Open Access

[Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line

  • Authors:
    • Katsuro Koike
  • View Affiliations

  • Published online on: December 10, 2013     https://doi.org/10.3892/or.2013.2912
  • Pages: 1030-1030
  • Copyright: © Koike . This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Article

Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line

KATSURO KOIKE

[Related article:] Oncol Rep 25: 609–617, 2011; DOI: 10.3892/or.2011.1137

After the publication of the article, an error was found and we would like to correct it. The corresponding author takes full responsibility for this oversight.

In Materials and methods, the third paragraph; ‘Construction of plasmid vector DNA’, the first appeared junB primer sets of ready-made primers by Takara Bio Inc., were mistaken following the order described in Fig. 1, where No. 1 and No. 2 primer sets were custom-made primer sets by Operon Biotechnologies. Thus, No. 3 and No. 4 primer sets (ready-made primers by Takara Bio Inc.) and No. 1 and No. 2 primer sets were reversely described.

In the article, it was described:

‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: ACCCCTACCGGAGTCTC AAA, reverse: GGAGTAGCTGCTGAGGTTGG) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: GAGCTGG AACGCCTGATTGTC, reverse: TGGTTCATCTTGTGCAG ATCGTC) using...’

However, it should be corrected as:

‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: GAGCTGGAACGCCTGA TTGTC, reverse: TGGTTCATCTTGTGCAGATCGTC) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: AC CCCTACCGGAGTCTCAAA, reverse: GGAGTAGCTGCTG AGGTTGG) using...’

Related Articles

Journal Cover

2014-February
Volume 31 Issue 2

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Koike K: [Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line. Oncol Rep 31: 1030-1030, 2014
APA
Koike, K. (2014). [Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line. Oncology Reports, 31, 1030-1030. https://doi.org/10.3892/or.2013.2912
MLA
Koike, K."[Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line". Oncology Reports 31.2 (2014): 1030-1030.
Chicago
Koike, K."[Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line". Oncology Reports 31, no. 2 (2014): 1030-1030. https://doi.org/10.3892/or.2013.2912