International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line
KATSURO KOIKE
[Related article:] Oncol Rep 25: 609β617, 2011; DOI: 10.3892/or.2011.1137
After the publication of the article, an error was found and we would like to correct it. The corresponding author takes full responsibility for this oversight.
In Materials and methods, the third paragraph; βConstruction of plasmid vector DNAβ, the first appeared junB primer sets of ready-made primers by Takara Bio Inc., were mistaken following the order described in Fig. 1, where No. 1 and No. 2 primer sets were custom-made primer sets by Operon Biotechnologies. Thus, No. 3 and No. 4 primer sets (ready-made primers by Takara Bio Inc.) and No. 1 and No. 2 primer sets were reversely described.
In the article, it was described:
β...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: ACCCCTACCGGAGTCTC AAA, reverse: GGAGTAGCTGCTGAGGTTGG) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: GAGCTGG AACGCCTGATTGTC, reverse: TGGTTCATCTTGTGCAG ATCGTC) using...β
However, it should be corrected as:
β...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: GAGCTGGAACGCCTGA TTGTC, reverse: TGGTTCATCTTGTGCAGATCGTC) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: AC CCCTACCGGAGTCTCAAA, reverse: GGAGTAGCTGCTG AGGTTGG) using...β