Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May-2014 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells

  • Authors:
    • Jing Kuang
    • Ya-Lan Wang
    • Ming Xiao
    • Yi Tang
    • Wen‑Wen Chen
    • Guang-Lin Song
    • Xi Yang
    • Ming Li
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Molecular Medicine and Cancer Research Center, Chongqing Medical University, Chongqing 400016, P.R. China
  • Pages: 2335-2343
    |
    Published online on: March 20, 2014
       https://doi.org/10.3892/or.2014.3100
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Arginine-specific ADP-ribosyltransferase 1 (ART1) and poly(ADP-ribose) polymerase-1 (PARP-1) are both post‑translational modification proteins. Inhibition of PARP1 induces apoptosis in cancer cells, and ART1 regulates RhoA which promotes apoptosis in hepatic cancer cells when inhibited. However, the interaction of ART1 and PARP-1 on the effect of apoptosis has not yet been elucidated. In the present study, lentiviral vector-mediated ART1-cDNA was transfected into CT26 cells, and the apoptosis rate was detected by flow cytometric assay and Hoechst 33342 staining. Relevant factors were detected by reverse transcriptase-PCR and western blotting. The results showed that the apoptosis rate in the ART1-cDNA CT26 cells treated with PARP-1 inhibitor 5-aminoisoquinoline (5-AIQ) and cisplatin increased, when compared with the ART1-cDNA CT26 cells treated with cisplatin only or the untreated ART1-cDNA CT26 cells. Further studies have shown that PARP-1 is in the downstream of ART1, and plays a role in ART1-mediated CT26 cell apoptosis through the ROCK1/NF-κB/PARP-1 pathway when induced by cisplatin. We also found that in cisplatin-treated cells, activated caspase 3 cleaved PARP-1 and the decreased level of PARP-1 in turn decreased the expression of nuclear factor (NF)-κB, Cox-2 and increased caspase 3, resulting in the enhanced ability of ART1 to regulate CT26 cell apoptosis. Our research provides initial sight into the synergistic effect of ART1 and PARP-1 on apoptosis induced by cisplatin in murine colon carcinoma CT26 cells.

Introduction

ADP-ribosylation reactions can be divided into four major groups: mono-ADP-ribosylation, poly-ADP-ribosylation, ADP-ribose cyclization and formation of O-acetyl-ADP-ribose (1). Mono-ADP-ribosylation and poly-ADP-ribosylation are common in both prokaryotes and eukaryotes and serve as post-translational modification proteins in which the ADP-ribose is transferred from NAD+ to a specific amino acid in a target protein (2,3).

Mono-ADP-ribosylation reactions transfer a single ADP-ribose to various amino acid (arginine, histidine, diphthamid, cysteine, asparagine) residues by mono-ADP-ribosyl transferases (ARTs) (4,5). Arginine-specific ADP-ribosyl transferase 1 (ART1), a member of the arginine-specific ARTs, was initially found to be expressed and activated in eukaryons (6–8), and has been mainly researched in regards to inflammation (9). Yau et al reported that MIBG, a specific inhibitor of arginine-dependent mARTs, could inhibit smooth muscle cell (SMC) proliferation and migration via Rho-dependent signaling (10). However, it has been proven that the Rho kinase-associated coil-containing protein kinase (RhoA/ROCK) pathway plays a central role in tumor progression (11). Several reports indicate evidence that inhibition of the Rho/ROCK signaling pathway induces hepatocellular cancer (HCC) cell apoptosis (12,13).

Unlike mono-ADP-ribosylation, poly-ADP-ribosylation transforms NAD+ to nicotinamide and ADP-ribose to form long and branched (ADP-ribose) polymers on glutamic acid residues by poly(ADP-ribose) polymerase (PARP). PARP-1 is the principal member of the PARP enzymes and has been implicated in both the prevention and aggravation of various diseases (14). Expression of PARP-1 plays a central role in the cellular response to DNA damage (6), whereas the diverse physiological functions of PARP-1 in cell survival, several forms of cell death, gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging have been widely appreciated recently (14). Our previous study demonstrated that downregulation of PARP-1 by RNA interference of PARG inhibits the migration, proliferation and metastatic potential of colon carcinoma cells (15–18). Ye reported that a PARP-1 inhibitor enhances the efficacy of DNA-damaging anticancer drugs by inducing cancer cell apoptosis, and inhibits necrosis in normal cells and neurons from the toxic effects of DNA-damaging anticancer drugs, both through processes that prevent the significant loss of ATP (19).

Pioneer observations found that mART could mediate the signal transduction from the cell surface to the nucleus (11), and our previously study demonstrated that both the expression of ART1 and PARP-1 was significantly increased in colon carcinoma tissues when compared with normal colon tissues, and inhibition of ART1 downregulated the expression of PARP-1 possibly by regulation of NF-κB (20). However, the interaction of ART1 and PARP-1 in the process of apoptosis has not yet been elucidated. In the present study, we aimed to research their effect on apoptosis induced by cisplatin (CDDP) and the possible mechanism in murine colon carcinoma CT26 cells (21,22).

Materials and methods

Cell line and reagents

CT26, a murine colon carcinoma cell line, was kindly provided by Professor Y.Q. Wei, Huaxi Hospital, Sichuan University. ART1-shRNA and control-shRNA were successfully transfected in CT26 cells by us in early experiments (20). The lentiviral vector was obtained from GeneChem (Shanghai, China). The Annexin V-PE/7-AAD apoptosis detection kit was from KeyGen Biotechnology Co., Ltd. (Nanjing, China). Y-27632 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). CDDP was obtained from Sigma (St. Louis, MO, USA). 5-Aminoisoquinoline was kindly supplied by Professor M.D. Threadgill, Bath University, UK. The BCA protein assay kit was from Beyotime (Shanghai, China).

Cell culture

The murine CT26 colon carcinoma cell line was cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 μg/ml streptomycin (Thermo Pierce) at 37°C in a 5% CO2 incubator. CDDP was prepared in 1640 at a final concentration of 1 mM and stored at 4°C away from light.

Transfection of CT26 cells and identification

Mouse ART1-cDNA sequence (accession no. NC_000073) was obtained from GenBank, and the primers of ART1-cDNA were designed as follows: lentiviral vector-mediated ART1-cDNA primer 1, GAGGATCCCCGGGTACCGGTCGCCACCATGAAGATTCCTGCTATGATG; lentiviral vector-mediated ART1-cDNA primer 2, TCACCATGGTGGCGACCGGACATCGGGTAAGTTGCTG, and was successfully constructed by GeneChem. Transfection was carried according to the manufacturer’s instructions. Cells were cultured in 12-well plates at a density of 3×104 cells/well when they were in the logarithmic growth phase. Lentivirus particles (10 μl) were added to each well while the cells covered 50% of each well. Transfection efficiency was optimized using green fluorescent protein and detected under a fluorescence microscope after 72 h. The efficiency of the ART1-cDNA lentivirus transfected into CT26 cells was determined by reverse transcriptase (RT)-PCR and western blot analysis.

RNA was extracted from ART1-cDNA CT26 cells with TRIzol reagent according to the supplied manual (Takara, Dalian, China), and RNAs were extracted from ART1-shRNA CT26 cells, control-shRNA CT26 cells and untransfected CT26 cells used as a control. ART1 (target gene) and β-actin (internal control gene) were detected using oligonucleotide primers which were designed and produced by Sangon Biotech Co. (Shanghai, China): ART1, 5′-ACCTTCTTCGGTATCTGGACCT-3′ (F1) and 5′-TAAGTTGCTGGAGACCTGGATT-3′ (R1); β-actin, 5′-ATATCGCTGCGCTGGTCGTC-3′ (F1) and 5′-AGGATGGCGTGAGGGAGAGC-3′ (R1). The cycling conditions were as follows: the number of PCR cycles (94°C for 30 sec, 50–58°C for 30 sec, 72°C for 1 min and then 5 min for the last extension) was 30 for the amplification of reverse transcriptase products. Finally, the PCR amplification products were separated on 2.0% agarose gel (Genview, Tallahasses, FL, USA). This experiment was performed in triplicate.

Effect of ART1 and PARP-1 on CT26 cell apoptosis induced by CDDP

ART1-cDNA CT26 cells were treated with or without CDDP. ART1-shRNA CT26 cells, control-shRNA CT26 cells and untransfected CT26 cells were treated in the same manner as were the control. CT26 cells were cultured in 6-well plates at 1×105 cells/well for 24 h and 30 μM of CDDP for a further 48 h for inducing apoptosis. To confirm the role of PARP-1 in this apoptosis process, ART1-cDNA CT26 cells were treated with PARP-1 inhibitor 5-AIQ at 100 μM for 24 h and CDDP at 30 μM for 48 h or ART1-cDNA CT26 cells were treated with CDDP only at 30 μM for 48 h or were untreated as control groups. The apoptosis rate was tested for each cell group by flow cytometric analysis and Hoechst 33342 staining.

For flow cytometric analysis, cells were trypsinized, washed twice with phosphate-buffered saline (PBS) before PE-conjugated Annexin V and 7-ADD were added, incubated for 30 min and analyzed by flow cytometry (Becton-Dickinson). As for Hoechst 33342 staining, cells were washed twice with PBS, and stained with 5 μl Hoechst 33342 for 30 min according to the manufacturer’s instructions (Beyotime). Stained nuclei were observed under a fluorescence microscope. The percentage of apoptotic cells, the apoptotic ratio (AR), was calculated using the formula: AR% = [apoptotic cells (A)/total cell count (T)] × l00. (Ten images from each sample were acquired and analyzed in three different experiments). All experiments were performed three times.

Detection of relevant apoptosis-related proteins

Western blotting was used to detect the expression of ART1, RhoA, ROCK1, NF-κB, Cox-2, caspase 3, PARP-1 and PARP-1 cleavaged fragments. Total and nuclear proteins in the above groups were extracted according to protein extraction protocols (Beyotime P0013 and P0028). Protein concentrations were determined using the BCA assay (Beyotime), and respective proteins (30 μg/lane) were loaded onto 6% polyacrylamide gel (PARP-1, ROCK1) or 10% polyacrylamide gel (ART1, RhoA, Cox-2, caspase 3 and NF-κB). Proteins were separated by electrophoresis, transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA) and blocked with 5% non-fat dry milk for 1 h at room temperature. Primary antibodies against ART1, PARP-1, NF-κB (Bioworld, St. Louis Park, MN, USA); RhoA, ROCK1, Cox-2, caspase 3 (Proteintech Group, Chicago, IL, USA); β-actin (Boster, Wuhan, China) were diluted to 1:500 and incubated at 4°C overnight. The next day, the membranes (37°C 30 min) were washed thoroughly 3 times for 10 min with Tris-buffered saline and Tween-20 (TBST). Secondary antibodies (peroxidase-conjugated goat or anti-rabbit IgG) (Boster) diluted to 1:1,000 were added and incubation was carried out for 2 h at 37°C, and washed thoroughly for 15 min with TBST. The bands were detected by enhanced chemiluminescence method (Beyotime).

To verify the relationship of ART1, PARP-1 and ROCK1, untransfected CT26 cells were treated with PARP-1 inhibitor 5-AIQ (100 μM) and ROCK inhibitor Y-27632 (20 μM) (23) for 24 h, respectively. Total protein was extracted and detected by western blotting. All experiments were repeated three times.

Data measurement and statistical analysis

Data are expressed as the means ± standard deviation (SD) in the quantitative experiments. Statistical analysis was performed by Student’s t-test or one-way ANOVA. Values of P<0.05 were considered to indicate statistically significant results.

Results

Transfection of lentiviral vector-mediated ART1-cDNA in CT26 cells

The ratio of lentiviral vector-mediated ART1-cDNA transfected in the CT26 cells was detected by fluorescence microscope and indicated that ~80% of CT26 cells were successfully transfected (Fig. 1A). Western blot assay and RT-PCR were used to identify the efficiency of the ART1-cDNA lentivirus transfection in the CT26 cells. The cells transfected with the lentiviral vector-mediated ART1-cDNA revealed an increase in ART1 expression when compared to the expression level in the ART1-shRNA, control-shRNA and untransfected CT26 cells (Fig. 1B and C; P<0.01 and P<0.05, respectively).

Figure 1

Lentiviral vector-mediated ART1-cDNA was successfully transfected into CT26 cells. (A) CT26 cells transfected with the lentiviral vector-mediated ART1-cDNA. The lentivirus (10 μl) was transfected into CT26 cells, and the efficiency was observed under an optical microscope (a) and a fluorescence microscope (b) after 72 h. (B) Expression level of ART1 protein in the ART1-cDNA CT26 cells as compared with the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells. (C) Expression of ART1 mRNA in the ART1-cDNA CT26 cells as compared with the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells (**P<0.01, *P<0.05). ART1, arginine-specific ADP-ribosyltransferase 1.

Effect of ART1 and PARP-1 on CT26 cell apoptosis induced by CDDP

Based on the flow cytometric analysis, the results showed that the apoptosis rate increased in each group of CT26 cells induced by CDDP, while the ART1-cDNA CT26 cells induced by CDDP had a lower apoptosis rate (16.39%), compared with the ART1-shRNA CT26 cells (80.03%), the untransfected CT26 cells (50.03%) and the control-shRNA CT26 cells (51.17%) treated in the same manner (Fig. 2A). The apoptosis rate of the ART1-cDNA CT26 cells treated with 5-AIQ and CDDP obviously increased (25.71%), compared to the ART1-cDNA CT26 cells treated with CDDP only (13.23%) and the untreated ART1-cDNA CT26 cells (4.56%) (P<0.05) (Fig. 2B).

Figure 2

PARP-1 is involved in the ART1-mediated CT26 cell apoptosis induced by CDDP. (A and C) ART1-cDNA CT26 cells were untreated (a1) or treated with CDDP (a2), compared with ART1-shRNA CT26 cells (b1 and b2), control-shRNA CT26 cells (c1 and c2) and untransfected CT26 cells (d1 and d2) treated in the same manner. a1–d1, untreated cells; a2–d2, cells treated with CDDP (30 μM) for 48 h. The apoptosis rate was detected by flow cytometric analysis and Hoechst 33342 staining. (B and D) ART1-cDNA CT26 cells were treated with 5-AIQ (100 μM) for 24 h and then CDDP (30 μM) for 48 h (c) or ART1-cDNA CT26 cells were treated with CDDP (30 μM) for 48 h only (b), or ART1-cDNA CT26 cells were untreated (c) and apoptosis was detected by flow cytometric analysis and Hoechst 33342 staining. Diagrams represent the average of three independent experiments. All experiment were performed three times (*P<0.05). (In A and B: UL, necrotic cells; LL, viable cells; LR, early apoptosis; UR, late apoptosis, in percentages %). PARP-1, poly(ADP-ribose) polymerase-1; ART1, arginine-specific ADP-ribosyltransferase 1; CDDP, cisplatin; 5-AIQ, 5-aminoisoquinoline.

The results of Hoechst 33342 staining showed that apoptotic bodies were significantly increased in each group of CT26 cells treated with CDDP. Moreover, after treatment with CDDP, the apoptosis rate in the ART1-cDNA CT26 cells declined (15.2%), compared with the ART1-shRNA CT26 cells (77.8%), the control-shRNA CT26 cells (37.5%) and the untransfected CT26 cells (35.8%) (Fig. 2C). ART1-cDNA CT26 cells treated with 5-AIQ and CDDP had a high apoptosis rate (25.3%), compared with the ART1-cDNA CT26 cells treated with CDDP only (14.03%) and the untreated ART1-cDNA CT26 cells (5.06%) (P<0.05) (Fig. 2D).

Influence of ART1 on the expression of RhoA, ROCK1, NF-κB, Cox-2, caspase 3, PARP-1 and PARP-1 cleavage fragments

Among the groups of cells treated with CDDP, the expression of RhoA, ROCK1, NF-κB, Cox-2 and PARP-1 was increased in the ART1-cDNA CT26 cells, when compared to these levels in the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells, while the expression of caspase 3 and PARP-1 cleavage fragment (p89) had an opposite trend. The expression of RhoA, ROCK1, NF-κB, Cox2 and PARP-1 had the same trend in cells not treated with CDDP, except for the PARP-1 cleavage fragment (p89) which was the cleavage substrate for activated caspase 3 which was noted in the CDDP-treated CT26 cells only (P<0.05, P<0.01) (Fig 3).

Figure 3

ART1 affects PARP-1, RhoA, ROCK1, NF-κB, Cox2 and caspase 3 expression in CT26 cells. (A) Expression of PARP-1 and its cleavage fragment (p89) in ART1-cDNA CT26 cells treated with or without CDDP (30 μM) for 48 h, compared with the expression level in the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells treated in the same manner. (B) The effect of ART1 on the expression of NF-κB in the ART1-cDNA CT26 cells treated with or without CDDP (30 μM) for 48 h, compared with the expression level in the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells treated in the same manner. (C and D) The effect of ART1 on the expression of RhoA, ROCK1, Cox-2, caspase 3 in the ART1-cDNA CT26 cells treated with or without CDDP (30 μM) for 48 h, compared with the expression levels in the ART1-shRNA CT26 cells, the control-shRNA CT26 cells and the untransfected CT26 cells treated in the same manner. All experiments were repeated three times (*P<0.05, **P<0.01). ART1, arginine-specific ADP-ribosyltransferase 1; PARP-1, poly(ADP-ribose) polymerase-1; ROCK, Rho kinase-associated coil-containing protein kinase; NF-κB, nuclear factor-κB; CDDP, cisplatin.

Influence of 5-AIQ and Y-27632 on the expression of ART1, ROCK1 and PARP-1 in the untransfected CT26 cells

The expression of ROCK1 and ART1 in the 5-AIQ treated untransfected CT26 cells exhibited no obvious changes when compared to the untreated untransfected CT26 cells. In the untransfected CT26 cells treated with Y-27632, the expression of PARP-1 was significantly decreased while the expression of ART1 exhibited no obvious change (P<0.05) (Fig. 4).

Figure 4

Relationship of ART1, ROCK1 and PARP-1 in untransfected CT26 cells. Untransfected CT26 cells were treated with 5-AIQ (100 μM) or Y-27632 (20 μM) for 24 h, respectively. Whole extracts were collected and subjected to western blot assay. (A) PARP-1 inhibitor 5-AIQ had no obvious effect on the expression of ROCK1 and ART1. (B) ROCK inhibitor inhibited the expression of PARP-1, while it had no significant influence on the expression of ART1 (*P<0.05). Both experiments were performed in triplicate. ART1, arginine-specific ADP-ribosyltransferase 1; ROCK, Rho kinase-associated coil-containing protein kinase; PARP-1, poly(ADP-ribose) polymerase-1.

Influence of PARP-1 inhibitor 5-AIQ on the expression of NF-κB, Cox-2 and caspase 3 in the ART1-cDNA CT26 cells

There was an obvious decreas in NF-κB and Cox-2 and an increase in caspase 3 in the ART1-cDNA CT26 cells treated with 5-AIQ and CDDP, when compared to the ART1-cDNA CT26 cells treated with CDDP only and the untreated ART1-cDNA CT26 cells (P<0.05) (Fig. 5).

Figure 5

PARP-1 inhibitor affects the expression of Cox-2, NF-κB and caspase 3 in ART1-cDNA CT26 cells. ART1-cDNA CT26 cells were treated with 5-AIQ (100 μM) for 24 h and then CDDP (30 μM) for 48 h or ART1-cDNA CT26 cells were treated with CDDP (30 μM) only for 48 h or ART1-cDNA CT26 cells were untreated as control. (A) Expression of Cox-2 was reduced while caspase 3 expression was increased in the ART1-cDNA CT26 cells treated with 5-AIQ and CDDP. (B) Expression of NF-κB in the nuclear extract was obviously decreased in the ART1-cDNA CT26 cells treated with 5-AIQ and CDDP (*P<0.05). All experiments were repeated thrice. PARP-1, poly(ADP-ribose) polymerase-1; NF-κB, nuclear factor-κB; ART1, arginine-specific ADP-ribosyltransferase 1; 5-AIQ, 5-aminoisoquinoline; CDDP, cisplatin.

Discussion

ADP-ribosylation reactions are currently topics of intense interest. A tremendous amount of research has been carried out to decipher the physiological and pathophysiological roles of ADP-ribosylation reactions at the molecular level. Many research groups with a wide range of expertise have become involved in mono-ADP-ribosylation or poly-ADP-ribosylation research (5). It has been determined that both ART1 and PARP-1 play important roles in reticular biological processes, and ART1 influences the expression of PARP-1 through NF-κB. However, despite the progress made in recent years in the biochemistry, molecular biology, physiology and pathophysiology of ADP-ribosylation, no unified image of the physiological and pathophysiological correlation of mono- and poly-ADP-ribosylation in the field of apoptosis has been noted (1). In the present study, the role of ART1 and PARP-1 in CDDP-induced CT26 cell apoptosis was studied. The results showed that a high level of ART1 expression decreased the apoptosis rate of CT26 cells induced by CDDP. Moreover, in the ART1-cDNA CT26 cells treated with 5-AIQ and CDDP an increase in the apoptosis rate was noted when compared with the ART1-cDNA CT26 cells treated with CDDP only and the untreated ART1-cDNA CT26 cells, which indicated that PARP-1 plays a role in the process of ART1-mediated apoptosis in CDDP-treated CT26 cells.

Several studies have shown that inhibition of the RhoA/ROCK pathway increases the apoptosis of human hepatocellular carcinoma cells (HCC) and endothelial cells through a mitochondrial apoptosis pathway (12,13). Benitah et al identified that ROCK is necessary for RhoA-induced expression of Cox-2 at the transcriptional level through the RhoA/ROCK/NF-κB/COX-2 signaling pathway (24), and the Cox-2-specific inhibitor celecoxib induced apoptosis through a mitochondrial pathway to suppress Akt phosphorylation, to release cytochrome c to the cytosol and to activate caspase 3 (25,26). Caspase 3 mediates highly specific proteolytic cleavage events in dying cells, which collectively manifest the apoptotic phenotype (27). Moreover, inhibition of Cox-2 was also shown to inhibit NF-κB by directly blocking the activity of IκB kinase; these feedback loops of the inhibition of Cox-2 mediated inactivation of NF-κB leading to a reconstituted sensitivity of cancer cells to apoptosis (28). Thus, RhoA/ROCK regulates apoptosis through an NF-κB/Cox2/caspase 3 pathway. Yau et al reported that the RhoA/ROCK pathways could be regulated by ADP-ribosyltransferase (10). However, the relationship of these factors with ART1 has not been reported in CDDP-induced colon carcinoma CT26 cell apoptosis. In the present study, we analyzed these factors, and the results showed that the expression of RhoA, ROCK1, NF-κB and Cox-2 was increased in the ART1-cDNA CT26 cells when treated with CDDP, while caspase 3 had the opposite trend. Thus, we conclude that ART1 probably regulates apoptosis through the RhoA/ROCK1/NF-κB/Cox2/caspase 3 pathway.

It has been demonstrated that PARP-1 acts as a co-activator of NF-κB, and the PARP-1 inhibitor decreases the expression of NF-κB and inhibition of NF-κB could decrease PARP-1 expression through a feedback manner (29–31); whereas inhibition of PARP-1 is thought to impair DNA repair function and promote cellular dysfunction and death (32). In models of acute stress, the PARP-1 inhibitor may protect cellular NAD pools and prevent NF-κB-dependent inflammatory signaling pathway. Research also found that PARP-1 inhibitor can trigger apoptosis in cancer cells and inhibit necrosis in normal cells and neurons through a mitochondrial pathway (33,34). Yau reported that mART could mediate the signal transduction from the cell surface to the nucleus (11). Our previous study showed that ART1 regulated the expression of PARP-1 probably through NF-κB, while PARP-1 inhibitor 5-AIQ had no effect on ART1 (20). In the present study, we also found that the expression of PARP-1 was decreased in the ART1-shRNA CT26 cells and was increased in the ART1-cDNA CT26 cells, which is accordance to the trend of NF-κB. From these findings we can conclude that ART1 affects the expression of PARP-1 probably through the regulation of NF-κB.

To clarify the relationship among ART1, ROCK1 and PARP-1, Y-27632 and 5-AIQ were used to treat the untransfected CT26 cells. Results showed that there was no obvious change in ROCK1 and ART1 in the 5-AIQ-treated untransfected CT26 cells, and the expression of PARP-1 in the Y-27632-treated untransfected CT26 cells was significantly decreased while the expression of ART1 had no obvious change. These results demonstrate that ROCK1 is in the downstream of ART1 while PARP-1 is regulated by ROCK1. To further verify the role of PARP-1 in ART1-mediated apoptosis in CT26 cells treated with CDDP, we used 5-AIQ to treat ART1-cDNA CT26 cells and determined the expression of NF-κB, Cox-2 and caspase 3. Results showed that there was an obvious decrease in NF-κB and Cox-2 and an increase in caspase 3 in the 5-AIQ-treated ART1-cDNA CT26 cells treated with CDDP, which demonstrated that PARP-1 is involved in CDDP-induced apoptosis in CT26 cells through the NF-κB/Cox-2/caspase 3 pathway.

Moreover, Li and Yuan reported that PARP-1 was one of the first identified substrates of caspase 3 (35). During apoptosis, activated caspase 3 cleaves PARP-1 into two fragments, p89 and p24, resulting in the inactivation of PARP-1. The cleavage fragments lead to the suppression of PARP-1 activity by inhibiting the homoassociation and DNA binding of intact PARP-1, respectively (36–38), preserving cellular energy for certain ATP-sensitive steps of apoptosis (39–41). In the present study, the results also showed that caspase 3 was activated and PARP-1 cleavage fragments formed when the cells were treated with CDDP. However, in the untreated cells, caspase 3 was inactivated for there were no PARP-1 cleavage fragments (p89) observed. Compared to the control groups, more PARP-1 cleavage fragments were formed in the ART1-shRNA CT26 cells treated with CDDP and less were formed in the ART1-cDNA CT26 cells treated with CDDP. These results suggest that ART1 activates caspase 3 which can cleave PARP-1 into p24 and p89 fragments when induced by CDDP, and this reaction leads to a decreased level and inactivation of PARP-1, ending in the promotion of CT26 cell apoptosis.

In brief, this investigation is an initial research on the synergistic effect of ART1 and PARP-1 on apoptosis induced by CDDP in murine colon carcinoma CT26 cells. The results showed that PARP-1 is in the downstream of ART1, and plays a role in ART1-mediated CT26 cell apoptosis through the ROCK1/NF-κB/PARP-1 pathway when induced by CDDP. In contrast, in CDDP-induced cells, activated caspase 3 cleaved PARP-1 and the decrease in PARP-1 in turn decreased the expression of NF-κB, and Cox-2 and increased caspase 3, resulting in the enhanced ability of ART1-mediated CT26 cell apoptosis. However, despite our findings, further study is needed to detect the detail mechanism.

Acknowledgements

This study was supported by the Ministry of Education Specialized Research Fund for the Doctoral Program of Higher Education (grant no. 20105503110009), and the Science and Technology Project of the Education Commission of Chongqing (grant no. KJ110322).

References

1 

Hassa PO, Haenni SS, Elser M and Hottiger MO: Nuclear ADP-ribosylation reactions in mammalian cells: where are we today and where are we going? Microbiol Mol Biol Rev. 70:789–829. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Otto H, Reche PA, Bazan F, Dittmar K, Haag F and Koch-Nolte F: In silico characterization of the family of PARP-like poly(ADP-ribosyl)transferases (pARTs). BMC Genomics. 6:1392005. View Article : Google Scholar

3 

Ueda K and Hayaishi O: ADP-ribosylation. Annu Rev Biochem. 54:73–100. 1985. View Article : Google Scholar

4 

Corda D and Di Girolamo M: Mono-ADP-ribosylation: a tool for modulating immune response and cell signaling. Sci STKE. 2002:pe532002.PubMed/NCBI

5 

Corda D and Di Girolamo M: Functional aspects of protein mono-ADP-ribosylation. EMBO J. 22:1953–1958. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Zhao Z, Gruszczynska-Biegala J and Zolkiewska A: ADP-ribosylation of integrin α7 modulates the binding of integrin α7β1 to laminin. Biochem J. 385:309–317. 2005.

7 

Okazaki IJ, Zolkiewska A, Nightingale MS and Moss J: Immunological and structural conservation of mammalian skeletal muscle glycosylphosphatidylinositol-linked ADP-ribosyltransferases. Biochemistry. 33:12828–12836. 1994. View Article : Google Scholar : PubMed/NCBI

8 

Zolkiewska A, Nightingale MS and Moss J: Molecular characterization of NAD:arginine ADP-ribosyltransferase from rabbit skeletal muscle. Proc Natl Acad Sci USA. 89:11352–11356. 1992. View Article : Google Scholar : PubMed/NCBI

9 

Paone G, Stevens LA, Levine RL, et al: ADP-ribosyltransferase-specific modification of human neutrophil peptide-1. J Biol Chem. 281:17054–17060. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Yau L, Litchie B, Thomas S, Storie B, Yurkova N and Zahradka P: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression. Eur J Biochem. 270:101–110. 2003. View Article : Google Scholar

11 

Gilcrease MZ: Integrin signaling in epithelial cells. Cancer Lett. 247:1–25. 2007. View Article : Google Scholar

12 

Takeba Y, Matsumoto N, Watanabe M, et al: The Rho kinase inhibitor fasudil is involved in p53-mediated apoptosis in human hepatocellular carcinoma cells. Cancer Chemother Pharmacol. 69:1545–1555. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Hippenstiel S, Schmeck B, N’Guessan PD, et al: Rho protein inactivation induced apoptosis of cultured human endothelial cells. Am J Physiol Lung Cell Mol Physiol. 283:L830–L838. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Kirkland JB: Poly ADP-ribose polymerase-1 and health. Exp Biol Med. 235:561–568. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Xu JX, Wang YL, Tang Y and Xiong W: Effect of ART1 gene silencing by RNA interference on the proliferation of mouse colon carcinoma cells and its possible mechanism. TUMOR. 32:949–954. 2012.

16 

Li Q, Li M, Wang YL, et al: RNA interference of PARG could inhibit the metastatic potency of colon carcinoma cells via PI3-kinase/Akt pathway. Cell Physiol Biochem. 29:361–372. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Fauzee NJ, Li Q, Wang YL and Pan J: Silencing poly (ADP-ribose) glycohydrolase (PARG) expression inhibits growth of human colon cancer cells in vitro via PI3K/Akt/NFκ-B pathway. Pathol Oncol Res. 18:191–199. 2012.PubMed/NCBI

18 

Fauzee NJ, Pan J and Wang YL: PARP and PARG inhibitors - new therapeutic targets in cancer treatment. Pathol Oncol Res. 16:469–478. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Ye K: PARP inhibitor tilts cell death from necrosis to apoptosis in cancer cells. Cancer Biol Ther. 7:942–944. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Tang Y, Wang YL, Yang L, et al: Inhibition of arginine ADP-ribosyltransferase 1 reduces the expression of poly(ADP-ribose) polymerase-1 in colon carcinoma. Int J Mol Med. 32:130–136. 2013.PubMed/NCBI

21 

Furuya K, Ozaki T, Hanamoto T, et al: Stabilization of p73 by nuclear IκB kinase-α mediates cisplatin-induced apoptosis. J Biol Chem. 282:18365–18378. 2007.

22 

Ohnishi K, Ota I, Takahashi A, Yane K, Matsumoto H and Ohnishi T: Transfection of mutant p53 gene depresses X-ray- or CDDP-induced apoptosis in a human squamous cell carcinoma of the head and neck. Apoptosis. 7:367–372. 2002. View Article : Google Scholar : PubMed/NCBI

23 

van Houdt WJ, Hoogwater FJ, de Bruijn MT, et al: Oncogenic KRAS desensitizes colorectal tumor cells to epidermal growth factor receptor inhibition and activation. Neoplasia. 12:443–452. 2010.PubMed/NCBI

24 

Benitah SA, Valerón PF and Lacal JC: ROCK and nuclear factor-κB-dependent activation of cyclooxygenase-2 by Rho GTPases: effects on tumor growth and therapeutic consequences. Mol Biol Cell. 14:3041–3054. 2003.

25 

Zhang Z, Lai GH and Sirica AE: Celecoxib-induced apoptosis in rat cholangiocarcinoma cells mediated by Akt inactivation and Bax translocation. Hepatology. 39:1028–1037. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Lax AJ and Thomas W: How bacteria could cause cancer: one step at a time. Trends Microbiol. 10:293–299. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Nicholson DW and Thornberry NA: Caspases: killer proteases. Trends Biochem Sci. 22:299–306. 1997. View Article : Google Scholar

28 

Yin MJ, Yamamoto Y and Gaynor RB: The anti-inflammatory agents aspirin and salicylate inhibit the activity of IκB kinase-β. Nature. 396:77–80. 1998.

29 

Cai L, Threadgill MD, Wang Y and Li M: Effect of poly (ADP-ribose) polymerase-1 inhibition on the proliferation of murine colon carcinoma CT26 cells. Pathol Oncol Res. 15:323–328. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Chiti F, Stefani M, Taddei N, Ramponi G and Dobson CM: Rationalization of the effects of mutations on peptide and protein aggregation rates. Nature. 424:805–808. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Hassa PO and Hottiger MO: The functional role of poly(ADP-ribose)polymerase 1 as novel coactivator of NF-κB in inflammatory disorders. Cell Mol Life Sci. 59:1534–1553. 2002.PubMed/NCBI

32 

Ratnam K and Low JA: Current development of clinical inhibitors of poly(ADP-ribose) polymerase in oncology. Clin Cancer Res. 13:1383–1388. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Jagtap P and Szabó C: Poly(ADP-ribose) polymerase and the therapeutic effects of its inhibitors. Nat Rev Drug Discov. 4:421–440. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Schreiber V, Dantzer F, Ame JC and De Murcia G: Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol. 7:517–528. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Li J and Yuan J: Caspases in apoptosis and beyond. Oncogene. 27:6194–6206. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Kim JW, Kim K, Kang K and Joe CO: Inhibition of homodimerization of poly(ADP-ribose) polymerase by its C-terminal cleavage products produced during apoptosis. J Biol Chem. 275:8121–8125. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Kim JW, Won J, Sohn S and Joe CO: DNA-binding activity of the N-terminal cleavage product of poly(ADP-ribose) polymerase is required for UV mediated apoptosis. J Cell Sci. 113:955–961. 2000.PubMed/NCBI

38 

D’Ambrosio SM, Gibson-D’Ambrosio RE, Brady T, Oberyszyn AS and Robertson FM: Mechanisms of nitric oxide-induced cytotoxicity in normal human hepatocytes. Environ Mol Mutagen. 37:46–54. 2001.PubMed/NCBI

39 

Chaitanya GV, Steven AJ and Babu PP: PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration. Cell Commun Signal. 8:312010. View Article : Google Scholar : PubMed/NCBI

40 

Soldani C and Scovassi A: Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis. 7:321–328. 2002. View Article : Google Scholar : PubMed/NCBI

41 

Virág L and Szabó C: The therapeutic potential of poly(ADP-ribose) polymerase inhibitors. Pharmacol Rev. 54:375–429. 2002.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kuang J, Wang Y, Xiao M, Tang Y, Chen WW, Song G, Yang X and Li M: Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells. Oncol Rep 31: 2335-2343, 2014.
APA
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G. ... Li, M. (2014). Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells. Oncology Reports, 31, 2335-2343. https://doi.org/10.3892/or.2014.3100
MLA
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G., Yang, X., Li, M."Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells". Oncology Reports 31.5 (2014): 2335-2343.
Chicago
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G., Yang, X., Li, M."Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells". Oncology Reports 31, no. 5 (2014): 2335-2343. https://doi.org/10.3892/or.2014.3100
Copy and paste a formatted citation
x
Spandidos Publications style
Kuang J, Wang Y, Xiao M, Tang Y, Chen WW, Song G, Yang X and Li M: Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells. Oncol Rep 31: 2335-2343, 2014.
APA
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G. ... Li, M. (2014). Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells. Oncology Reports, 31, 2335-2343. https://doi.org/10.3892/or.2014.3100
MLA
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G., Yang, X., Li, M."Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells". Oncology Reports 31.5 (2014): 2335-2343.
Chicago
Kuang, J., Wang, Y., Xiao, M., Tang, Y., Chen, W., Song, G., Yang, X., Li, M."Synergistic effect of arginine-specific ADP-ribosyltransferase 1 and poly(ADP-ribose) polymerase-1 on apoptosis induced by cisplatin in CT26 cells". Oncology Reports 31, no. 5 (2014): 2335-2343. https://doi.org/10.3892/or.2014.3100
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team