105 cells per well. On the following day, cells were treated with solvent control (0.1% DMSO) or I3M at the indicated concentrations for 24 h. ΔΨm was determined by flow cytometry with the dye JC-1. Cells that emit more red fluorescence indicate higher membrane potential. (A) The numbers at the corners represent the percentage of cells in the corresponding quadrants. Results are representative of three independent experiments. (B) The red (FL-2) to green (FL-1) fluorescence ratios for LA-N-1 cells treated with various concentrations of I3M for 24 h are shown. **P<0.01; ***P<0.001.

Indirubin-3′-oxime selectively reduces ERRγ and PGC-1β protein and mRNA levels in LA-N-1 cells

Our previous results showed that I3M suppressed the mRNA expression levels of SOD2, Tfam and ATP5b in LA-N-1 cells. It has been reported that ERRα, ERRγ, PGC-1α, and PGC-1β are responsible for controlling the expression of these genes at the transcriptional level and regulate mitochondrial mass and oxidative phosphorylation (17). Therefore, whether I3M can alter the mRNA and protein levels of these transcriptional factors and co-activators was investigated. Using western blot analysis, the protein levels of ERRα and PGC-1α were not found to be significantly altered by I3M (Fig. 7A). On the contrary, the protein levels of ERRγ and PGC-1β were markedly reduced (Fig. 7A). To determine whether the suppression was at the transcriptional level, the mRNA levels of ERRγ and PGC-1β were determined by quantitative RT-PCR analysis. The mRNA expression levels of ERRγ and PGC-1β were significantly decreased after I3M treatment (Fig. 7B and C).

Figure 7

I3M downregulates the expression of ERRγ and PGC-1β. (A) Representative western blots of ERRα, ERRγ, PGC-1α, PGC-1β, with β-actin as a control after treatment with I3M for 48 h in LA-N-1 cells. The mRNA expression levels of ERRγ (B) and PGC-1β (C) were measured after 24 h of I3M treatment in LA-N-1 cells. The relative level for the solvent-treated control was set as 1. **P<0.01; ***P<0.001.

Discussion

Neuroblastoma is a childhood cancer that, despite intensive multimodality therapy, is often fatal. Conventional treatments often cause severe and inevitable side-effects, therefore, there is a need for the development of alternative therapeutic approaches which are potent in inhibiting the proliferation of cancer cells while exhibiting minimal cytotoxicity towards the normal cells. Indirubin and its derivatives have been shown to have growth-inhibitory effects on various human cancer cells by inducing cell cycle arrest and/or apoptosis (6,9–11,26–28). Previously, indirubin-3′-oxime, a derivative of indirubin, was shown to induce G0/G1 cell cycle arrest and apoptosis in Hep-2 human laryngeal carcinoma cells through induction of CDK inhibitor p21, inhibition of cyclin D1 and activation of caspase-3 (26). However, its modulatory effects on human neuroblastomas and the underlying action mechanisms remain poorly understood. In this study, the growth-inhibitory activities of I3M on the human neuroblastoma cells were investigated and the possible antitumor mechanisms were elucidated.

The effects of I3M on three human neuroblastoma cell lines, LA-N-1, SH-SY5Y and SK-N-DZ, were studied. Our results showed that treatment with I3M led to growth inhibition in all three human neuroblastoma cell lines in a dose- and time-dependent manner. The growth-inhibitory effect of I3M was most potent in LA-N-1 cells with the lowest IC50 value compared with those values for SH-SY5Y and SK-N-DZ cells. Therefore, LA-N-1 cells were selected for further mechanistic studies for the antitumor activity of I3M on human neuroblastoma cells. Markedly, I3M was found to exhibit little, if any, direct cytotoxicity on the normal cell models such as primary rat embryonic cortical neuronal cells, human embryonic kidney HEK-293 cells and human hepatocyte-like WRL-68 cells, at concentrations that are inhibitory to the neuroblastoma LA-N-1 cells, suggesting that I3M may be of therapeutic potential.

Cell growth is regulated by several factors, including growth factors, amino acids, and energy status to ensure that cell growth is appropriate to environmental conditions. In order to promote cell growth and division, cells need to coordinate synthesis of proteins, nucleic acids, and lipids for genome and organelle duplications. These processes consume high levels of energy. The mitochondrion is the cell’s powerhouse responsible for energy production. Mitochondrial biogenesis and function play critical roles in cell growth and proliferation. For example, overexpression of a yeast homolog of mammalian Tfam shortens the G1 phase of the cell cycle (29). Downregulation of hMTERF4 inhibited cell proliferation, resulting in cell cycle arrest at the sub-G1 phase (14).

In this study, we demonstrated that I3M could block the human neuroblastoma cells’ entry into the rapidly growing phase and this might be mediated, at least in part, by inducing mitochondrial dysfunction. We found that I3M selectively reduced the expressions of ERRγ and PGC-1β, which are regulators of mitochondrial biogenesis and function. Downregulation of ERRγ and PGC-1β is likely to be a primary event preceding some of the mitochondrial dysfunctions observed with I3M. In particular, the expression levels of Tfam, ATP5b and SOD2, which are regulated by PGC-1α, PGC-1β with ERRα or ERRγ (17), were suppressed by I3M. Suppressing the expression of the oxidative phosphorylation enzyme (ATP5b) and mitochondrial biogenesis regulator (Tfam) is likely to result in reduced oxidative phosphorylation and the ability to generate ATP, which may be the main mechanism behind the decreased ΔΨm and cellular ATP levels, as previously reported (30). The elevation of ROS levels and reduction in ATP levels might be the reasons for the increased CDK inhibitor p27Kip1, and decreased CDK2 and cyclin E levels, and cell cycle arrest of LA-N-1 cells at the G0/G1 phase, and our results are in line with a previous report showing that the mitochondrion has a direct and specific role in the regulation of cell cycle progression (15).

Collectively, our findings indicate that I3M might exert its growth-inhibitory effect on the human neuroblastoma LA-N-1 cells by causing mitochondrial dysfunction which results in cell cycle arrest. Moreover, I3M exhibited minimal cytotoxicity towards the normal cells. Therefore, further elucidation of the action mechanisms of I3M on human neuroblastoma cells may provide better insights in the development of I3M as a drug candidate for the treatment of this pediatric cancer.

Acknowledgements

We thank Professor K.F. Lau for providing us with the primary embryonic cortical neurons from SD rats and Miss Ada Kong for her technical assistance in this study.

References

1 

Maris JM: Recent advances in neuroblastoma. N Engl J Med. 362:2202–2211. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Park JR, Eggert A and Caron H: Neuroblastoma: biology, prognosis, and treatment. Hematol Oncol Clin North Am. 24:65–86. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Xiao Z, Hao Y, Liu B and Qian L: Indirubin and meisoindigo in the treatment of chronic myelogenous leukemia in China. Leuk Lymphoma. 43:1763–1768. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Zhang N, Jiang Y, Zou J, et al: 3D QSAR for GSK-3beta inhibition by indirubin analogues. Eur J Med Chem. 41:373–378. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Meijer L, Skaltsounis AL, Magiatis P, et al: GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem Biol. 10:1255–1266. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Hoessel R, Leclerc S, Endicott JA, et al: Indirubin, the active constituent of a Chinese antileukaemia medicine, inhibits cyclin-dependent kinases. Nat Cell Biol. 1:60–67. 1999.PubMed/NCBI

7 

Leclerc S, Garnier M, Hoessel R, et al: Indirubins inhibit glycogen synthase kinase-3 beta and CDK5/p25, two protein kinases involved in abnormal tau phosphorylation in Alzheimer’s disease. A property common to most cyclin-dependent kinase inhibitors? J Biol Chem. 276:251–260. 2001.PubMed/NCBI

8 

Nguyen MC, Bui HT, Dang HH, et al: Inhibitory effects of indirubin derivatives on the growth of HL-60 leukemia cells. Nat Prod Commun. 5:103–106. 2010.PubMed/NCBI

9 

Damiens E, Baratte B, Marie D, Eisenbrand G and Meijer L: Anti-mitotic properties of indirubin-3′-monoxime, a CDK/GSK-3 inhibitor: induction of endoreplication following prophase arrest. Oncogene. 20:3786–3797. 2001.

10 

Shi J and Shen HM: Critical role of Bid and Bax in indirubin-3′-monoxime- induced apoptosis in human cancer cells. Biochem Pharmacol. 75:1729–1742. 2008.PubMed/NCBI

11 

Perabo FG, Landwehrs G, Frossler C, Schmidt DH and Mueller SC: Antiproliferative and apoptosis inducing effects of indirubin-3′-monoxime in renal cell cancer cells. Urol Oncol. 29:815–820. 2011.

12 

Ravichandran K, Pal A and Ravichandran R: Effect of indirubin-3-monoxime against lung cancer as evaluated by histological and transmission electron microscopic studies. Microsc Res Tech. 73:1053–1058. 2010. View Article : Google Scholar : PubMed/NCBI

13 

McBride HM, Neuspiel M and Wasiak S: Mitochondria: more than just a powerhouse. Curr Biol. 16:R551–R560. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Yu M, Dai J, Huang WW, et al: hMTERF4 knockdown in HeLa cells results in sub-G1 cell accumulation and cell death. Acta Biochim Biophys Sin. 43:372–379. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Mandal S, Guptan P, Owusu-Ansah E and Banerjee U: Mitochondrial regulation of cell cycle progression during development as revealed by the tenured mutation in Drosophila. Dev Cell. 9:843–854. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Owusu-Ansah E, Yavari A, Mandal S and Banerjee U: Distinct mitochondrial retrograde signals control the G1-S cell cycle checkpoint. Nat Genet. 40:356–361. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Giguere V: Transcriptional control of energy homeostasis by the estrogen-related receptors. Endocr Rev. 29:677–696. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Wu ZD, Puigserver P, Andersson U, et al: Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell. 98:115–124. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Lo FH, Mak NK and Leung KN: Studies on the anti-tumor activities of the soy isoflavone daidzein on murine neuroblastoma cells. Biomed Pharmacother. 61:591–595. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Liu T, Hannafon B, Gill L, Kelly W and Benbrook D: Flex-Hets differentially induce apoptosis in cancer over normal cells by directly targeting mitochondria. Mol Cancer Ther. 6:1814–1822. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Opel D, Naumann I, Schneider M, Bertele D, Debatin KM and Fulda S: Targeting aberrant PI3K/Akt activation by PI103 restores sensitivity to TRAIL-induced apoptosis in neuroblastoma. Clin Cancer Res. 17:3233–3247. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Liao XM, Wang YF and Wong CW: Troglitazone induces cytotoxicity in part by promoting the degradation of peroxisome proliferator-activated receptor gamma co-activator-1 alpha protein. Br J Pharmacol. 161:771–781. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Freedman VH and Shin SI: Cellular tumorigenicity in nude mice: correlation with cell growth in semi-solid medium. Cell. 3:355–359. 1974. View Article : Google Scholar : PubMed/NCBI

24 

Bianco MR, Berbenni M, Amara F, et al: Cross-talk between cell cycle induction and mitochondrial dysfunction during oxidative stress and nerve growth factor withdrawal in differentiated PC12 cells. J Neurosci Res. 89:1302–1315. 2011. View Article : Google Scholar

25 

Zelko IN, Mariani TJ and Folz RJ: Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic Biol Med. 33:337–349. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Kameswaran TR and Ramanibai R: Indirubin-3-monooxime induced cell cycle arrest and apoptosis in Hep-2 human laryngeal carcinoma cells. Biochem Pharmacol. 63:146–154. 2009.PubMed/NCBI

27 

Xingi E, Smirlis D, Myrianthopoulos V, et al: 6-Br-5-methylindirubin-3′-oxime (5-Me-6-BIO) targeting the leishmanial glycogen synthase kinase-3 (GSK-3) short form affects cell-cycle progression and induces apoptosis-like death: exploitation of GSK-3 for treating leishmaniasis. Int J Parasitol. 39:1289–1303. 2009.

28 

Ribas J, Bettayeb K, Ferandin Y, et al: 7-bromoindirubin-3′-oxime induces caspase-independent cell death. Oncogene. 25:6304–6318. 2006.

29 

Loewith R, Jacinto E, Wullschleger S, et al: Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell. 10:457–468. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Nadanaciva S, Dykens JA, Bernal A, Capaldi RA and Will Y: Mitochondrial impairment by PPAR agonists and statins identified via immunocaptured OXPHOS complex activities and respiration. Toxicol Appl Pharmacol. 223:277–287. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liao X and Leung K: Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells. Oncol Rep 29: 371-379, 2013.
APA
Liao, X., & Leung, K. (2013). Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells. Oncology Reports, 29, 371-379. https://doi.org/10.3892/or.2012.2094
MLA
Liao, X., Leung, K."Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells". Oncology Reports 29.1 (2013): 371-379.
Chicago
Liao, X., Leung, K."Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells". Oncology Reports 29, no. 1 (2013): 371-379. https://doi.org/10.3892/or.2012.2094
Copy and paste a formatted citation
x
Spandidos Publications style
Liao X and Leung K: Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells. Oncol Rep 29: 371-379, 2013.
APA
Liao, X., & Leung, K. (2013). Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells. Oncology Reports, 29, 371-379. https://doi.org/10.3892/or.2012.2094
MLA
Liao, X., Leung, K."Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells". Oncology Reports 29.1 (2013): 371-379.
Chicago
Liao, X., Leung, K."Indirubin-3'-oxime induces mitochondrial dysfunction and triggers growth inhibition and cell cycle arrest in human neuroblastoma cells". Oncology Reports 29, no. 1 (2013): 371-379. https://doi.org/10.3892/or.2012.2094
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team