Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November 2013 Volume 30 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2013 Volume 30 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection

  • Authors:
    • Masahito Nakano
    • Takumi Kawaguchi
    • Shingo Nakamoto
    • Atsushi Kawaguchi
    • Tatsuo Kanda
    • Fumio Imazeki
    • Ryoko Kuromatsu
    • Shuji Sumie
    • Manabu Satani
    • Shingo Yamada
    • Takuji Torimura
    • Tatsuyuki Kakuma
    • Osamu Yokosuka
    • Michio Sata
  • View Affiliations / Copyright

    Affiliations: Division of Gastroenterology, Department of Medicine, Kurume University School of Medicine, Kurume, Japan, Department of Gastroenterology and Nephrology, Graduate School of Medicine, Chiba University, Chiba, Japan, Biostatistics Center, Kurume University, Kurume, Japan, Department of Biostatistics, Kurume University Graduate School of Medicine, Kurume, Japan
  • Pages: 2049-2055
    |
    Published online on: August 27, 2013
       https://doi.org/10.3892/or.2013.2700
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Although overt hepatitis B virus (HBV) infection promotes the onset of hepatocellular carcinoma (HCC) in hepatitis C virus (HCV)-infected patients, the effect of occult HBV infection remains unclear. The aim of this study was to investigate the effect of occult HBV infection on the early-onset of HCC in HCV-infected patients. A total of 173 HCC patients with HCV infection were enrolled and classified into 2 groups according to the median age of HCC onset: the early-onset group (n=91; 61.1±5.6 years) and the late-onset group (n=82; 73.8±3.7 years). Independent factors associated with the early-onset of HCC were assessed by multivariate analysis. In the overall analysis, independent risk factors for the early-onset of HCC were the white blood cell count and alanine aminotransferase level, but not the presence of HBV DNA. In a stratification analysis according to albumin levels of ≥3.5 g/dl, the presence of HBV DNA was a significant independent risk factor for the early-onset of HCC (OR 145.18, 95% CI 1.38-15296.61, P=0.036), whereas the presence of antibodies against hepatitis B core antigen was not found to be a risk factor. The presence of HBV DNA was not a risk factor for the early-onset of HCC in the overall analysis. However, its presence was an independent factor for the early-onset of HCC in HCV-infected patients with an albumin level of ≥3.5 g/dl. Thus, occult HBV infection may accelerate hepatocarcino­genesis in HCV-infected patients with relatively low carcinogenic potential.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide. It ranks third in men and fifth in women as the cause of death from malignancies in Japan (1). Chronic hepatitis C virus (HCV) infection is the major cause of HCC and accounts for ~60–70% of HCC cases in Japan (2). In addition to hepatic inflammation and subsequent fibrosis, various other factors including aging, obesity and diabetes mellitus are involved in the hepatocarcinogenesis in HCV-infected patients (3–5).

Co-infection of HCV with hepatitis B virus (HBV) is thought to synergistically increase the development of HCC (6). The status of HBV infection is evaluated by the presence of hepatitis B surface antigen (HBsAg), antibodies against hepatitis B core antigen (HBcAb), and HBV DNA. In some cases, HBV DNA can be detected in the serum or liver tissue of patients who are negative for HBsAg, a condition referred to as ‘occult HBV infection’ (7,8). In Japan, the prevalence of occult HBV infection in HCV-infected patients is reported to be between 37.7% and 90% (9–11). Occult HBV infection is associated with a poor response to interferon therapy for chronic hepatitis C (12,13) and is also known to accelerate the progression of liver fibrosis, resulting in cirrhosis in patients with HCV infection (9,14,15). Several previous studies have examined the impact of occult HBV infection on the development of HCC in HCV-infected patients, but no clear conclusions have emerged (14,16,17). Moreover, the effects of occult HBV infection on the early-onset of HCC have not been investigated in HCV-infected patients.

Albumin is produced by hepatocytes, and the level of serum albumin is used to evaluate hepatic function (18). Albumin plays a significant role in maintaining colloid osmotic pressure and transports drugs and endogenous substances including bilirubin and unesterified free fatty acids (19). In addition, albumin exerts antioxidative properties (19), and hypoalbuminemia has been shown to be an independent risk factor for mortality among residents of a hyperendemic area of HCV infection in Japan (20). A serum albumin level of ≥3.5 g/dl is an independent predictor of survival in HCC patients (21,22) and in cirrhotic patients with a serum albumin levels of <3.5 g/dl, branched-chain amino acids increase serum albumin levels and subsequently suppress hepatocarcinogenesis (23,24). Thus, the serum albumin level is an important factor in hepatocarcinogenesis.

The aim of this study is to investigate the impact of occult HBV infection on the early-onset of HCC in HCV-infected patients. We also performed a stratification analysis according to the serum albumin level.

Subjects and methods

Subjects

We conducted a retrospective study to investigate the effect of the presence of HBV DNA on the early-onset of HCC in HCV-infected patients. Between 1995 and 2011, 325 patients underwent hepatic resection at the Kurume University Hospital. The inclusion criteria were histologically proven HCC, a positive result for serum anti-HCV, and a negative result for serum HBsAg. Exclusion criteria were the presence of autoimmune hepatitis, primary biliary cirrhosis, and hemochromatosis, no test results for serum HBV DNA, and a histological diagnosis of combined hepatocellular and cholangiocellular carcinoma. Although 214 patients met the inclusion criteria, 41 patients had to be excluded because of one or more of these reasons. The remaining 173 HCC patients with HCV infection were therefore enrolled in this study and classified into 2 groups according to the median age of HCC onset: the early-onset group (n=91; 61.1±5.6 years) and the late-onset group (n=82; 73.8±3.7 years).

The study protocol was approved by the institutional review board, and informed consent for participation in the study was obtained from each subject. None of the subjects were institutionalized.

Data collection

Demographic data were collected at the time of hepatic resection including age, gender, and alcohol intake. Body mass index (BMI) was calculated as body weight in kilograms divided by the square of height in meters (kg/m2).

Venous blood samples were taken in the morning after a 12-h overnight fast. The presence of serum anti-HCV, HBsAg, and HBcAb was tested using standard clinical methods (Department of Clinical Laboratory, Kurume University Hospital). Blood platelet count, white blood cell (WBC) count, prothrombin time %, plasma glucose levels; hemoglobin A1c (HbA1c) levels, and serum levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), albumin, total bilirubin, insulin, α-fetoprotein (AFP), and des-γ-carboxy prothrombin (DCP) were also measured using standard clinical methods. Insulin resistance was evaluated on the basis of fasting levels of plasma glucose and insulin, according to the homeostasis model assessment for insulin resistance (HOMA-IR), as previously described (25).

The stage of hepatic fibrosis was assessed using the AST-to-platelet ratio index (APRI), which is calculated as the serum AST level (U/l)/upper limit of normal AST (U/l) ×100/platelet count (x104/ml). Patients with APRI values of ≤1.5 were diagnosed as having chronic hepatitis, and patients with APRI values >1.5 were diagnosed as having liver cirrhosis, as previously described (26). The degree of liver cirrhosis was categorized according to the Child-Pugh classification (27). Diabetes mellitus was diagnosed on the basis of fasting blood glucose levels >126 mg/dl or HbA1c levels >6.5%, in accordance with the Diagnostic Criteria for Diabetes Mellitus of the Japan Diabetes Society (28), or the use of antidiabetic agents.

Nucleic acid extraction from serum

Total nucleic acid was extracted from 300 μl of plasma using a commercially available kit (High Pure Viral Nucleic Acid kit; Roche Diagnostics, Tokyo, Japan) according to the manufacturer’s instructions. The extracted nucleic acid was eluted in 25 μl of elution buffer.

PCR for HBV DNA

Serum HBV DNA was analyzed for the presence of HBs, HBc, and HBx (S, C and X) regions using TaqMan real-time PCR according to the manufacturer’s instructions (TaqMan Fast Universal PCR Master mix; Applied Biosystems, Tokyo, Japan). The oligonucleotide primers and probes that were optimized for the HBV subtype adr4 (29) were specific for the S, X and C region sequences are listed in Table I. The full-length HBV DNA (GenBank accession no. X01587) (29) was used as an internal standard in the quantitative real-time detection PCR. We used 8 μl of nucleic acid-containing serum in our study for better sensitivity. The limit of sensitivity of our TaqMan Real-time PCR methods was 4.5 copies/well, and the detection limit of our tests was 45 copies/ml (1.7 log copies/ml). A real-time PCR assay (COBAS TaqMan HBV Auto; Roche Diagnostics) was also performed to detect the core region of HBV DNA (limit of quantification, 1.8 log copies/ml). The presence of HBV DNA was defined as any positivity of S, X or C region.

Table I

Nucleotide positions and sequences of TaqMan PCR primers and probes.

Table I

Nucleotide positions and sequences of TaqMan PCR primers and probes.

Primer/ProbeSequencePosition
S-sense TGTACAAAACCTTCGGACGGAAA442–464
S-antisense TGCGAAAGCCCAGGATGATG485–504
S-probe CTGCACTTGTATTCCC465–480
C-sense ACTGTGGTTTCACATTTCCTGTCTT2072–2096
C-antisense GGCATTTGGTGGTCTGTAAGC2163–2183
C-probe CCACACTCCAAAAGAC2132–2147
X-sense CTACTGTTCAAGCCTCCAAGCT1729–1750
X-antisense GCTCCAAATTCTTTATACGGGTCAATG1778–1804
X-probe AAGCCACCCAAGGCAC1751–1766

[i] Nucleotide positions are based on the sequence of hepatitis B virus subtype adr4 (GenBank accession no. X01587) (29).

Statistical analysis

Data are expressed as the absolute value or the mean ± SD. Differences between the early-onset and late-onset groups were analyzed using the Mann-Whitney U test. A logistic regression model with the Firth’s correction 30 was used for multivariate stepwise analysis to identify independent variables associated with the early-onset of HCC, as previously described (31,32). All P-values were 2-tailed, and a level of <0.05 was considered statistically significant. All statistical analyses were conducted using SAS version 9.2 (SAS Institute, Cary, NC, USA) or R packages version 2.15.2 (URL http://www.R-project.org/).

Results

Univariate analysis between the early-onset and late-onset groups

AFP levels, DCP levels, and maximal HCC size did not differ between the early-onset and late-onset groups (Table II). Furthermore, although BMI, WBC count, and serum insulin levels were significantly higher in the early-onset group than in the late-onset group, there were no significant differences in the daily alcohol intake, platelet count, prothrombin time, Child-Pugh classification, presence of diabetes mellitus as a comorbidity, fasting blood glucose level, HOMA-IR value, HbA1c levels, and the serum levels of AST, ALT, albumin, and total bilirubin (Table II). The presence of HBcAb and HBV DNA did not differ either between the early-onset and late-onset groups (Table II).

Table II

Differences in the clinical characteristics between the early-onset and late-onset groups.

Table II

Differences in the clinical characteristics between the early-onset and late-onset groups.

VariableReference valueEarly-onsetLate-onsetP
Number of patients9182
Age (years)61.1±5.673.8±3.7<0.001
AFP (ng/ml)<8.71876±12163769±32460.588
DCP (mAU/ml)<401083±41201071±38450.378
Maximal HCC size (mm)N/A30.4±19.633.2±16.20.055
Gender (female/male)N/A23/6820/620.893
BMI (kg/m2)18.5–22.023.6±3.622.4±3.20.045
Daily alcohol intake (none/0–60 g/>60 g)N/A21/42/1423/36/100.676
Platelet count (x104/mm3)13–3613.8±5.413.5±4.60.988
WBC count (/mm3)4000–90005009±15264420±12100.012
AST (U/l)13–3356.2±29.552.8±27.20.412
ALT (U/l)6–3062.2±40.951.7±31.70.104
Albumin (g/dl)4.0–5.03.87±0.453.85±0.380.520
Prothrombin time (%)70–13090.0±11.291.7±12.20.272
Total bilirubin (mg/dl)0.3–1.20.84±0.350.79±0.290.346
Chronic hepatitis/Child-Pugh class A/Child-Pugh class BN/A40/49/236/44/20.994
Complication of diabetes mellitus (yes/no)N/A30/6120/620.214
Fasting blood glucose (mg/dl)80–109119±39107±310.060
Insulin (μU/ml)5–2013.1±10.49.8±8.00.014
HOMA-IR<2.53.05±2.472.11±1.030.622
HbA1c (%)4.6–6.25.77±0.885.50±0.780.053
HBcAb positive/negativeN/A49/4250/320.344
HBV DNA positive/negativeN/A6/853/790.385

[i] Values are expressed as the mean ± SE. AFP, α-fetoprotein; DCP, des-γ-carboxy prothrombin; HCC, hepatocellular carcinoma; BMI, body mass index; WBC, white blood cell; AST, aspartate aminotransferase; ALT, alanine aminotransferase; HOMA-IR, homeostasis model assessment for insulin resistance; HbA1c, hemoglobin A1c; HBcAb, antibody for hepatitis B core antigen; HBV, hepatitis B virus; N/A, not applicable.

Multivariate stepwise analysis for early-onset of HCC

Multivariate stepwise analysis showed that the serum ALT level and WBC count were independent risk factors for the early-onset of HCC (OR 1.10; 95% CI 1.00–1.21; P=0.045 and OR 1.35; 95% CI 1.06–1.73; P=0.014, respectively; Table III), but not the presence of HBcAb or HBV DNA.

Table III

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma.

Table III

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma.

UnitOdds ratio95% CIP
HbA1c11.370.91–2.070.136
BMI11.080.98–1.190.133
ALT101.101.00–1.210.045
DCP200.990.98–1.000.091
WBC count10001.351.06–1.730.014

[i] All P-values were 2-tailed, and a level of <0.05 was considered statistically significant. HbA1c, hemoglobin A1c; BMI, body mass index; ALT, alanine aminotransferase; DCP, des-γ-carboxy prothrombin; WBC, white blood cell.

Stratification analysis according to serum albumin level

Differences in the clinical characteristics between patients with the albumin level of ≥3.5 g/dl and <3.5 g/dl were summarized in Table IV. There were no significant differences in AFP levels, DCP levels, and maximal HCC size between the albumin level of ≥3.5 g/dl and <3.5 g/dl groups (Table IV). In the albumin level of ≥3.5 g/dl group, a significant elevation was seen in platelet count, prothrombin time and the number of patients with chronic hepatitis and a significant depletion was seen in AST level than in the albumin level of <3.5 g/dl group. However, other biochemical parameters and the presence of HBcAb and HBV DNA did not differ between the albumin level of ≥3.5 g/dl and <3.5 g/dl groups (Table IV).

Table IV

Differences in the clinical characteristics between patients with the albumin level of ≥3.5 g/dl and <3.5 g/dl.

Table IV

Differences in the clinical characteristics between patients with the albumin level of ≥3.5 g/dl and <3.5 g/dl.

Albumin level of

VariableReference value≥3.5 g/dl<3.5 g/dlP
Number of patients13835
Age (years)67.8±8.167.9±6.70.895
AFP (ng/ml)<8.7786±32193262±181950.248
DCP (mAU/ml)<40854±32691961±59770.306
Maximal HCC size (mm)N/A30.6±15.936.8±23.80.171
Gender (female/male)N/A35/1038/270.759
BMI (kg/m2)18.5–22.023.0±3.523.0±3.40.918
Daily alcohol intake (none/0–60 g/>60 g)N/A21/58/383/20/60.172
Platelet count (x104/mm3)13–3614.3±4.911.3±4.80.001
WBC count (/mm3)4000–90004798±13954291±13310.052
AST (U/l)13–3351.2±26.267.1±32.60.001
ALT (U/l)6–3054.9±37.463.4±32.70.057
Albumin (g/dl)4.0–5.04.02±0.283.23±0.20<0.001
Prothrombin time (%)70–13091.6±12.088.0±10.00.038
Total bilirubin (mg/dl)0.3–1.20.82±0.340.80±0.280.822
Chronic hepatitis/Child-Pugh class A/Child-Pugh class BN/A69/69/07/24/4<0.001
Complication of diabetes mellitus (yes/no)N/A38/10012/230.431
Fasting blood glucose (mg/dl)80–109112±37121±490.694
Insulin (μU/ml)5–2010.1±6.417.6±16.30.063
HOMA-IR<2.53.12±3.874.23±2.230.315
HbA1c (%)4.6–6.25.61±0.795.68±1.040.905
HBcAb positive/negativeN/A75/6324/110.129
HBV DNA positive/negativeN/A6/1323/320.315

[i] Values are expressed as the mean ± SE. AFP, α-fetoprotein; DCP, des-γ-carboxy prothrombin; HCC, hepatocellular carcinoma; BMI, body mass index; WBC, white blood cell; AST, aspartate aminotransferase; ALT, alanine aminotransferase; HOMA-IR, homeostasis model assessment for insulin resistance; HbA1c, hemoglobin A1c; HBcAb, antibody for hepatitis B core antigen; HBV, hepatitis B virus; N/A, not applicable.

In patients with a serum albumin level of ≥3.5 g/dl, the WBC count and serum levels of albumin and DCP were identified as independent factors associated with the early-onset of HCC (OR 1.64; 95% CI 1.15–2.35; P=0.006, OR 1.17; 95% CI 1.01–1.36; P=0.036, and OR 0.99; 95% CI 0.98–1.00; P=0.037, respectively; Table V). Although the presence of HBcAb was not found to be a significant risk factor for the early-onset of HCC, the presence of HBV DNA was identified as a significant independent risk factor associated with the early-onset of HCC (OR 145.18; 95% CI 1.38–15296.61; P=0.036; Table VI).

Table V

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma in patients with a serum albumin level of ≥3.5 g/dl.

Table V

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma in patients with a serum albumin level of ≥3.5 g/dl.

UnitOdds ratio95% CIP
HBcAbPositive0.590.27–1.260.169
HBV DNAPositive145.181.38–15296.610.036
Prothrombin time100.760.54–1.080.109
ALT101.080.97–1.210.145
Albumin0.11.171.01–1.360.036
DCP200.990.98–1.000.037
Platelet count10.920.84–1.020.107
WBC count10001.641.15–2.350.006

[i] All P-values were 2-tailed, and a level of <0.05 was considered statistically significant. HBcAb, antibody for hepatitis B core antigen; HBV, hepatitis B virus; ALT, alanine aminotransferase; DCP, des-γ-carboxy prothrombin; WBC, white blood cell.

Table VI

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma in patients with a serum albumin level of <3.5 g/dl.

Table VI

Multivariate stepwise analysis for factors associated with the early-onset of hepatocellular carcinoma in patients with a serum albumin level of <3.5 g/dl.

UnitOdds ratio95% CIP
HbA1c11.830.75–4.470.183
HBV DNAPositive0.000.00–2.960.093
AFP201.391.01–1.930.045

[i] All P-values were 2-tailed, and a level of <0.05 was considered statistically significant. HbA1c, hemoglobin A1c; HBV, hepatitis B virus; AFP, α-fetoprotein.

In patients with a serum albumin level of <3.5 g/dl, the serum AFP level was the only significant risk factor found to be associated with the early-onset of HCC (Table V). The presence of HBcAb and HBV DNA was not found to be a significant risk factor for the early-onset of HCC.

Discussion

In the overall analysis, the presence of HBV DNA in serum was not identified as a risk factor for the early-onset of HCC in HCV-infected patients. However, a stratification analysis according to a serum albumin level of ≥3.5 g/dl revealed that the presence of HBV DNA was an independent factor for the early-onset of HCC. These findings suggest that occult HBV infection may accelerate hepatocarcinogenesis in HCV-infected patients with a relatively low carcinogenic potential.

Although co-infection of HCV and HBV is thought to synergistically increase the risk of HCC (6), the overall analysis in this study showed that occult HBV infection was not significantly associated with the early-onset of HCC in HCV-infected patients. Similarly, several studies conducted in Asia have also failed to show any significant effect of occult HBV infection in these patients (33–35). Recently, Lok et al(36) performed a nested case-control study using a large number of patients enrolled in the HALT-C cohort and reported no significant difference in the prevalence of occult HBV infection between HCC and non-HCC patients with HCV infection. Taken together, these results suggest that occult HBV infection may not be an intensive promoter of HCC development in the presence of a potent carcinogenic factor such as HCV infection.

In contrast with these previous studies and with our own findings for all patients, a stratification analysis according to a serum albumin level of ≥3.5 g/dl showed that occult HBV infection was an independent risk factor for the early-onset of HCC. In patients with occult HBV infection, it is unclear whether a presence of HBV DNA is due to full-length HBV DNA replicated from covalently closed circular DNA in hepatocytes or fragmented HBV DNA integrated into the hepatocyte genome. However, the HBx gene is frequently integrated into cellular genes in HCC (37). The HBx protein upregulates the expression of proto-oncogenes including c-jun, c-fos and c-myc, all of which can promote hepatocarcinogenesis (38,39). In addition, albumin plays a crucial role in the development of various diseases, as it is a major antioxidant (19). In cirrhotic patients with a serum albumin level of <3.5 g/dl, branched-chain amino acids increase serum albumin levels, and this subsequently suppresses hepatocarcinogenesis (23,24). In this study, we found a significant association between occult HBV infection and the early-onset of HCC in patients with a serum albumin level of ≥3.5 g/dl, but not in patients with a serum albumin level of <3.5 g/dl. Taken together, these findings suggest that HBV DNA may promote hepatocarcinogenesis in HCV-infected patients with relatively low carcinogenic potential.

Although we designed this study to investigate the effect of HBV DNA on the early-onset of HCC in HCV-infected patients, we found instead that an elevated WBC count is an independent risk factor for the early-onset of HCC in HCV-infected patients. An elevated WBC count may reflect the consequences or underlying pathogenesis of the early-onset of HCC. One possible explanation is aging, because the WBC count declines in old age (40). Alternatively, an elevated WBC count still within the reference range is known to be associated with the development of various malignancies including gastric, colorectal, endometrial and lung cancers (41,42). The WBC count is a well-validated biomarker of inflammation. Chronic inflammation is a possible risk factor for hepatocarcinogenesis as it leads to the activation of receptors for chemokine and advanced glycation-end products (43,44). Another inflammation marker, C-reactive protein, is reported to be a diagnostic and prognostic marker of HCC (45,46). Taken together, these findings suggest that inflammation may promote the early-onset of HCC in HCV-infected patients.

A limitation of this study is that there were only a small number of HBV DNA-positive patients. Previous studies regarding occult HBV infection had a similar limitation (33,47,48). Since occult HBV infection is not frequently seen in HCV-infected patients with HCC, a multicenter study is needed to confirm our findings.

In conclusion, the presence of HBV DNA in serum was not a risk factor for the early-onset of HCC in HCV-infected patients. However, a stratification analysis based on a serum albumin level of ≥3.5 g/dl revealed that presence of HBV DNA in serum was an independent risk factor for the early-onset of HCC. These findings suggest that occult HBV infection may accelerate hepatocarcinogenesis in HCV-infected patients with relatively low carcinogenic potential.

Acknowledgements

This study was supported, in part, by Health and Labour Sciences Research Grants for Research on Hepatitis from the Ministry of Health, Labour and Welfare of Japan.

Abbreviations:

HCC

hepatocellular carcinoma

HCV

hepatitis C virus

HBV

hepatitis B virus

HBsAg

hepatitis B surface antigen

BMI

body mass index

WBC

white blood cell

HbA1c

hemoglobin A1c

AST

aspartate aminotransferase

ALT

alanine aminotransferase

AFP

α-fetoprotein

DCP

des-γ-carboxy prothrombin

HOMA

homeostasis model assessment

APRI

AST to platelet ratio index

AUROC

area under the receiver operating characteristic curve analysis

MAPK

mitogen activated protein kinase

References

1 

Kiyosawa K, Umemura T, Ichijo T, et al: Hepatocellular carcinoma: recent trends in Japan. Gastroenterology. 127:S17–S26. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Taura N, Fukushima N, Yastuhashi H, et al: The incidence of hepatocellular carcinoma associated with hepatitis C infection decreased in Kyushu area. Med Sci Monit. 17:PH7–PH11. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Koike K: Hepatitis C as a metabolic disease: implication for the pathogenesis of NASH. Hepatol Res. 33:145–150. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Kawaguchi T and Sata M: Importance of hepatitis C virus-associated insulin resistance: therapeutic strategies for insulin sensitization. World J Gastroenterol. 16:1943–52. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Sumie S, Kawaguchi T, Kuromatsu R, et al: Total and high molecular weight adiponectin and hepatocellular carcinoma with HCV infection. PLoS One. 6:e268402011. View Article : Google Scholar : PubMed/NCBI

6 

Wu Q and Liu Q: Do hepatitis B virus and hepatitis C virus co-infections increase hepatocellular carcinoma occurrence through synergistically modulating lipogenic gene expression? Hepatol Res. 42:733–740. 2012. View Article : Google Scholar

7 

Torbenson M and Thomas DL: Occult hepatitis B. Lancet Infect Dis. 2:479–486. 2002. View Article : Google Scholar

8 

Blackard JT, Martin CM, Sengupta S and Forrester J: Limited infection with occult hepatitis B virus in drug users in the USA. Hepatol Res. 43:413–417. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Koike K, Kobayashi M, Gondo M, Hayashi I, Osuga T and Takada S: Hepatitis B virus DNA is frequently found in liver biopsy samples from hepatitis C virus-infected chronic hepatitis patients. J Med Virol. 54:249–255. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Fukuda R, Ishimura N, Niigaki M, et al: Serologically silent hepatitis B virus coinfection in patients with hepatitis C virus-associated chronic liver disease: clinical and virological significance. J Med Virol. 58:201–207. 1999. View Article : Google Scholar

11 

Nirei K, Kaneko M, Moriyama M and Arakawa Y: The clinical features of chronic hepatitis C are not affected by the coexistence of hepatitis B virus DNA in patients negative for hepatitis B surface antigen. Intervirology. 43:95–101. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Mrani S, Chemin I, Menouar K, et al: Occult HBV infection may represent a major risk factor of non-response to antiviral therapy of chronic hepatitis C. J Med Virol. 79:1075–1081. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Berberova M, Mendizova A, Popchristova E, Krastev N and Genov J: Disease and treatment outcome in chronic active hepatitis C with occult HBV infection. Hepatogastroenterology. 50:2009–2012. 2003.PubMed/NCBI

14 

Squadrito G, Pollicino T, Cacciola I, et al: Occult hepatitis B virus infection is associated with the development of hepatocellular carcinoma in chronic hepatitis C patients. Cancer. 106:1326–1330. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Cacciola I, Pollicino T, Squadrito G, Cerenzia G, Orlando ME and Raimondo G: Occult hepatitis B virus infection in patients with chronic hepatitis C liver disease. N Engl J Med. 341:22–26. 1999. View Article : Google Scholar : PubMed/NCBI

16 

Hasegawa I, Orito E, Tanaka Y, et al: Impact of occult hepatitis B virus infection on efficacy and prognosis of interferon-alpha therapy for patients with chronic hepatitis C. Liver Int. 25:247–253. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Ikeda K, Marusawa H, Osaki Y, et al: Antibody to hepatitis B core antigen and risk for hepatitis C-related hepatocellular carcinoma: a prospective study. Ann Intern Med. 146:649–656. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Kawaguchi T, Izumi N, Charlton MR and Sata M: Branched-chain amino acids as pharmacological nutrients in chronic liver disease. Hepatology. 54:1063–1070. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Sakata M, Kawaguchi T, Taniguchi E, Abe M, Koga H and Sata M: Quick and simple method for increasing the reduced albumin fraction in human serum albumin preparations by using stronger neo-minophagen C. Hepatol Res. 41:1120–1125. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Nagao Y and Sata M: Serum albumin and mortality risk in a hyperendemic area of HCV infection in Japan. Virol J. 7:3752010. View Article : Google Scholar : PubMed/NCBI

21 

Pacella CM, Francica G, Di Lascio FM, et al: Long-term outcome of cirrhotic patients with early hepatocellular carcinoma treated with ultrasound-guided percutaneous laser ablation: a retrospective analysis. J Clin Oncol. 27:2615–2621. 2009. View Article : Google Scholar

22 

Nishikawa H, Osaki Y, Iguchi E, et al: Radiofrequency ablation for hepatocellular carcinoma: the relationship between a new grading system for the ablative margin and clinical outcomes. J Gastroenterol. 48:951–965. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Muto Y, Sato S, Watanabe A, et al: Effects of oral branched-chain amino acid granules on event-free survival in patients with liver cirrhosis. Clin Gastroenterol Hepatol. 3:705–713. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Muto Y, Sato S, Watanabe A, et al: Overweight and obesity increase the risk for liver cancer in patients with liver cirrhosis and long-term oral supplementation with branched-chain amino acid granules inhibits liver carcinogenesis in heavier patients with liver cirrhosis. Hepatol Res. 35:204–214. 2006.PubMed/NCBI

25 

Kawaguchi T, Yoshida T, Harada M, et al: Hepatitis C virus down-regulates insulin receptor substrates 1 and 2 through up-regulation of suppressor of cytokine signaling 3. Am J Pathol. 165:1499–1508. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Itou M, Kawaguchi T, Taniguchi E, et al: Altered expression of glucagon-like peptide-1 and dipeptidyl peptidase IV in patients with HCV-related glucose intolerance. J Gastroenterol Hepatol. 23:244–251. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Pascal JP and Cales P: Propranolol in the prevention of first upper gastrointestinal tract hemorrhage in patients with cirrhosis of the liver and esophageal varices. N Engl J Med. 317:856–861. 1987. View Article : Google Scholar : PubMed/NCBI

28 

The Committee of Japan Diabetes Society on the diagnostic criteria of diabetes mellitus. Report of the committee on the classification and diagnostic criteria of diabetes mellitus. J Japan Diab Soc. 53:450–467. 2010.(In Japanese).

29 

Fujiyama A, Miyanohara A, Nozaki C, Yoneyama T, Ohtomo N and Matsubara K: Cloning and structural analyses of hepatitis B virus DNAs, subtype adr. Nucleic Acids Res. 11:4601–4610. 1983. View Article : Google Scholar : PubMed/NCBI

30 

Firth D: Bias reduction of maximum likelihood estimates. Biometrika. 80:27–38. 1993. View Article : Google Scholar

31 

Otsuka M, Uchida Y, Kawaguchi T, et al: Fish to meat intake ratio and cooking oils are associated with hepatitis C virus carriers with persistently normal alanine aminotransferase levels. Hepatol Res. 42:982–989. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Taniguchi E, Kawaguchi T, Sakata M, Itou M, Oriishi T and Sata M: Lipid profile is associated with the incidence of cognitive dysfunction in viral cirrhotic patients: a data-mining analysis. Hepatol Res. 43:418–424. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Adachi S, Shibuya A, Miura Y, Takeuchi A, Nakazawa T and Saigenji K: Impact of occult hepatitis B virus infection and prior hepatitis B virus infection on development of hepatocellular carcinoma in patients with liver cirrhosis due to hepatitis C virus. Scand J Gastroenterol. 43:849–856. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Kao JH, Chen PJ, Lai MY and Chen DS: Occult hepatitis B virus infection and clinical outcomes of patients with chronic hepatitis C. J Clin Microbiol. 40:4068–4071. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Shintani Y, Yotsuyanagi H, Moriya K, et al: The significance of hepatitis B virus DNA detected in hepatocellular carcinoma of patients with hepatitis C. Cancer. 88:2478–2486. 2000. View Article : Google Scholar : PubMed/NCBI

36 

Lok AS, Everhart JE, Di Bisceglie AM, Kim HY, Hussain M and Morgan TR: Occult and previous hepatitis B virus infection are not associated with hepatocellular carcinoma in United States patients with chronic hepatitis C. Hepatology. 54:434–442. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Tamori A, Nishiguchi S, Kubo S, et al: Possible contribution to hepatocarcinogenesis of X transcript of hepatitis B virus in Japanese patients with hepatitis C virus. Hepatology. 29:1429–1434. 1999. View Article : Google Scholar : PubMed/NCBI

38 

Kim CM, Koike K, Saito I, Miyamura T and Jay G: HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature. 351:317–320. 1991. View Article : Google Scholar : PubMed/NCBI

39 

Koike K, Moriya K, Iino S, et al: High-level expression of hepatitis B virus HBx gene and hepatocarcinogenesis in transgenic mice. Hepatology. 19:810–819. 1994. View Article : Google Scholar : PubMed/NCBI

40 

MacKinney AA Jr: Effect of aging on the peripheral blood lymphocyte count. J Gerontol. 33:213–216. 1978. View Article : Google Scholar : PubMed/NCBI

41 

Margolis KL, Rodabough RJ, Thomson CA, Lopez AM and McTiernan A: Prospective study of leukocyte count as a predictor of incident breast, colorectal, endometrial, and lung cancer and mortality in postmenopausal women. Arch Intern Med. 167:1837–1844. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Iida M, Ikeda F, Ninomiya T, et al: White blood cell count and risk of gastric cancer incidence in a general Japanese population: the Hisayama study. Am J Epidemiol. 175:504–510. 2012. View Article : Google Scholar : PubMed/NCBI

43 

Barashi N, Weiss ID, Wald O, et al: Inflammation induced hepatocellular carcinoma is dependent on CCR5. Hepatology. Mar 21–2013.(Epub ahead of print). View Article : Google Scholar

44 

Pusterla T, Nèmeth J, Stein I, et al: Receptor for advanced glycation endproducts (RAGE) is a key regulator of oval cell activation and inflammation-associated liver carcinogenesis in mice. Hepatology. 8:363–373. 2013. View Article : Google Scholar : PubMed/NCBI

45 

Lee FY, Lee SD, Tsai YT, Wu JC, Lai KH and Lo KJ: Serum C-reactive protein as a serum marker for the diagnosis of hepatocellular carcinoma. Cancer. 63:1567–1571. 1989. View Article : Google Scholar : PubMed/NCBI

46 

Dufour JF: C-reactive protein, a prognostic marker in HCC. Hepatology. 57:2103–2105. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Assar S, Arababadi MK, Ahmadabadi BN, Salehi M and Kennedy D: Occult hepatitis B virus (HBV) infection: a global challenge for medicine. Clin Lab. 58:1225–1230. 2012.PubMed/NCBI

48 

Matsuoka S, Nirei K, Tamura A, et al: Influence of occult hepatitis B virus coinfection on the incidence of fibrosis and hepatocellular carcinoma in chronic hepatitis C. Intervirology. 51:352–361. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Nakano M, Kawaguchi T, Nakamoto S, Kawaguchi A, Kanda T, Imazeki F, Kuromatsu R, Sumie S, Satani M, Yamada S, Yamada S, et al: Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection. Oncol Rep 30: 2049-2055, 2013.
APA
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F. ... Sata, M. (2013). Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection. Oncology Reports, 30, 2049-2055. https://doi.org/10.3892/or.2013.2700
MLA
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F., Kuromatsu, R., Sumie, S., Satani, M., Yamada, S., Torimura, T., Kakuma, T., Yokosuka, O., Sata, M."Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection". Oncology Reports 30.5 (2013): 2049-2055.
Chicago
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F., Kuromatsu, R., Sumie, S., Satani, M., Yamada, S., Torimura, T., Kakuma, T., Yokosuka, O., Sata, M."Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection". Oncology Reports 30, no. 5 (2013): 2049-2055. https://doi.org/10.3892/or.2013.2700
Copy and paste a formatted citation
x
Spandidos Publications style
Nakano M, Kawaguchi T, Nakamoto S, Kawaguchi A, Kanda T, Imazeki F, Kuromatsu R, Sumie S, Satani M, Yamada S, Yamada S, et al: Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection. Oncol Rep 30: 2049-2055, 2013.
APA
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F. ... Sata, M. (2013). Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection. Oncology Reports, 30, 2049-2055. https://doi.org/10.3892/or.2013.2700
MLA
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F., Kuromatsu, R., Sumie, S., Satani, M., Yamada, S., Torimura, T., Kakuma, T., Yokosuka, O., Sata, M."Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection". Oncology Reports 30.5 (2013): 2049-2055.
Chicago
Nakano, M., Kawaguchi, T., Nakamoto, S., Kawaguchi, A., Kanda, T., Imazeki, F., Kuromatsu, R., Sumie, S., Satani, M., Yamada, S., Torimura, T., Kakuma, T., Yokosuka, O., Sata, M."Effect of occult hepatitis B virus infection on the early-onset of hepatocellular carcinoma in patients with hepatitis C virus infection". Oncology Reports 30, no. 5 (2013): 2049-2055. https://doi.org/10.3892/or.2013.2700
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team