Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
2014-February Volume 31 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-February Volume 31 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer

  • Authors:
    • Semra Demokan
    • Alice Y. Chuang
    • Kavita M. Pattani
    • David Sidransky
    • Wayne Koch
    • Joseph A. Califano
  • View Affiliations / Copyright

    Affiliations: Department of Basic Oncology, Oncology Institute, Istanbul University, Capa, Istanbul 34093, Turkey, Department of Dermatology, Johns Hopkins University, School of Medicine, Baltimore, MD, USA, Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins University, School of Medicine, Baltimore, MD, USA
  • Pages: 1014-1020
    |
    Published online on: December 16, 2013
       https://doi.org/10.3892/or.2013.2927
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Methylation of CpG islands in the promoter region of genes acts as a significant mechanism of epigenetic gene silencing in head and neck cancer. In the present study, we assessed the association of epigenetic alterations of a panel of 12 genes [nucleolar protein 4 (NOL4), iroquois homeobox 1 (IRX1), SLC5A8, LRRC3B, FUSSEL18, EBF3, GBX2, HMX2, SEPT9, ALX3, SOCS3 and LHX6] with head and neck squamous cell carcinoma (HNSCC) via a candidate gene approach. After the initial screening of methylated CpG islands on the promoter regions by bisulfite sequencing using salivary rinse samples, only two genes had methylated CpG dinucleotides on their promoter regions in tumor samples and absence of methylated CpGs were found in normal salivary rinse samples after bisulfite modification and bisulfite sequencing. We then performed real-time quantitative methylation-specific PCR (QMSP) on 16 salivary rinse and 14 normal mucosal samples from healthy subjects and 33 HNSCC tumor samples for the two genes selected. After validation with QMSP, one gene, NOL4, was highly methylated (91%) in tumor samples and unmethylated in normal salivary rinses and minimally methylated in normal mucosal samples demonstrating cancer-specific methylation in HNSCC tissues. Although the IRX1 gene was observed as methylated in normal mucosal and salivary rinse samples, the methylation values of these normal samples were very low (<10%). In conclusion, we identified NOL4 as a highly specific promoter methylated gene associated with HNSCC. IRX1 may have potential as a biomarker for HNSCC and should be assessed in a larger cohort.

Introduction

Head and neck cancer, which is the sixth most common cancer in the world among human malignant disorders, is an aggressive and life-threatening disease with poor prognosis, morbidity and high mortality in advanced disease. Survival rates have not improved significantly for patients with head and neck squamous cell carcinoma (HNSCC) in the past 30 years despite active clinical and basic research addressing this issue. More than 40,000 new cases of HNSCC are diagnosed in the United States each year, with a mortality rate of 12,000 in the USA annually (1). Treatment for HNSCC includes surgical resection, chemotherapy and radiation therapy; however, approximately 50% of all patients have advanced disease at the time of diagnosis often requiring use of all three treatment modalities. Cancer-specific molecular biomarkers, which have the ability to warn the clinicians in the earlier stage before the disease advances, or to provide insight regarding the prognosis of the disease or outcome of the patients, are required. In addition, it is important to develop new methods that provide sensitive and reliable biomarkers of HNSCC for detection, treatment response and prognosis.

Epigenetic alterations are a recent attractive phenomenon of human cancer, with the activation of proto-oncogenes and inactivation of tumor suppressor genes, either through hypomethylation or hypermethylation in the promoter regions of the genes, respectively (2). Transcriptional silencing of tumor suppressor genes by means of promoter hypermethylation plays an important role in head and neck carcinogenesis (3). Methylation of the CpG islands in the promoter regions of tumor suppressor genes is frequently observed with reduced gene expression (4,5).

From a previous study using the gene expression profiling via oligonucleotide microarray-based approach to discover the new cancer-specific methylated genes (6), in the present study, we evaluated the hypermethylation of 10 genes [nucleolar protein 4 (NOL4), iroquois homeobox 1 (IRX1), sodium-coupled monocarboxylate transporter 1 (SLC5A8), leucine rich repeat containing 3B (LRRC3B), functional smad-suppressing element on chromosome 18 (FUSSEL18), early B-cell factor 3 (EBF3), gastrulation brain homeobox 2 (GBX2), H6 family homeobox 2 (HMX2), septin 9 (SEPT9), ALX homeobox 3 (ALX3)] identified by Restriction Landmark Genomic Scanning (RLGS) in previous studies (7,8), and by personal communication with Bennett et al (7,8), and two other genes [suppressor of cytokine signaling 3 (SOCS3) and LIM homeobox 6 (LHX6)] selected from the literature via candidate gene approach (9–14). IRX1, SLC5A8, FUSSEL18, EBF3, GBX2, HMX2, SEPT9 and ALX3 genes showed tumor suppressor activity in previous cancer studies (15–19) and were involved in transforming growth factor (TGF) signaling pathway which has a high frequency of alteration in HNSCC (15,20–23). To measure methylation levels, real-time quantitative methylation-specific PCR (QMSP) was performed to provide an objective, robust and rapid assessment of promoter methylation status (24–27).

Materials and methods

Tissue samples

Following institutional review board approval and after obtaining appropriate informed consent, the HNSCC patients and control population from healthy subjects enrolled in a community screening study were recruited from the Johns Hopkins School of Medicine, Department of Otolaryngology-Head and Neck Surgery. Mucosal samples and salivary rinses from healthy population and HNSCC tissue samples were collected. In the present study, salivary rinses were obtained by brushing oral cavity and oropharyngeal surfaces with an exfoliating brush followed by rinse and gargle with 20 ml normal saline solution. The brush was gently agitated to release the obtained material into saline. After centrifugation, the supernatant was discarded and DNA was isolated from the pellet. Tumors were snap frozen and microdissected on a cryostat to ≥75% purity. DNA from 16 salivary rinse samples from non-cancer individuals were analyzed as a control, to investigate the normal promoter methylation status of two newly identified candidate genes, IRX1 and NOL4. The methylation status of these genes was analyzed in 33 fresh tumor samples from patients with head and neck cancer and 14 normal mucosa samples from healthy individuals.

DNA extraction and bisulfite treatment

DNA was isolated as previously described (28). In brief, DNA was obtained by phenol/chloroform extraction after overnight incubation with proteinase K (Boehringer-Mannheim, Germany) at 48°C. DNA from tumor and control samples was subjected to bisulfite treatment using EpiTect Bisulfite modification kit (Qiagen, Valencia, CA, USA) as per the manufacturer’s protocol.

Bisulfite sequencing

The bisulfite sequence analysis was performed to determine the methylation status in the promoter regions of 12 genes. Bisulfite-treated DNA was amplified for the 5′ region that included at least a portion of the CpG island within 1–2 kb of the first exon of the genes. The promoter regions of the genes were found from the database of the University of California, Santa Cruz (UCSC) (http://genome.ucsc.edu/). Primer sequences were determined by MethPrimer program (29) showing the CpG islands in the promoter regions of 12 genes for bisulfite sequencing (Table I). A thousand base pair region of the genes’ promoters and some part of the first exon were sequenced by the specific primers producing 400–500 bp PCR fragments. The primers for bisulfite sequencing were designed to hybridize to regions in the promoter without CpG dinucleotides. PCR products were gel-purified using the QIAquick Gel Extraction kit (Qiagen) according to the manufacturer’s instructions. Each amplified DNA sample was sequenced by the Applied Biosystems 3700 DNA Analyzer using nested, forward or reverse primers and BD terminator dye (Applied Biosystems, Foster City, CA, USA).

Table I

Primer sequences of 12 selected genes for bisulfite sequencing.

Table I

Primer sequences of 12 selected genes for bisulfite sequencing.

Gene name5′ Primer sequence 3′Primer sequence
LRRC3B TAAAGAGAGGGGAAAGATTTTTGTT AATCAATTTCCCCTACAATTCTAAAA
GGAAAATTGAATTTTATTTTTTTT AAAATATTAACTCCCTCTACTACTCTC
AATAGGAGAAAGAATGGGGTTATAGTT TAACCTTACAAAAAAAACAAACAAAA
NOL4 GGAAGTTTTGAATGGAGTAATTGTT CAAATACATTTTAAATAAATTCCAACC
GTTTGGGGTATTATAATTTATTTTGTAGAA CTCTCCTTCCTCCTAAATCCTACTT
TAGGATTTAGGAGGAAGGAGAGATT ACACCATTCTAACCCAAAAAAACTA
GTTGGGATGGTTTTGGTTATAAA CACCTATTCACCCTAAACTCATAAAA
FUSSEL18 TTATTTAATTATTTGAGATTAGAATTA AATAAATTCCTAAAAAACCTAAAACCTTAT
GGTTTTAGGTTTTTTAGGAATTTAT TCACCTAACCCACCTAATTAAATTTAA
EBF3 TTTTAGGATAAGTTGTAGTTTTTTGTATTT ATTTAACCCCTTAATACCTCCCTAC
GTAGGGAGGTATTAAGGGGTTAAAT CACAAAACTCAACCCTCTCTCCC
GGGAGAGAGGGTTGAGTTTTGTG CCCAAACATAAAAACTACTAAC
GBX2 GAGGGGTAGGATTTTGTTTTTAATT AACCTTAAAACCCTACAACCTTATC
GAGGTTAGTTTGGGTGGAAAG ATAAAACATAAACATAAAATAACC
GGTAGGTAAAATGTGAATGAGAAAGAGGAG ATAAAACATAAACATAAAATAACC
IRX1 TGGGTGAAGAGAAAGTTTTTTTT AAACATCTTTAACAAAAATACACCC
TTTTGTTAAAGATGTTTTTTGGAGG TACTTTAATTAACATCCCCTTAAAC
HMX2 GTTTTGTTATTAGTTTTTTATTTTTTTT AACCTCATCCCTATCACAAATTCTA
GGAATTTGAATTTAGATTTTTTG TTAAACCCCTTAAACCCTTCTCT
GAGAGAAGGGTTTAAGGGGTTTA TACAACAAACAAACAATAAAAAAAA
GGAGGATGGTGGAGTAGTTTGTATA TCTAACCAAAAACAACCAAAACTAAA
SLC5A8 GTGGATTGTTTATTTAGGATTAGATGG AACCTTCATATAACACATACATACTTAACA
GTGTTAAGTATGTATGTGTTATATGAAGGT AAAAACTAAAACCTCCAACTACTTCC
GATTGTTGAATTGGAAAGTTAAAATTTA CCTCAAACCCAAATATAAAACCTC
SEPT9 GGAAGATGTTTTTTTTGTTAAGGAG TCAATCTATACTACTCCCCAAAACC
TTGGGGAGTAGTATAGATTGAAAAGT TTAAACTTCACCTCAAAAATTCATT
GGATGAATAGTGGGGAATAGTATTG CCAAAAAAAACCCTAAAAAATCAC
ALX3 GTGGGTTTTTAGATATTTGGGTTATT CAAACAAACAAACCTTAAACTACAATTT
ATTTTTAATAGTTTTTTTTATTGTG CTAACTTAATACTAAAACCATCCAC
TTTGAGTTGTTTGGGATTGG CTCTAAAAAATAAAACTCCAAAAACC
SOCS3 GAGAGTATTTGGTTTAATTTATA CTTCCCCTTCCCCTTTTCCC
TGTAGTTTTGGGTTTTTTTTT CAACTTCTCATTCACATTTCC
GATTTGGATTTTTTGTTT CTCCTCCTTCCTACCTAATC
LHX6 GTAGATGGTATGGTTATGGGT ACCTCCCTAACTACTACC
AGGAGGATAAGGAGGAGGGAG CTCATACTTCCAATACATAAACC
GTTTTTGTAGTAGTTTTTGT CCAACATTTACATAATATATTCC
GGTTTATGTATTGGAAGTATGAG AAAAAAAAACACCCTCCAACC
GGTTGGAGGGTGTTTTTTTTT AATTTTTTCTCTCTCCACC

[i] LRRC3B, leucine rich repeat containing 3B; NOL4, nucleolar protein 4; FUSSEL18, functional smad-suppressing element on chromosome 18; EBF3, early B-cell factor 3; GBX2, gastrulation brain homeobox 2; IRX1, iroquois homeobox 1; HMX2, H6 family homeobox 2; SLC5A8, sodium-coupled monocarboxylate transporter 1; SEPT9, septin 9; ALX3, ALX homeobox 3; SOCS3, suppressor of cytokine signaling 3; LHX6, LIM homeobox 6.

Quantitative methylation-specific PCR

Primer and probe sequences were determined by MethPrimer program showing the CpG islands in the promoter regions of two genes selected after bisulfite sequencing (Table II). To determine if the methylated genes in tumor samples were cancer-specific, we investigated promoter methylation in 16 normal saliva, 14 age-matched normal mucosa from healthy individuals that were analyzed as a control, to investigate the normal promoter methylation status of two newly identified candidate genes (NOL4, IRX1) and in 33 HNSCC tumor samples by QMSP. Lymphocytes obtained from a healthy individual were in vitro methylated using excess SssI methyltransferase (New England Biolabs Inc., Beverly, MA, USA) to generate completely methylated DNA that was used as a positive control standard. To quantitate the relative percent of methylation, we computed the ratio between the QMSP values of the gene of interest relative to an internal control, ACTB (gene of interest/reference gene ×100) (30). Fluorogenic PCR was carried out in a reaction volume of 20 μl consisting of 600 nM of each primer; 200 nM of probe; 0.6 U of platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA); 200 μM of each dATP, dCTP, dGTP and dTTP; 1X ROX Dye reference and 1X buffer [16.6 mM of ammonium sulfate; 67 mM of Trizma (Sigma, St. Louis, MO, USA); 6.7 mM of magnesium chloride; 10 mM of mercaptoethanol and 0.1% dimethylsulfoxide]. Thirty nanograms of bisulfite treated DNA were used in each real-time QMSP reaction. Amplifications were carried out in 384-well plates in a 7900 Sequence Detector system (Perkin-Elmer Applied Biosystems, Norwalk, CT, USA) and were analyzed by SDS 2.3 (sequence detector system) (Applied Biosystems). Each reaction was performed in triplicate.

Table II

Primers and probe sequences of 2 selected genes for validation by QMSP.

Table II

Primers and probe sequences of 2 selected genes for validation by QMSP.

Gene nameProbe sequence5′ Primer sequence3′ Primer sequenceTemp (°C)bp
NOL4 GGGGAGGCGGCGTTGCGTTTTAT TTTTCGGGGTTTAAAGGCGTTG AAATAATCCCTAAACGCCTCGC60178
IRX1 AGTAGTTGGTCGGGTCGGTACGG GGGGATATATTTCGGTCGCGA TCCCGCGAACACGTAATACC60198

[i] QMSP, real-time quantitative methylation-specific PCR; NOL4, nucleolar protein 4; IRX1, iroquois homeobox 1.

Results

Clinicopathological characteristics of control subjects and patients with HNSCC

Table III describes the demographic parameters of the sample populations used in the present study. The mean age of normal mucosal samples was 43.4 years (range, 24–65). Tobacco users were observed as 42%. Both normal mucosal and tumor samples had a similar male and Caucasian predominance. Smoking rate was 78% and alcohol consumption was 69%. Tumor samples (n=33) were obtained from patients with stage I (7.4%), stage II (22%), stage III (26%) and stage IV (44%) lesions. These were from primary tumors of the oral cavity (n=9), oropharynx (n=7), hypopharynx (n=2), larynx (n=8), maxillary sinus (n=2), nasal floor (n=1), salivary gland (n=1) and unknown primary/neck (n=3). The male and Caucasian prevalence was smaller in the normal salivary rinse samples and tobacco users were found as 31.25%. The ages of individuals from which the normal salivary rinse was obtained were slightly lower than the population of head and neck cancer patients, mean ages 53.06 years (range, 33–83) and 61.4 years (range, 36–88), respectively. Due to our small cohort, we did not perform any statistics between the clinical parameters and QMSP results of tumor and normal populations.

Table III

QMSP results and demographics of the patients with HNSCC.

Table III

QMSP results and demographics of the patients with HNSCC.

Tumor samplesIRX1NOL4Age (years)GenderRaceSmokingAlcoholTumor anatomic siteOverall stage
1NN67MCYesYesNasal floor2
2YY57MCYesYesLarynx2
3NN61MCNoNoNeck3
4YY60FCYesYesLarynx4
5YY55MAYesYesLarynx2
6YY54MCNoYesOropharynx4
7YN64MAYesYesHypopharynx3
8YY55FAYesNoOral cavity1
9NY80MCYesNoOral cavityNA
10YY54FCNoOralcavity4
11YY62MCYesYesOropharynx4
12YY72MCYesYesHypopharynx3
13YY42MCYesNoLarynx2
14YY66MCYesNoOropharynx4
15YY74MCYesLarynx2
16YY58MAYesYesOropharynx4
17YY56FCYesYesOral cavity2
18YY43MCYesYesOropharynx4
19YY68MCYesYesOropharynx4
20YY63MAYesOral cavityNA
21YY64FCNoYesOral cavity3
22NY88MCYesYesOral cavityNA
23YY42MCYesNoOral cavity3
24YY51MCYesYesLarynx4
25YY80MCNoYesNeckNA
26YY58MCYesYesLarynx3
27YY71MCYesYesNeckNA
28YY48MCYesYesOropharynx4
29YY61MCYesNoMaxillary sinus1
30YY77MCNoNoSalivary glandNA
31YY67MCLarynx3
32YY36MCYesNoOral cavity4
33YY74FCNoYesMaxillary sinus4

[i] M, male; F, female; C, Caucasian; A, African; Y, methylated; N, unmethylated; QMSP, real-time quantitative methylation-specific PCR; HNSCC, head and neck squamous cell carcinoma; IRX1, iroquois homeobox 1; NOL4, nucleolar protein 4; NA, not available.

Genes specifically methylated in HNSCC tumors

In the present study, we investigated methylation of the 12 gene promoters by bisulfite modification and QMSP. In the initial screening of the methylated CpG islands, bisulfite sequencing was performed by using four HNSCC cell lines (JHU-06, JHU-022, JHU-022B and JHU-028), eight normal salivary rinses and eight HNSCC samples. Only two genes, NOL4 (NM_003787) and IRX1 (NM_024337) (http://www.genenames.org), had methylated CpG dinucleotides on their promoter regions in tumor samples but absence of methylated CpGs was found in normal salivary rinse samples (Table IV). We investigated the methylation frequency in a larger cohort of normal salivary rinses, mucosal and HNSCC specimens, in order to find a biomarker candidate.

Table IV

Information regarding candidate tumor suppressor genes and the bisulfite sequencing results.

Table IV

Information regarding candidate tumor suppressor genes and the bisulfite sequencing results.

Gene ref. IDChromosomal locationCandidate TSGsNormal salivary rinses n (%)HNSCC tissue n (%)HNSCC cell lines n (%)
NM_052953 chr3:26,664,300–26,752,265LRRC3B1/3 (33)3/4 (75)4/4 (100)
NM_003787 chr18:31,431,070–31,803,446NOL 40/6 (0)6/6 (100)4/4 (100)
NM_001037802 chr18:44,757,495–44,775,554 FUSSEL185/8 (62.5)4/7 (57)3/4 (75)
NM_001005463 chr10:131,633,547–131,762,091EBF32/4 (50)1/3 (33)3/4 (75)
NM_001485 chr2:237,074,307–237,076,652GBX23/5 (60)4/6 (67)4/4 (100)
NM_024337 chr5:3,596,168–3,601,517 IRX10/6 (0)6/6 (100)4/4 (100)
NM_005519 chr10:124,907,638–124,910,188HMX22/4 (50)1/3 (33)4/4 (100)
NM_145913 chr12:101,549,994–101,604,016SLC5A83/5 (60)2/3 (67)2/2 (100)
NM_006640 chr17:75,315,597–75,496,678SEPT94/7 (57)2/3 (67)2/4 (50)
NM_006492 chr1:110,602,997–110,613,322ALX31/3 (33)0/3 (0)3/4 (75)
NM_003955 chr17:76,352,859–76,356,158SOCS30/8 (0)0/8 (0)1/2 (50)
NM_014368 chr9:124,964,858–124,991,019LHX60/8 (0)0/8 (0)1/1 (100)

[i] HNSCC, head and neck squamous cell carcinoma; LRRC3B, leucine rich repeat containing 3B; NOL4, nucleolar protein 4; FUSSEL18, functional smad-suppressing element on chromosome 18; EBF3, early B-cell factor 3; GBX2, gastrulation brain homeobox 2; IRX1, iroquois homeobox 1; HMX2, H6 family homeobox 2; SLC5A8, sodium-coupled monocarboxylate transporter 1; SEPT9, septin 9; ALX3, ALX homeobox 3; SOCS3, suppressor of cytokine signaling 3; LHX6, LIM homeobox 6.

In the second stage of the present study, we performed QMSP on 16 normal salivary rinse and 14 normal mucosal samples from healthy individuals and 33 HNSCC tumor samples for two selected genes. The NOL4 gene showed no methylation (0/16) in normal salivary rinses and two out of 14 (14%) mucosal samples were minimally methylated between 1 and 3% methylation values, whereas the methylation rate was 91% (30/33) on the promoter region of the NOL4 gene in HNSCC tumor samples showing high methylation values are 79% (26/33) of the patients between 10 and 100%. The IRX1 gene [10/14 (71%), 9/16 (56.25%) and 29/33 (88%)] demonstrated varying degrees of methylation on their promoter regions in normal mucosa, normal salivary rinses and HNSCC tumor samples, respectively (Fig. 1). Although normal salivary methylation rate was observed as high, IRX1 methylation values were <1% in normal salivary rinses and were mostly (8/14, 57%) between 0.1 and 10% in normal mucosal samples indicating a very strong marker which may define HNSCC tumor tissues as a potential biomarker (Fig. 1).

Figure 1

Methylation frequency of two candidate genes IRX1 and NOL4 in HNSCC tumors, normal mucosal and salivary rinse samples. Scatter plots of QMSP analysis of candidate gene promoters. NOL4, nucleolar protein 4; IRX1, iroquois homeobox 1; HNSCC, head and neck squamous cell carcinoma; QMSP, real-time quantitative methylation-specific PCR.

Discussion

In the present study, we investigated methylation status of the promoter regions of 12 genes by bisulfite modification, bisulfite sequencing and QMSP techniques. Only two of them (IRX1 and NOL4) showed methylation in their CpG islands located on promoter region of these genes, indicating a characteristic of a biomarker molecule. NOL4 gene encoding a nucleolar protein which is expressed predominantly in brain and testis, was identified by Ueki et al (31) and there is only one study showing high methylation status of 20 patients with cervical cancer by MethyLight assays (32) in concordance with our results.

The IRX1 gene is a member of the iroquois homeobox gene family and plays a role during pattern formation of vertebrate embryos. In published literature, there are only four studies investigating the effects of epigenetically silencing IRX1 gene, in the patients with gastric cancer (33) and the studies of Bennett et al with HNSCC (7,8,34). Bennett et al (7) reported an association between the HNSCC and hypermethylation of IRX1 in accordance with our results, and four other genes (FUSSEL18, EBF3, SLC5A8 and SEPT9), but not SLC5A8; we did not find any methylated CpG on the promoter regions of the last five genes. In two other studies, Bennett et al also showed the association between IRX1 methylation and recurrence and between four other genes and clinicopathological parameters such as HPV status, alcohol and tobacco usage (8) and they investigated the interactions with some molecules of the TGF-β pathway, and their transcriptional inactivation by methylation in HNSCC caused the decrease in apoptosis and differentiation, and increased proliferation (34). In the present study, we only observed the methylation of the IRX1 gene which was the one of the five frequently methylated genes identified by Restriction Landmark Genomic Scanning (RLGS) method in metastatic HNSCC samples compared to primary tumors. Mass array methylation (7) and COBRA (8) analysis were used in fresh/paraffin-embeded HNSCC tumors and matched normal mucosa samples in the previous studies of Bennett et al (7,8). We screened the methylated CpG islands on the promoter regions of these genes by bisulfite sequencing using frozen HNSCC tumors, HNSCC cell lines and normal salivary rinses in order to select the genes that have the methylated CpG islands on their promoter regions in tumor samples but no methylation in normal mucosal and normal salivary rinse samples. Then, the methylation levels were measured by QMSP technique in 33 HNSCC tumors, 16 salivary rinses and 14 normal mucosa as reported in our previous study (35). Our aim was to find a cancer-specific biomarker and to detect the tumor tissues in salivary rinses of the patients earlier and to screen the normal population. In addition, in a previous study (34), tonsillar carcinoma samples were used, whereas we quantified the methylation in the primary tumors of the oral cavity, oropharynx, hypopharynx, larynx, maxillary sinus, nasal floor and unknown primary/neck. Therefore, discrepant observations between these studies by Bennett et al (7,8,34) and our data may be due to confounding factors including anatomic site, methodology and sampling method. Therefore, the four other genes described by Bennett et al (7,8), may not be good biomarker candidates in salivary rinse samples despite being differentially methylated in primary tumor samples. The present study is the first to investigate the methylation levels of NOL4 gene and to show high methylation in the patients with HNSCC by QMSP technique.

In addition, it would be helpful to increase sample size to facilitate a more precise determination of accuracy of these biomarkers in detection of the disease and to evaluate the association of the results with the clinical parameters of the disease. These newly identified silenced genes here remain to be tested in saliva, serum or plasma samples from HNSCC patients in a larger sample size.

Acknowledgements

This study was supported by the National Cancer Institute SPORE (5P50CA096784-05) and the Scientific Research Projects Coordination Unit of Istanbul University (UDP-30980). This study/analysis is based on a web database application provided by Research Information Technology Systems (RITS)-https://www.rits.onc.jhmi.edu/.

References

1 

Jemal A, Siegel R, Ward E, Murray T, Xu J, Smigal C and Thun MJ: Cancer statistics, 2006. CA Cancer J Clin. 56:106–130. 2006. View Article : Google Scholar

2 

Baylin SB, Herman JG, Graff JR, Vertino PM and Issa JP: Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res. 72:141–196. 1998. View Article : Google Scholar : PubMed/NCBI

3 

Dulaimi E, Hillinck J, Ibanez de Caceres I, Al-Saleem T and Cairns P: Tumor suppressor gene promoter hypermethylation in serum of breast cancer patients. Clin Cancer Res. 10:6189–6193. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Leonhardt H and Cardoso MC: DNA methylation, nuclear structure, gene expression and cancer. J Cell Biochem Suppl. 35:78–83. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Herman JG and Baylin SB: Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med. 349:2042–2054. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Yamashita K, Upadhyay S, Osada M, et al: Pharmacologic unmasking of epigenetically silenced tumor suppressor genes in esophageal squamous cell carcinoma. Cancer Cell. 2:485–495. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Bennett KL, Karpenko M, Lin MT, et al: Frequently methylated tumor suppressor genes in head and neck squamous cell carcinoma. Cancer Res. 68:4494–4499. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Bennett KL, Lee W, Lamarre E, et al: HPV status-independent association of alcohol and tobacco exposure or prior radiation therapy with promoter methylation of FUSSEL18, EBF3, IRX1, and SEPT9, but not SLC5A8, in head and neck squamous cell carcinomas. Genes Chromosomes Cancer. 49:319–326. 2010.PubMed/NCBI

9 

Estécio MR, Youssef EM, Rahal P, et al: LHX6 is a sensitive methylation marker in head and neck carcinomas. Oncogene. 25:5018–5026. 2006.PubMed/NCBI

10 

Pierconti F, Martini M, Pinto F, et al: Epigenetic silencing of SOCS3 identifies a subset of prostate cancer with an aggressive behavior. Prostate. 71:318–325. 2011.

11 

Isomoto H: Epigenetic alterations in cholangiocarcinoma-sustained IL-6/STAT3 signaling in cholangio- carcinoma due to SOCS3 epigenetic silencing. Digestion. 79(Suppl 1): 2–8. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Fourouclas N, Li J, Gilby DC, et al: Methylation of the suppressor of cytokine signaling 3 gene (SOCS3) in myeloproliferative disorders. Haematologica. 93:1635–1644. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Martini M, Pallini R, Luongo G, Cenci T, Lucantoni C and Larocca LM: Prognostic relevance of SOCS3 hypermethylation in patients with glioblastoma multiforme. Int J Cancer. 123:2955–2960. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Weber A, Hengge UR, Bardenheuer W, et al: SOCS-3 is frequently methylated in head and neck squamous cell carcinoma and its precursor lesions and causes growth inhibition. Oncogene. 24:6699–6708. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Thangaraju M, Gopal E, Martin PM, Ananth S, Smith SB, Prasad PD, Sterneck E and Ganapathy V: SLC5A8 triggers tumor cell apoptosis through pyruvate-dependent inhibition of histone deacetylases. Cancer Res. 66:11560–11564. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Zhao LY, Niu Y, Santiago A, Liu J, Albert SH, Robertson KD and Liao D: An EBF3-mediated transcriptional program that induces cell cycle arrest and apoptosis. Cancer Res. 66:9445–9452. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Yu YY, Ji J, Lu Y, Bu L, Liu BY, Zhu ZG and Lin YZ: High-resolution analysis of chromosome 5 and identification of candidate genes in gastric cancer. Zhonghua Zhong Liu Za Zhi. 28:84–87. 2006.(In Chinese).

18 

Jönsson G, Staaf J, Olsson E, et al: High-resolution genomic profiles of breast cancer cell lines assessed by tiling BAC array comparative genomic hybridization. Genes Chromosomes Cancer. 46:543–558. 2007.PubMed/NCBI

19 

Burrows JF, Chanduloy S, McIlhatton MA, et al: Altered expression of the septin gene, SEPT9, in ovarian neoplasia. J Pathol. 201:581–588. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Amir S, Wang R, Matzkin H, Simons JW and Mabjeesh NJ: MSF-A interacts with hypoxia-inducible factor-1α and augments hypoxia-inducible factor transcriptional activation to affect tumorigenicity and angiogenesis. Cancer Res. 66:856–866. 2006.PubMed/NCBI

21 

Endo S, Zeng Q, Burke NA, et al: TGF-α antisense gene therapy inhibits head and neck squamous cell carcinoma growth in vivo. Gene Ther. 7:1906–1914. 2000.

22 

Le QT, Kong C, Lavori PW, et al: Expression and prognostic significance of a panel of tissue hypoxia markers in head-and-neck squamous cell carcinomas. Int J Radiat Oncol Biol Phys. 69:167–175. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Sánchez-Elsner T, Botella LM, Velasco B, Corbí A, Attisano L and Bernabéu C: Synergistic cooperation between hypoxia and transforming growth factor-β pathways on human vascular endothelial growth factor gene expression. J Biol Chem. 276:38527–38535. 2001.PubMed/NCBI

24 

Bernard PS and Wittwer CT: Real-time PCR technology for cancer diagnostics. Clin Chem. 48:1178–1185. 2002.PubMed/NCBI

25 

Eads CA, Danenberg KD, Kawakami K, et al: MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 28:E322000. View Article : Google Scholar : PubMed/NCBI

26 

Cottrell SE and Laird PW: Sensitive detection of DNA methylation. Ann NY Acad Sci. 983:120–130. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Jerónimo C, Usadel H, Henrique R, Oliveira J, Lopes C, Nelson WG and Sidransky D: Quantitation of GSTP1 methylation in non-neoplastic prostatic tissue and organ-confined prostate adenocarcinoma. J Natl Cancer Inst. 93:1747–1752. 2001.PubMed/NCBI

28 

Tokumaru Y, Yamashita K, Osada M, et al: Inverse correlation between cyclin A1 hypermethylation and p53 mutation in head and neck cancer identified by reversal of epigenetic silencing. Cancer Res. 64:5982–5987. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Li LC and Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics. 18:1427–1431. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Park HL, Kim MS, Yamashita K, et al: DCC promoter hypermethylation in esophageal squamous cell carcinoma. Int J Cancer. 122:2498–2502. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Ueki N, Kondo M, Seki N, Yano K, Oda T, Masuho Y and Muramatsu M: NOLP: identification of a novel human nucleolar protein and determination of sequence requirements for its nucleolar localization. Biochem Biophys Res Commun. 252:97–102. 1998. View Article : Google Scholar : PubMed/NCBI

32 

Wang SS, Smiraglia DJ, Wu YZ, et al: Identification of novel methylation markers in cervical cancer using restriction landmark genomic scanning. Cancer Res. 68:2489–2497. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Guo X, Liu W, Pan Y, et al: Homeobox gene IRX1 is a tumor suppressor gene in gastric carcinoma. Oncogene. 29:3908–3920. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Bennett KL, Romigh T and Eng C: Disruption of transforming growth factor-β signaling by five frequently methylated genes leads to head and neck squamous cell carcinoma pathogenesis. Cancer Res. 69:9301–9305. 2009.

35 

Demokan S, Chuang AY, Chang X, et al: Identification of guanine nucleotide-binding protein γ-7 as an epigenetically silenced gene in head and neck cancer by gene expression profiling. Int J Oncol. 42:1427–1436. 2013.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Demokan S, Chuang AY, Pattani KM, Sidransky D, Koch W and Califano JA: Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer. Oncol Rep 31: 1014-1020, 2014.
APA
Demokan, S., Chuang, A.Y., Pattani, K.M., Sidransky, D., Koch, W., & Califano, J.A. (2014). Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer. Oncology Reports, 31, 1014-1020. https://doi.org/10.3892/or.2013.2927
MLA
Demokan, S., Chuang, A. Y., Pattani, K. M., Sidransky, D., Koch, W., Califano, J. A."Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer". Oncology Reports 31.2 (2014): 1014-1020.
Chicago
Demokan, S., Chuang, A. Y., Pattani, K. M., Sidransky, D., Koch, W., Califano, J. A."Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer". Oncology Reports 31, no. 2 (2014): 1014-1020. https://doi.org/10.3892/or.2013.2927
Copy and paste a formatted citation
x
Spandidos Publications style
Demokan S, Chuang AY, Pattani KM, Sidransky D, Koch W and Califano JA: Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer. Oncol Rep 31: 1014-1020, 2014.
APA
Demokan, S., Chuang, A.Y., Pattani, K.M., Sidransky, D., Koch, W., & Califano, J.A. (2014). Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer. Oncology Reports, 31, 1014-1020. https://doi.org/10.3892/or.2013.2927
MLA
Demokan, S., Chuang, A. Y., Pattani, K. M., Sidransky, D., Koch, W., Califano, J. A."Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer". Oncology Reports 31.2 (2014): 1014-1020.
Chicago
Demokan, S., Chuang, A. Y., Pattani, K. M., Sidransky, D., Koch, W., Califano, J. A."Validation of nucleolar protein 4 as a novel methylated tumor suppressor gene in head and neck cancer". Oncology Reports 31, no. 2 (2014): 1014-1020. https://doi.org/10.3892/or.2013.2927
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team