Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May 2013 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May 2013 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells

  • Authors:
    • Yingchao Wang
    • Chuyun Yin
    • Lei Feng
    • Lina Ma
    • Yongwei Wei
    • Guangyao Sheng
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052, P.R. China
  • Pages: 1923-1931
    |
    Published online on: February 28, 2013
       https://doi.org/10.3892/or.2013.2316
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The objective of the present study was to examine and determine whether the human acute monocytic leukemia cell line THP-1 contains side population (SP) cells, and, if so, to increase the proportion of SP cells using arabinosylcytosine (Ara-C). Fluorescent microscopy and flow cytometry were employed to detect the percentage of SP cells in THP-1 cells. Then, SP and non-SP (NSP) cell subpopulations were collected and identified. THP-1 cells were incubated with different concentrations of Ara-C for 24 h and the proportion of SP cells was detected. Our results demonstrated that the percentage of SP cells was 1.81±0.99% in THP-1 cells. A majority of the SP cells remained in the G0/G1 phase, and the expression of CD34+ and CD34+CD38- and the proliferation ability of the SP cells were higher compared to NSP cells (P<0.05). The mRNA expression of multidrug resistance genes (ABCG2 and ABCB1), apoptosis regulation genes (Bcl-2) and the Bcl-2/Bax value of SP cells were higher than those of NSP cells. SP cells have been shown to be more tumorigenic than NSP cells. Following co-culture with Ara-C, the proportion of SP cells increased significantly and subsequently the Ara-C concentration increased. These findings suggest that the THP-1 cell line contains SP cells and that SP cells possess certain intrinsic stem cell properties and may contain a larger proportion of leukemia stem cells (LSCs). The concentrations of SP cells can be increased with Ara-C by co-culture, and this technique is a useful and important application for the study of LSCs.

Introduction

Childhood and adolescent acute myeloid leukemia (AML) is one of the most challenging types of childhood cancer to successfully treat (1). The relapse rate remains unacceptably high, with a 5-year event-free survival (EFS) of approximately 50% (2). In addition, successful treatment can only be achieved using highly intensive chemotherapy that results in relatively high rates of treatment-related mortality and significant side-effects (3). Although extensive efforts are being made to eliminate these issues, an efficient and effective method of treating AML has yet to be developed. Novel therapeutic strategies are urgently required to improve the prognosis of this disease.

The cancer stem cells (CSCs) theory postulates the origin of cancer from a new perspective. CSCs are a small subset of cancer cells that possess stem cell-like properties, such as, the ability to self-renew via asymmetric division and to produce differentiated progeny. These cells generally remain in a quiescent state (4) and comprise a small minority of the total tumor population. They have an extensive capacity to proliferate, differentiate, and self-renew, enabling them to repopulate recipients after transplantation (5). This small population of cells within a cancer is responsible for drug resistance and the recurrence of cancer (6). Hence, the specific targeting of CSCs therapeutically must be explored. To date, the possible existence of CSCs has been shown in leukemia (7,8) and in certain solid tumors (9,10). CSCs have also been identified in immortalized cell lines (5), long-term cultured cancer cells (10,11), and patient tumor samples (5), using the side population (SP) technique.

Extensive research has focused on leukemia stem cells (LSCs) in the pursuit of new ideas for targeted therapy. Therefore, sorting, identifying and enriching LSCs has become particularly important in leukemia treatment research. Side population (SP) cells, as defined by Hoechst 33342 exclusion in flow cytometry, represent only a small fraction of the whole cell population (12); their properties occupy an important position in several investigations (13,14). Previous studies have shown that CSCs can be identified by an SP phenotype based on fluorescence-activated flow cytometry. SP cells have been found not only in patient tumor samples but also in immortalized cell lines and long-term cultured cancer cells (15,16); they have demonstrated the capacity to function as stem cells in the tissues from which they were isolated and may be able to transdifferentiate (17). SP cells share the most relevant features of LSCs, i.e., the self-renewal potential and quiescent status, and they contain relatively high concentrations of tumor stem cell indicators (18). Concurrent studies have shown that SP cells in human cancer have various origins, including acute myelogenous leukemia, neuroblastoma, and glioma (10,11,19). These studies have also suggested that SP cells may be a source of cancer stem cells (CSCs). SP cells can be sorted using flow cytometry, which is a suitable application for LSC sorting (20).

The human acute monocytic leukemia cell line THP-1, which was originally established from an infant diagnosed with AML (21), provides an experimental model for functional, preclinical therapeutics and target identification studies of AML. In this study, we identified cancer SP cells by isolating them in the THP-1 cell line. In SP and NSP cells, we evaluated the cell cycle, the capacity for self-renewal, the presence of leukocyte surface antigens, and the expression of the multidrug resistance gene and the apoptosis gene. The aim of this study was to enrich the LSC subpopulation in the THP-1 cell line with arabinosylcytosine (Ara-C) and to study the relationship between SP cells and LSCs.

Materials and methods

Cell line and culture

The human acute monocytic leukemia cell line THP-1 (Shanghai Institute of Cell Biology) was cultured in RPMI-1640 medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS) (Hyclone), 100 U/ml penicillin-streptomycin (Invitrogen Life Technologies, Grand Island, NY, USA) at 37°C under a 5% CO2 atmosphere.

SP cell analysis using fluorescence microscopy

The SP cells were suspended at 1×106 cells/ml in pre-warmed RPMI-1640 medium containing 2% FBS, 100 U/ml penicillin-streptomycin G, 100 μg/ml streptomycin and 10 mmol/l HEPES buffer. These cells were then incubated at 37°C for 90 min with 5 μg/ml Hoechst 33342 (Sigma-Aldrich, St. Louis, MO, USA), protected from light, either alone or in the presence of 50 μmol/l verapamil (Sigma-Aldrich). The cells were placed immediately on ice and were then washed and resuspended in cold phosphate-buffered saline (PBS) containing 1% FBS. Fluorescence microscopy (Leica, Germany) was employed to detect the morphology of SP cells among the THP-1 cells. The cells that were not stained or colored light blue were identified as SP cells.

SP cell analysis and sorting using flow cytometry

Following incubation with Hoechst 33342 at 4°C, 1 μg/ml propidium iodide (PI) (BD Pharmingen, San Diego, CA, USA) was added to label the dead cells, and the mixture was then filtered through a 40-μm cell strainer (BD Falcon) to obtain a single-cell suspension. Cell analyses and purification were performed using MoFlo carrying a triple-laser (DakoCytomation, Fort Collins, CO, USA). Hoechst 33342 was excited with the UV laser at 350 nm, and fluorescence emission was measured with 405/BP30 (Hoechst blue) and 570/BP20 (Hoechst red) optical filters. PI labeling was measured through the 630/BP30 filter for the discrimination of dead cells. SP and NSP cells in each well were isolated (22).

Cell surface immunophenotyping

Immunophenotyping was conducted using conjugated monoclonal human antibodies reactive to CD34 and CD38 (BD Pharmingen). The staining was performed in the dark at 4°C for 30 min. Isotype control antibodies and live unstained cells were used to establish gating parameters for positive cells. The percentage of the positive cells was obtained via the CellQuest software (BD Pharmingen).

Cell cycle analysis

SP and NSP cells were harvested and then washed twice with PBS. The supernatant was discarded and the pellets were dissolved with 1 ml of 70% cold ethanol. After incubating at 4°C for at least 12 h, cells were stained with 50 g/ml PI supplemented with 50 g/ml RNase and then incubated in the dark at 21°C for 30 min. The samples were profiled for DNA content by flow cytometry (BD Biosciences), and 10,000 events were recorded for each sample. The percentages of cells in the G0/G1, S and G2/M phases were obtained by CellQuest software.

Cell proliferation assay

The cells were grown in a 96-well plate, and the relative cell number was determined using a Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) according to the manufacturer’s protocol. The SP and NSP cells were plated at a density of 1×104 cells/well in 96-well plates for 0–9 days. After 10 μl CCK-8 solution was added to each well, cells were incubated for a further 4 h at 37°C, and the absorbance was measured at 450 nm using an automated ELISA reader (BioTek, Winooski, VT, USA).

Validation of gene expression by qPCR

Quantitative-PCR (qPCR) analysis was performed according to the manufacturer’s protocol. First, total RNA was extracted from cells with an RNAprep pure Cell kit (Tiangen Biotech Co., Ltd., Beijing, China). One microgram of total RNA was reverse transcribed into cDNA with l μl M-MuLV RT (200 μg/μl) using a Single-Strand cDNA Synthesis Kit (Stratagene, La Jolla, CA, USA) and analyzed using an ABI 7900 (Applied Biosystems, Foster City, CA, USA). Specific primers for qPCR of GAPDH (housekeeping gene) and the additional genes of interest were designed using Assay-by-Design primer design software (Applied Biosystems) or were purchased as Assays-on-Demand from Applied Biosystems. The primers for these genes are shown in Table I. The relative amounts of product were calculated using the comparative CT (2−ΔΔCt) method.

Table I

Primer sequences for different genes.

Table I

Primer sequences for different genes.

GenePrimer sequences (5′-3′)
GAPDHF: ACCACAGTCCATGCCATCAC
R: TCCACCACCCTGTTGCTGTA
ABCG2F: GTCTAAGCAGGGACGAACAATC
R: GCCAATAAGGTGAGGCTATCAA
ABCB1F: TGGTGTTTGGAGAAATGACAGAT
R: GAAACCTGAATGTAAGCAGCAAC
Bcl-2F: GTGGATGACTGAATACCTGAACC
R: AGACAGCCAGGAGAAATCAAAC
BaxF: GGTTGTCGCCCTTTTCTACTT
R: GTGAGGAGGCTTGAGGAGTCT

[i] F, forward; R, reverse.

In vivo tumor formation

All animal studies were performed in compliance with the Guidelines for the Care and Use of the Laboratory Animals in Henan Province, China. Naïve male 6–8-week-old NOD/SCID mice were obtained from Beijing HFK Bioscience Co. (Beijing, China), kept under specific pathogen-free (SPF) conditions and used as tumor transplant recipients. Mice were housed five per cage. Thirty mice were randomly divided into six groups, five mice per group. Growing cells, sorted from the SP cells (1×103, 1×104 and 1×105 per mouse) and NSP cells (1×104, 1×105 and 1×106 per mouse) diluted in PBS, were mixed with 50 ml Matrigel (BD Biosciences) and injected intravenously via the tail vein. Three to four weeks later, human AML engraftment (hCD45+/CD33+ cells) was assessed in the peripheral blood and bone marrow by tail bleed and aspiration of the femur, respectively.

Enrichment of LSCs in an SP of THP-1 with Ara-C

THP-1 cells (1×108 cells/ml) were incubated for 24 h at 37°C under a 5% CO2 atmosphere with four different concentrations of Ara-C: 10, 100, 1,000 and 2,000 μg/ml. The cells were then harvested and washed twice with PBS. The proportion of SP cells was detected, respectively, for each Ara-C concentration.

Statistical analysis

Statistical analyses were performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). Data are presented as the means ± SD. Differences were determined using the Student’s t-test or Fisher’s exact test and one-way analysis of variance (ANOVA) followed by Scheffe’s post hoc test, as indicated in the text. P<0.05 was considered to indicate a statistically significant difference. All experiments were performed in triplicate.

Results

Prevalence of SP cells in THP-1 cells

The SP cells overexpressed the multidrug-resistant proteins that allowed them to efflux various drugs and xenobiotics, as well as the Hoechst 33342 dye (23). As shown in Fig. 1, fluorescence microscopy with Hoechst 33342 staining demonstrated that the SP cells were present among the THP-1 cells. Whereas >90% of the THP-1 cells were stained intense blue, a small population of the cells remained unstained (Fig. 1A, arrow). The micrographs of THP-1 SP and NSP cells were observed under visible light. There was no significant difference between SP and NSP cells in morphology (Fig. 1B, arrow).

Figure 1

Hoechst 33342 staining of THP-1 cells (magnification, ×200). Micrographs of THP-1 cells under a fluorescence microscope. (B) Micrographs of THP-1 cells under a common microscope (magnification, ×200). The cells indicated by the arrow are SP cells.

Flow cytometry analysis with Hoechst 33342 staining demonstrated that the dimly stained Hoechst 33342 cells on the corner of the plot were gated as the SP population and represented a percentage of 1.81±0.99% of total THP-1 cells (Fig. 2A). Since the SP profile was blocked by staining in the presence of verapamil, a calcium channel blocker, the SP cell frequency was practically eliminated in the THP-1 cells stained with Hoechst 33342 and verapamil (Fig. 2B). To determine the sensitivity of our system, the SP and NSP cells in THP-1 cells were sorted and the purity was tested separately. The results showed that the cells of SP tube were still concentrated in the THP-1 SP region and the cells of NSP tube were still concentrated in the subregion of the main group of cells prior to sorting. Purity levels were 96.75±1.55% and 97.03±1.87%, respectively (Fig. 2C and D).

Figure 2

Cell sorting results and sorting purity. (A) The SP cells appear as the Hoechst-resistant fraction capable of pumping out the dye, and typically represent 1.81±0.99% of viable cells from the THP-1 leukemia cell line. The NSP cells that retained high levels of Hoechst staining are the main population of cells. (B) The SP is ablated when verapamil is included in the Hoechst incubation. (C) The sorted SP cells were concentrated in the SP region, the purity reached 96.75±1.55%. (D) The NSP tube cells were concentrated in the subregion of the main group of cells prior to the election, the purity reached 97.03±1.87%.

Expression of cell surface markers in SP and NSP cells

To further define the cells within the SP fraction, we used two cell-surface markers (CD34 and CD38) associated with LSCs (24). The analysis of SP and NSP cells revealed that these cells differ significantly in the expression of cell surface markers. The overall percentage of cells positive for CD34 was significantly lower in the NSP compared with the SP cells in all cell lines examined (Fig. 3).

Figure 3

Flow cytometry analysis of CD34/CD38 expression. (A) IgG isotype control in THP-1 cells. (B) CD34/CD38 expression in unsorted THP-1 cells. (C) CD34/CD38 expression in the SP fraction. (D) CD34/CD38 expression in the NSP fraction.

Although the expression of CD34+/CD38− in the SP fraction (Fig. 3C) was small, it was statistically significant and substantially higher than that in unsorted THP-1 cells (Fig. 3B) and NSP cells (Fig. 3D). The percentage of CD34+ and CD38− expression in SP cells was 8.68±0.20%, markedly higher than that in NSP cells (0.16±0.08%) (P<0.05) (Fig. 3).

Cell cycle in THP-1 SP and NSP cells

The G0/G1 phase cells in the THP-1 SP subpopulation accounted for ~84.04±4.98% of the total cells and more than NSP cells (44.02±1.35%).

THP-1 SP cells resulted in blockage of the cell cycle from the G0/G1 phase to the S phase. Compared with NSP cells, the ratio of G0/G1 phase cells significantly increased, and the ratio of S-phase cells significantly decreased in SP cells (P<0.05) (Fig. 4).

Figure 4

Cell cycle analysis by flow cytometry. (A) Cell cycle distribution in the SP cell groups. (B) Cell cycle distribution in the NSP cell groups. (C) Results of duplicate determinations from three separate experiments. *P<0.05 vs. SP cells.

In vivo growth characteristics of SP and NSP cells

The growth characteristics of the SP subpopulation were consistent with the predicted behavior of primitive precursor cells, including a high proliferative rate and self-renewal capacity. The proliferation of SP cells was significantly higher than that of NSP cells (P<0.05) (Fig. 5).

Figure 5

Growth curve of THP-1 SP and NSP cells. The THP-1 SP cells under stem cell-selective conditions grew faster compared with THP-1 NSP cells (P<0.05).

Analysis of gene expression in SP and NSP cells

We isolated RNA from sorted SP and NSP cells of the leukemia cell line THP-1 and used quantitative real-time RT-PCR amplification analysis to quantify the relative expression of the ABC transporter gene, the ABCB1 and ABCG2 gene product currently believed to be most closely associated with the SP phenotype (25). All SP fractions expressed higher levels of the ABCB1 and ABCG2 transporter gene than did the NSP fractions (Fig. 6A). We also measured the expression levels of two other cell apoptosis genes, Bcl-2 and Bax; the former gene was clearly expressed at higher concentrations in SP compared with the NSP, whereas the latter gene was not. However, the Bcl-2 and Bax values were significantly higher than in the NSP (P<0.05) (Fig. 6B).

Figure 6

Analysis of ABCB1, ABCG2, Bcl-2 and Bax gene expression.

THP-1 SP cells exhibit higher tumorigenicity than NSP cells

To determine whether the SP cells we identified in the THP-1 cell line might also be more tumorigenic, we performed xenograft experiments in vivo. Three or 4 weeks after THP-1 SP cells were transplanted intravenously via the tail vein, human AML engraftment (hCD45+/CD33+) was assessed in the peripheral blood and bone marrow by tail bleed and aspiration of the femur, respectively. The results indicated that the systemic disseminated leukemia model had been established successfully by injecting 1×103 THP-1 SP cells in NOD/SCID mice (Fig. 6A). The SP cells isolated from the THP-1 cells were more tumorigenic than the NSP cells. NSP cells require a quantity of at least 1×106 to establish a tumor model. Statistically, there were significant differences in the incidence of leukemia among different groups (P<0.05). The H&E strain of histologic sections revealed that almost all the leukemia xenotransplants successfully induced leukemia in the mice (Fig. 7B and C).

Figure 7

Identification of human THP-1 xenotransplant leukemia models. (A) Human AML engraftment (hCD45+CD33+ cells) was assessed in the peripheral blood and bone marrow using flow cytometry. (B) Wright’s staining of bone marrow of NOD/SCID mice injected with SP cells. (a) magnification, ×100, (b) magnification, ×1,000 and (c) peripheral blood (magnification, ×1,000). (C) Pathological examination of NOD/SCID mice injected with SP cells. Representative H&E staining sections of organs and tissues (H&E magnification, ×200). AML cells can be found in (a) lung, (b) liver, (c) spleen, (d) didymus, (e) paravertebral muscles, (f) lymph node, and (g) musculi faciales. (h) Cerebral edema was observed.

SP increases in the THP-1 cell line

It has been reported that CSCs can resist apoptosis when they are exposed to apoptosis inducement factors (26). Considering this characteristic of CSCs, we formulated a hypothesis that apoptosis resistance of CSCs can be used to increase the proportion of SP cells. In an apoptosis inducement model, the proportion of SP cells may increase in surviving cells. In this study, SP cells were co-cultured with different concentrations of Ara-C, the proportion of SP cells increased significantly, and the proportion of SP cells increased with the Ara-C concentration (Fig. 8).

Figure 8

The proportion of SP cells after treatment with different concentrations of Ara-C. Following co-culture with different concentrations of Ara-C, the proportion of SP cells increased significantly and the proportion of SP cells increased with Ara-C concentration.

Discussion

Using the side population (SP) technique, Zheng et al(27) reported the SP rate in acute promyelocytic leukemia NB4 cells to be less than 1%. In addition, SP cells possess intrinsic stem cell properties and express some of the characteristic stem cell genes. In the present study, analysis by fluorescence microscopy and flow cytometry demonstrated the presence of SP cells, and we were able to identify a small SP component (1.81±0.99%) of cancer cells from the THP-1 leukemia cell line. The SP cells were practically non-existent in the presence of Hoechst 33342 and verapamil, a calcium channel blocker. The percentages of SP cells detected were similar to those in most previous reports: 0.8–1.9% in human multiple myeloma cell line RPMI-8226 and NCI-H929 (28), 0.47–4% in an adult T-cell leukemia/lymphoma cell line (29), and 0.5–29.9% in human acute myeloid leukemia (AML) (8), but less than the 4–37% noted in neuroblastoma cell lines (15). Furthermore, the SP cells and the majority of non-SP (NSP) cells were indistinguishable morphologically. Therefore, the isolation and identification of cancer stem cells (CSCs) remains very difficult (8). To the best of our knowledge, this is the first described isolation of cancer stem-like cells from the THP-1 cell line.

To date, AML leukemia stem cells (LSCs) are the most well-studied CSCs population (30). AML is typically a disease of stem progenitor cell origin. No special markers have been successfully developed to identify those cells in different tumors; different tumors have different CSCs markers (one or more). Blair et al(31) demonstrated that only a small quantity of a defined subset of cells were consistently clonogenic and that all AML LSC subtypes possess the same cell-surface markers (32). As determined by immunophenotyping, SP cells share some phenotypic characteristics with bone marrow, such as the absence of mature hematopoietic lineage markers CD34 and expression of CD38. Bonnet et al have identified LSCs in human AML as a common immunophenotype (CD34+/CD38−) and have demonstrated their self-renewal potential (1). We therefore examined the expression of CD34/CD38 in SP cells, NSP cells, and unsorted THP-1 cells. Our results showed that CD34/CD38 were both expressed at low levels on the membranes of SP and NSP cells. The percentages of CD34+ and CD34+/CD38− cells in the SP were higher than those in the NSP and among common THP-1 cells (P<0.05). These results suggest that the presence of LSCs in THP-1 cells is rare and that the number of LSCs is quite limited; however, LSCs may be more prevalent in the SP.

LSCs, similar to their normal HSC counterparts, exhibit a range of characteristics that enable their long-term survival. Some of these characteristics also facilitate their escape from the cytotoxic effects of chemotherapy; for example, LSCs are primarily present in a quiescent phase of the cell cycle (33). In the present study, the cell cycles of two cell subsets, SP and NSP of the THP-1 cell line, were analyzed by flow cytometry. A majority of the SP cells remained in the G0/G1 phase, and the NSP cells remained in the S or G2 or M phases. The proliferation of SP cells was significantly higher than that of NSP cells (P<0.05).

A study by Hope et al(34) showed that AML originates from a hierarchy of LSC classes that differ in self-renewal capacity. Clarke et al(35) reported that SP cells produced two to seven times more colonies than NSP cells. In support of their putative stem cell nature, only the SP cells possessed the ability to produce colonies with both myoepithelial and luminal epithelial cell types. In the present study, the cell growth curves showed that the growth rate of SP cells was significantly faster than that of NSP cells; the cells continued to proliferate and the plateau period was not evident. This observation may indicate that SP cells contain more LSCs, and, therefore, cell proliferation is accelerated.

SPs are small subpopulations of cells with enriched stem cell activity that show a distinct ‘low’ Hoechst 33342 dye-staining pattern. The SP phenotype is mediated by the ATP-binding cassette (ABC) family of transporter proteins. Various types of ABC transporters have been shown to contribute to drug resistance in numerous types of cancer by pumping drugs out of cells (25,36). Notably, some ABC transporters are expressed by several types of stem cells. One of the major mediators seems to be ABCG2 or BCRP (37), which was initially identified in drug-selected MCF7 breast cancer cells and was later found to efflux multiple chemotherapeutic drugs and xenobiotics (38). Other supporting evidence shows that SP cells preferentially express ABCG2 (13,39). SP cells also express other ABC transporters such as MDR-1 (i.e., ABCB1 or P-glycoprotein), suggesting that these latter molecules may also be involved in mediating the SP phenotype (40). We therefore isolated RNA from sorted SP and NSP cells of the THP-1 leukemia cell lines, and we used a real-time RT-PCR assay to quantify the relative expression of the ABCG2 and ABCB1 transporters. The mRNA expression levels of the two genes of SP cells were higher than those among NSP cells. Independent of whether THP-1SP cells are indeed a tumor ‘stem cell’ population, their high expression of drug efflux transporter genes and their associated high capacity to efflux lipophilic drugs may have a significant effect on treatment outcome (5).

Stem cell resistance to apoptosis through complicated mechanisms (41,42), such as the regulation of Bcl-2 or Bax (43,44), has been proven experimentally. Compared with SP cells, NSP cells in tumors are more susceptible to apoptosis inducement or chemotherapy. We also measured the expression levels of two other apoptosis regulation genes, Bcl-2 and Bax; the former gene was clearly expressed at higher concentrations in SP cells compared with NSP cells, whereas the latter gene was not. There was no difference between SP and NSP cells in Bax expression, but the Bcl-2/Bax values of the SP cells were significantly higher than those of the NSP cells. These results suggest that apoptosis resistance may aid in screening the markers of CSCs.

It is believed that only the CSCs, but not the majority of their remaining descendants, are responsible for tumorigenesis, progression, metastasis, and relapse following treatment (45). Repopulation in recipients after transplantation is the most important characteristic of CSCs. Purified SP cells from certain cell lines were more tumorigenic than the corresponding NSP cells. To evaluate the tumorigenic ability of THP-1 SP cells in vivo, NOD/SCID mice were injected with different subpopulations and different quantities of THP-1 cells intravenously by tail vein, and the incidence of leukemia was compared among the groups. As we anticipated, the systemic disseminated leukemia model was established successfully by injecting 1×103 THP-1 SP cells. Unsorted THP-1 cells require a quantity of at least 1×106 to establish a tumor model.

Isolation and identification of the SP cells is helpful in studying the difference between the CSCs and non-tumorigenic cells in certain aspects. However, the proportion of LSCs is quite limited, and the isolation and identification of CSCs is very difficult. CSCs have been reported to resist apoptosis when they are exposed to apoptosis inducement factors (26). This characteristic of CSCs led us to formulate a hypothesis that apoptosis resistance by CSCs can be used to increase the proportion of SP cells. In an apoptosis inducement model, the proportion of SP cells may increase in surviving cells. Cytarabine (Ara-C) is commonly used for the treatment of acute leukemia. Incorporation of Ara-C into DNA is a key event in the killing of proliferating leukemic cells, but it is relatively ineffective against LSCs, which retain a quiescent status (46). In this study, we used Ara-C to kill common proliferating THP-1 cells. Following co-culture with Ara-C, the proportion of SP cells increased significantly and with Ara-C concentration.

In our study, all the representative LSC markers were significantly increased in SP cells compared with NSP cells; therefore, our results suggest that isolated SP cells could characterize the properties of LSCs. The proportion of SP cells may be increased after they are co-cultured with Ara-C, and this technique can be applied to the study of LSCs.

References

1 

Woods WG: Curing childhood acute myeloid leukemia (AML) at the half-way point: promises to keep and miles to go before we sleep. Pediatr Blood Cancer. 46:565–569. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Gorman MF, Ji L, Ko RH, et al: Outcome for children treated for relapsed or refractory acute myelogenous leukemia (rAML): a Therapeutic Advances in Childhood Leukemia (TACL) Consortium study. Pediatr Blood Cancer. 55:421–429. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Kaspers GJ and Zwaan CM: Pediatric acute myeloid leukemia: towards high-quality cure of all patients. Haematologica. 92:1519–1532. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Reya T, Morrison SJ, Clarke MF and Weissman IL: Stem cells, cancer, and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Benchaouir R, Rameau P, Decraene C, et al: Evidence for a resident subset of cells with SP phenotype in the C2C12 myogenic line: a tool to explore muscle stem cell biology. Exp Cell Res. 294:254–268. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Schatton T, Murphy GF, Frank NY, et al: Identification of cells initiating human melanomas. Nature. 451:345–349. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Lapidot T, Sirard C, Vormoor J, et al: A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 367:645–648. 1994. View Article : Google Scholar : PubMed/NCBI

8 

Bonnet D and Dick JE: Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 3:730–737. 1997. View Article : Google Scholar : PubMed/NCBI

9 

Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ and Clarke MF: Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA. 100:3983–3988. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Kondo T, Setoguchi T and Taga T: Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci USA. 101:781–786. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Hirschmann-Jax C, Foster AE, Wulf GG, et al: A distinct ‘side population’ of cells with high drug efflux capacity in human tumor cells. Proc Natl Acad Sci USA. 101:14228–14233. 2004.

12 

Goodell MA, Brose K, Paradis G, Conner AS and Mulligan RC: Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med. 183:1797–1806. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Shimano K, Satake M, Okaya A, et al: Hepatic oval cells have the side population phenotype defined by expression of ATP-binding cassette transporter ABCG2/BCRP1. Am J Pathol. 163:3–9. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Falciatori I, Borsellino G, Haliassos N, et al: Identification and enrichment of spermatogonial stem cells displaying side-population phenotype in immature mouse testis. FASEB J. 18:376–378. 2004.PubMed/NCBI

15 

Hu C, Li H, Li J, et al: Analysis of ABCG2 expression and side population identifies intrinsic drug efflux in the HCC cell line MHCC-97L and its modulation by Akt signaling. Carcinogenesis. 29:2289–2297. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Wang J, Guo LP, Chen LZ, Zeng YX and Lu SH: Identification of cancer stem cell-like side population cells in human nasopharyngeal carcinoma cell line. Cancer Res. 67:3716–3724. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Haraguchi N, Utsunomiya T, Inoue H, et al: Characterization of a side population of cancer cells from human gastrointestinal system. Stem Cells. 24:506–513. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Setoguchi T, Taga T and Kondo T: Cancer stem cells persist in many cancer cell lines. Cell Cycle. 3:414–415. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Feuring-Buske M and Hogge DE: Hoechst 33342 efflux identifies a subpopulation of cytogenetically normal CD34(+)CD38(−) progenitor cells from patients with acute myeloid leukemia. Blood. 97:3882–3889. 2001.PubMed/NCBI

20 

Guo Y, Follo M, Geiger K, Lubbert M and Engelhardt M: Side-population cells from different precursor compartments. J Hematother Stem Cell Res. 12:71–82. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T and Tada K: Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer. 26:171–176. 1980. View Article : Google Scholar : PubMed/NCBI

22 

Gao Q, Geng L, Kvalheim G, Gaudernack G and Suo Z: Identification of cancer stem-like side population cells in ovarian cancer cell line OVCAR-3. Ultrastruct Pathol. 33:175–181. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Ishikawa T and Nakagawa H: Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics. J Exp Ther Oncol. 8:5–24. 2009.PubMed/NCBI

24 

Rombouts WJ, Martens AC and Ploemacher RE: Identification of variables determining the engraftment potential of human acute myeloid leukemia in the immunodeficient NOD/SCID human chimera model. Leukemia. 14:889–897. 2000. View Article : Google Scholar : PubMed/NCBI

25 

Jonker JW, Freeman J, Bolscher E, et al: Contribution of the ABC transporters Bcrp1 and Mdr1a/1b to the side population phenotype in mammary gland and bone marrow of mice. Stem Cells. 23:1059–1065. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Raguz S and Yague E: Resistance to chemotherapy: new treatments and novel insights into an old problem. Br J Cancer. 99:387–391. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Zheng X, Seshire A, Ruster B, et al: Arsenic but not all-trans retinoic acid overcomes the aberrant stem cell capacity of PML/RARalpha-positive leukemic stem cells. Haematologica. 92:323–331. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Matsui W, Wang Q, Barber JP, et al: Clonogenic multiple myeloma progenitors, stem cell properties, and drug resistance. Cancer Res. 68:190–197. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Kayo H, Yamazaki H, Nishida H, Dang NH and Morimoto C: Stem cell properties and the side population cells as a target for interferon-α in adult T-cell leukemia/lymphoma. Biochem Biophys Res Commun. 364:808–814. 2007.PubMed/NCBI

30 

Wang JC and Dick JE: Cancer stem cells: lessons from leukemia. Trends Cell Biol. 15:494–501. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Blair A, Hogge DE, Ailles LE, Lansdorp PM and Sutherland HJ: Lack of expression of Thy-1 (CD90) on acute myeloid leukemia cells with long-term proliferative ability in vitro and in vivo. Blood. 89:3104–3112. 1997.PubMed/NCBI

32 

Blair A and Sutherland HJ: Primitive acute myeloid leukemia cells with long-term proliferative ability in vitro and in vivo lack surface expression of c-kit (CD117). Exp Hematol. 28:660–671. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Naka K, Hoshii T and Hirao A: Novel therapeutic approach to eradicate tyrosine kinase inhibitor resistant chronic myeloid leukemia stem cells. Cancer Sci. 101:1577–1581. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Hope KJ, Jin L and Dick JE: Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol. 5:738–743. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Clarke RB: Isolation and characterization of human mammary stem cells. Cell Prolif. 38:375–386. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Chang XB: Molecular mechanism of ATP-dependent solute transport by multidrug resistance-associated protein 1. Methods Mol Biol. 596:223–249. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Zhou S, Schuetz JD, Bunting KD, et al: The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 7:1028–1034. 2001. View Article : Google Scholar : PubMed/NCBI

38 

Doyle LA and Ross DD: Multidrug resistance mediated by the breast cancer resistance protein BCRP (ABCG2). Oncogene. 22:7340–7358. 2003. View Article : Google Scholar : PubMed/NCBI

39 

Summer R, Kotton DN, Sun X, Ma B, Fitzsimmons K and Fine A: Side population cells and Bcrp1 expression in lung. Am J Physiol Lung Cell Mol Physiol. 285:L97–L104. 2003. View Article : Google Scholar : PubMed/NCBI

40 

Bunting KD, Zhou S, Lu T and Sorrentino BP: Enforced P-glycoprotein pump function in murine bone marrow cells results in expansion of side population stem cells in vitro and repopulating cells in vivo. Blood. 96:902–909. 2000.PubMed/NCBI

41 

Taipale J and Beachy PA: The Hedgehog and Wnt signalling pathways in cancer. Nature. 411:349–354. 2001. View Article : Google Scholar : PubMed/NCBI

42 

van Stijn A, van der Pol MA, Kok A, et al: Differences between the CD34+ and CD34− blast compartments in apoptosis resistance in acute myeloid leukemia. Haematologica. 88:497–508. 2003.

43 

Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ and Green DR: The BCL-2 family reunion. Mol Cell. 37:299–310. 2010. View Article : Google Scholar : PubMed/NCBI

44 

Zhang QL, Niu Q, Niu PY, et al: Bax gene silencing: a potential intervention in aluminum-induced neural cell death. J Biol Regul Homeost Agents. 24:7–17. 2010.PubMed/NCBI

45 

Komuro H, Saihara R, Shinya M, et al: Identification of side population cells (stem-like cell population) in pediatric solid tumor cell lines. J Pediatr Surg. 42:2040–2045. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Misaghian N, Ligresti G, Steelman LS, et al: Targeting the leukemic stem cell: the Holy Grail of leukemia therapy. Leukemia. 23:25–42. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Yin C, Feng L, Ma L, Wei Y and Sheng G: Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells. Oncol Rep 29: 1923-1931, 2013.
APA
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., & Sheng, G. (2013). Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells. Oncology Reports, 29, 1923-1931. https://doi.org/10.3892/or.2013.2316
MLA
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., Sheng, G."Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells". Oncology Reports 29.5 (2013): 1923-1931.
Chicago
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., Sheng, G."Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells". Oncology Reports 29, no. 5 (2013): 1923-1931. https://doi.org/10.3892/or.2013.2316
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Yin C, Feng L, Ma L, Wei Y and Sheng G: Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells. Oncol Rep 29: 1923-1931, 2013.
APA
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., & Sheng, G. (2013). Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells. Oncology Reports, 29, 1923-1931. https://doi.org/10.3892/or.2013.2316
MLA
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., Sheng, G."Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells". Oncology Reports 29.5 (2013): 1923-1931.
Chicago
Wang, Y., Yin, C., Feng, L., Ma, L., Wei, Y., Sheng, G."Sorting, identification and enrichment of side population cells in THP-1 acute monocytic leukemia cells". Oncology Reports 29, no. 5 (2013): 1923-1931. https://doi.org/10.3892/or.2013.2316
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team