Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November-2014 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2014 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo

  • Authors:
    • Wei Zhang
    • Songyang Liu
    • Kai Liu
    • Bai  Ji
    • Yingchao Wang
    • Yahui Liu
  • View Affiliations / Copyright

    Affiliations: Department of Hepatobiliary and Pancreatic Surgery, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China
  • Pages: 1913-1922
    |
    Published online on: August 19, 2014
       https://doi.org/10.3892/or.2014.3418
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Sorafenib (SOR), a vascular endothelial growth factor receptor (VEGFR) inhibitor, is in wide clinical use for the treatment and prevention of liver cancer. However, extended SOR administration for hepatocellular carcinoma (HCC) induces drug resistance thereby limiting its efficacy and highlighting the need for improved therapeutic strategies. It has previously been demonstrated that knockout of a disintegrin and metalloproteinase 10 (ADAM10) via siRNA induced cancer apoptosis and decreased chemotherapy drug resistance. However, whether knockout of ADAM10 is able to decrease SOR resistance remains to be determined. Therefore, in the present study, the effect of siRNA-ADAM10 in combination with SOR was analyzed in HCC cell lines (HepG2) by inhibiting tumor growth and simultaneously reducing doses of SOR. Cell proliferation, apoptosis, migration, invasion and involvement in receptor signaling were determined after siRNA-ADAM10 was applied in combination with SOR treatment. Tumor growth ability in nude mice was also detected. The results showed that siRNA-ADAM10 in combination with SOR treatment in HCC cancer cells significantly suppressed proliferation, migration and invasion, and induced tumor apoptosis in vitro, and suppressed tumor growth in vivo. In addition, the results showed that knockout of ADAM10 by siRNA inhibited the constitutive phosphorylation of PI3K and AKT, which may contribute to the reduction of SOR resistance. Collectively, our experimental results indicate that knockout of ADAM10 by siRNA increased the SOR antitumor activity of liver cancer in vitro and in vivo, and that this additive combination is a promising drug candidate for treatment of HCC.

Introduction

Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third most frequent cause of cancer-related mortality globally, affecting >600,000 individuals annually (1,2). Although there have been developments in surgical strategies and percutaneous techniques such as ethanol injection and radiofrequency ablation and transcatheter arterial chemoembolization (TACE), the overall outcome for HCC patients remains poor as HCC is commonly detected at a late stage when therapeutic options are limited (3). Conventional cytotoxic therapies may result in significant morbidity in patients with solid tumors including HCC since these drugs affect rapidly dividing normal and malignant cells, thereby limiting the survival of normal cells (4). Therefore, it is necessary to improve anticancer therapies that effectively and specifically target liver tumor cells while minimizing the toxic side-effects commonly associated with conventional cytotoxic therapies.

Sorafenib (SOR) (Nexavar, BAY 43-9006), an oral multikinase small molecule inhibitor, has been shown to have significant antitumor activity against various types of cancer including HCC (5–7). SOR blocks tumor cell proliferation and angiogenesis by targeting the Raf/mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling pathway and receptor tyrosine kinases (RTKs), such as vascular endothelial cell growth factor receptor (VEGFR)-2, VEGFR-3, platelet-derived growth factor receptor-β, fms-like tyrosine kinase receptor-3 (FLT3), RET and c-KIT (5,6). The results of phase III trials in Europe and Asia showed that SOR increased the survival rate in patients with advanced HCC (8,9). Although results of SOR for patients with advanced HCC are encouraging, treatment outcomes are poor due to unfavorable pharmacokinetics, low tumor accumulation and other adverse effects (10). Several studies have demonstrated that combination therapies of SOR and TRAIL or other chemotherapeutic agent are effective for HCC (11–18). However, chemotherapeutic drug resistance often occurs and the management of multi-drug resistant and recurrent or refractory tumors pose a challenge for clinical oncologists.

A class of disintegrins and metalloproteinases, known as ADAMs, has been shown to be involved in a variety of signaling events that are aberrant in cancers as well as during tumor progression (19). A disintegrin and metalloproteinase 10 (ADAM10), a member of the ADAM family, has been found to be upregulated in various types of cancer and contributes to cancer progression and metastasis (20,21). Consistent with these findings, our recent results showed that ADAM10 is overexpressed in HCC tissues and there were significant associations between the protein levels of ADAM10 and tumor grade, amount of tumor differentiation, tumor size and the presence of metastasis (22). In addition, the RNA interference (RNAi)-mediated downregulation of endogenous ADAM10 was found to decrease the cell migration and invasion of HCC (23). Yang et al found that ADAM10 plays an important role in modulating the chemosensitivity of HCC cells to doxorubicin (24). Findings of that study suggested that ADAM10 is involved in HCC progression and metastasis and is important in modulating the chemosensitivity of HCC. However, little is known regarding the role of ADAM10 in the modulation of chemosensitivity of HCC cells to SOR. Thus, in the present study, we investigated the effects of modulating ADAM10 expression on the sensitivity of HCC cells to SOR treatment and examined the molecular pathways involved. In addition, tumor growth ability in nude mice was detected to define SOR in combination with the siRNA-ADAM10 treatment effect on tumorigenesis in vivo.

Materials and methods

Reagents

SOR (BAY 43-9006; Nexavar, LC Laboratories, Woburn, MA, USA) was dissolved in sterile dimethyl sulfoxide (DMSO; Sigma, St. Louis, MO, USA) for the in vitro experiments. DMSO was added to cultures at 0.1% (v/v) final concentration as a vehicle control. PI3K and phosphorylated PI3K (p-PI3K; Tyr458); Akt and phosphorylated Akt (p-Akt; S473) primary antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ADAM10, MMP-2 and MMP-9 were purchased from Sigma-Aldrich (St. Louis, MO, USA). The HRP-conjugated goat anti-mouse IgG secondary antibody was obtained from Amersham Biosciences (Uppsala, Sweden).

Cell culture

The human HCC cell lines, HepG2, was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich) supplemented with 1% penicillin/streptomycin (Gibco-BRL, Grand Island, NY, USA) and 10% heat-inactivated fetal calf serum (FCS) (Invitrogen, Carlsbad, CA, USA).

Preparation of plasmid-based ADAM10 shRNA vector and transfect in HepG2

The ADAM10 small-interfering RNA (siRNA) (CAGTGTGCATTCAAGTCAA) and scrambled control (AATTCTCCGAACGTGTCACGT) sequences, which do not target any gene product or have any significant sequence similar to the human gene sequences, were designed using siRNA Target Designer software (Promega, Madison, WI, USA). The human ADAM10 and scrambled control short hairpin RNA (shRNA) were synthesized (Shanghai GeneChem Co., Ltd., China) and cloned into the pSUPER siRNA expression plasmid with the U6 promoter (Oligoengine, Seattle, WA, USA) as previously described (25) and designated as psi-ADAM10 and psi-Scramble, respectively.

HepG2 cells were transduced with the plasmid psi-ADAM10 and psi-Scramble using Lipofectamine™ 2000 transfection reagent according to the manufacturer’s instructions. G418 (300 μg/ml; Sigma) was used to screen stably transfected clones. The expression of ADAM10 was examined by quantitative RT-PCR (RT-qPCR) and western blotting with an antibody against ADAM10 to validate the silencing efficiency of the target gene after RNAi.

Quantitative RT-PCR

RT-qPCR for ADAM10 transcripts in HepG2 cells was performed. First, total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA was subsequently reverse-transcribed into cDNA by a PrimeScript™ RT reagent kit according to the manufacturer’s instructions (Takara, Dalian, China). RT-qPCR was conducted using the SYBR-Green fluorescent dye method, and a Rotor Gene 3000 real-time PCR apparatus. ADAM10 gene-specific amplification was confirmed by PCR with specific primers (sense, 5′-CTGCCCAGCATCTGACCCTAA-3′ and antisense, 5′-TTGCCATCAGAACTGGCACAC-3′) and subjected to melting curve analysis. GAPDH was used as an internal control for standardization. The primer sequences used were: β-actin, forward: 5′-GATCATTGCTCCTCCTGAGC-3′ and reverse: 5′-ACTCCTGCTTGCTGATCCAC-3′. The PCR conditions were as follows: pre-denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 10 sec, and annealing/extension at 55°C for 20 sec. All the RT-qPCR tests were performed in triplicate and after the third day of plasmid transfections. The data were analyzed using the comparative Ct method.

Western blotting

The cells were collected and homogenized in a lysis buffer (Tris-HCl 50 mmol/l, EDTA 5 mmol/l, NaCl 150 mmol/l, sodium deoxycholate 1%, Na3VO4 500 μmol/l, Triton X-100 0.5%, AEBSF 10 μmol/l, NaF 10 mmol/l) on ice for 30 min. Cell lysates were clarified by centrifugation (10,000 × g, 15 min), and protein concentrations were determined using the Bradford reagent (Sigma-Aldrich, Taufkirchen, Germany). Equal amounts of protein (15 μg/lane) from the cell lysates were separated on an 8–15% SDS-polyacrylamide gel (SDS-PAGE) and transferred onto nitrocellulose membranes (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The membrane was incubated for 2 h in phosphate-buffered saline (PBS) plus 0.1% Tween-20 and 5% non-fat skim milk to block non-specific binding. The membranes were then incubated overnight at 4°C with primary antibodies. After washing, the proteins were visualized using an ECL detection kit with the appropriate HRP-conjugated secondary antibody (Amersham Pharmacia Biotech, Piscataway, NJ, USA) for 2 h. All the assays were performed after the third day of drug treatment.

Cell proliferation assay

The MTT assay was used to determine for cell proliferation. Briefly, the cells were seeded in 8- of 96-well plates at a density of 2×103 cells/well. After being cultured for 24 h, the cells were treated with psi-ADAM10, psi-Scramble, SOR or psi-ADAM10 in combination with SOR, respectively. At 48 h after treatment, 20 μl of MTT (5 mg/ml; Sigma) was added to each well followed by incubation at 37°C for 48 h. Centrifugation was then performed at 2,000 × g for 10 min. The supernatant was removed, and 200 μl of DMSO was added to each well followed by agitation for 10 min. The absorbance was measured using a microplate reader at a wavelength of 490 nm. The experiment was repeated three times. The inhibition rate was calculated according to the formula: Inhibition rate (%) = [1-(average absorbance of experimental group/average absorbance of blank control group)] × 100%. The mean proliferation of cells without any treatment was expressed as 100%.

Colony formation assay

HepG2 cells were seeded in 6-well culture plates at 1×104 cells/well, and were treated with specific drugs when cells reached the logarithmic growth phase. After the cells were incubated at 37°C for 10 days, and the medium was replaced every 3 days. After washing three times with PBS, the colonies were fixed with ice methanol for 30 min and stained with Giemsa for 10 min. The visible colonies were then counted.

TUNEL assay

To measure the effect of psi-AMAD10 in combination with SOR on cell apoptosis, a TUNEL assay was carried out. Briefly, after HepG2 cells were treated with psi-ADAM10, psi-Scramble, SOR or psi-ADAM10 in combination with SOR for 24 h, cellular DNA fragmentation was measured with the ApoTag Red In Situ Apoptosis Detection kit (Chemicon International, Temecula, CA, USA) according to the manufacturer’s instructions. To quantify the apoptotic cells, the terminal deoxynucleotidyl transferase-mediated nick end-labeling (TUNEL)-positive cells were counted using confocal microscopy.

In addition, at the molecular level, we detected apoptosis related to protein, survivin and Bcl-2 protein expression by western blotting as an additional indicator of apoptosis.

Caspase-8 activity assay

HepG2 cells were collected and lysed in lysis buffer (10 mM Tris-HCl, pH 7.5, 130 mM NaCl, 1% Triton X-100 and 10 mM sodium pyrophosphate) following specific treatment. Cell lysates were clarified by centrifugation at 14,000 × g for 5 min at 4°C and clear lysates containing 50 μg of protein were incubated with 100 μM of enzyme-specific substrate (Ac-IEVD-pNA for caspase-8) in assay buffer (50 mM Tris-HCl, pH 7.4, 1 mM EDTA and 10 mM EGTA) at 37°C for 1 h. Caspase-8 activity was determined by the cleavage of colorimetric substrate monitored at 405 nm.

Wound-healing assay

To assess the effect of psi-ADAM10 in combination with SOR psi-ADAM10 on cell migration, a wound-healing assay was performed. Briefly, 1×105 HepG2 cells were plated in 12-well plates in DMEM containing 10% fetal bovine serum (FBS). After 24 h, a scratch was made through the confluent cell monolayer, and the cells were treated with psi-ADAM10, psi-Scramble, SOR or psi-ADAM10 in combination with SOR, respectively, in 3 ml of complete medium. After 48 h treatment, the cells were stained with hematoxylin and eosin (H&E). Cells invading the wound line were observed under an inverted phase-contrast microscope using ×20, Leica DMR, Germany. Experiments were performed in triplicate.

Transwell invasion assay

Cell invasion was determined using Transwell chambers produced from polycarbonate membrane filters with a pore size of 8-μm according to the manufacturer’s instructions (Costar, USA) and the upper chambers were coated with Matrigel (BD Biosciences, USA). The cells were transferred to the upper chamber of each prepared Transwell chamber at a density of 4×105 cells/ml (100 μl) and treated with psi-ADAM10, psi-Scramble, SOR or psi-ADAM10 in combination with SOR, respectively. The lower chamber contained DMEM supplemented with 10% FBS. The cells were allowed to migrate for 24 h at 37°C. Non-invading cells were removed from the top surfaces with a cotton swab. The membranes were fixed in 95% ethanol and stained with 0.1% crystal violet. The cells that had penetrated to the bottom surface of each membrane were counted with 10 random fields on each microscope slide. In addition, cells were quantified by measuring the absorbance of dye extracts at 570 nm in 100 ml of Sorenson’s solution (9 mg trisodium citrate, 305 ml distilled water, 195 ml 0.1 N HCl, and 500 ml 90% ethanol). Experiments were performed in triplicate.

Tumor xenograft assay

Fifty female BALB nude mice aged 4–6 weeks and weighing 18–20 g, were purchased from the Institute of Laboratory Animal Science, Jilin University (Changchun, Jilin, China), and were maintained under specific pathogen-free (SPF) conditions and provided with food and water ad libitum. The animal experiments were carried out according to the standards of animal care as outlined in the Guide for the Care and Use of Experimental Animals of Jilin University. The study protocol was approved by the Ethics Committee, The First Hospital of Jilin University.

Exponentially growing HepG2 cells were harvested and a tumorigenic dose of 2×106 cells was injected intraperitoneally into the BALB mice. Approximately 20 days after the inoculation of HepG2 cells, the average tumor volume was at 120.28±8.23 mm3, and the mice were divided randomly into 5 groups (10 mice/group). The control group received 1% polysorbate resuspended in deionized water. The remaining four groups were treated with psi-Scramble (30 μg/50 μl/mouse), SOR (80 mg/kg body weight), psi-ADAM10 (30 μg/50 μl/mouse) or SOR plus psi-ADAM10 (SOR, 40 mg/kg body weight; psi-ADAM10; 15 μg/50 μl/mouse) intraperitoneally on alternative days for 3 weeks. The tumor size was measured using calipers prior to administration of the treatment injections and on the 7th, 14th and 21st days of treatment. On the 21st day, the animals were sacrificed using chloroform and their spleen tissue was collected and cultured for a splenocyte surveillance study as previously described (26). Sections of each tumor tissue were wax-embedded for H&E staining to study cell apoptosis in vivo by TUNEL.

Statistical analysis

Data are presented as means ± SD. A statistical comparison of more than two groups was performed using one-way ANOVA followed by a Tukey’s post-hoc test. Statistical analyses were undertaken using the GraphPad Prism version 5.01 (GraphPad Software, San Diego, CA, USA) for Windows®. P<0.05 was considered to indicate a statistically significant result. The images shown in the present study were obtained from at least three independent experiments with similar results.

Results

Downregulation of ADAM10 expression by plasmid psi-ADAM10

To silence ADAM10 expression, we constructed a recombinant plasmid-based shRNA against ADAM10, psi-Scramble. Subsequently, we assessed the silencing ability of psi-ADAM10 in the HCC cell line by RT-qPCR and western blotting following the treatment of HepG2 cells with plasmid psi-ADAM10 for three days. RT-qPCR results showed no significant inhibition in ADAM10 mRNA expression in the control and psi-Scramble groups. Compared to the psi-Scramble and control groups, mRNA expression in the psi-ADAM10 group was significantly decreased (Fig. 1A, P<0.01). On the protein level, no significant inhibition in ADAM10 protein expression was found in the psi-Scramble and control groups (P>0.05), while the band density markedly decreased in the psi-ADAM10 group as compared with the psi-Scramble and control groups (P<0.01) (Fig. 1B). These results demonstrated that silencing ADAM10 significantly decreased ADAM10 expression in the HCC cell line.

Figure 1

Silencing ADAM10 inhibits ADAM10 expression in HepG2 tumor cells. (A) ADAM10 mRNA expression was determined by quantitative PCR (RT-qPCR) 72 h after transfection of plasmid psi-ADAM10. (B) Western blot analysis and RT-qPCR of ADAM10 protein expression 72 h after the transfection of plasmid psi-ADAM10. *P<0.05 vs. control. ADAM10, a disintegrin and metalloproteinases 10.

Effects of SOR and psi-ADAM10 alone or in combination on HepG2 cell proliferation and cell colony formation

To evaluate the effect of psi-ADAM10 and SOR alone or their combination on the viability of HCC cells in vitro, an MTT assay was performed for 48 h when HepG2 cells were treated with psi-ADAM10 and SOR alone or both. It was found that the inhibitory rates of psi-ADAM10 and SOR alone or the combination treatment were higher than those of the control and psi-Scramble groups (P<0.01, Fig. 2A). No significant difference between the psi-Scramble and control groups was observed (P>0.05, Fig. 2A). In addition, the inhibitory rates of psi-ADAM10 in combination with the SOR group were higher than the single treatment group (P<0.05, Fig. 2A).

Figure 2

Effect of SOR and psi-ADAM10 alone and in combination on cell proliferation and clone formation. (A) Cell proliferation and (B) cell clone formation of HepG2 cells were determined following treatment with SOR and psi-ADAM10 alone or in combination.*P<0.05 vs. control, #P<0.05 vs. SOR alone. SOR, sorafenib; ADAM10, a disintegrin and metalloproteinases 10.

The effects of psi-ADAM10 and SOR alone or in combination on the HepG2 cell colony formation were then analyzed. Compared with the control and psi-Scramble groups, the number of tumor cells per colony were significantly reduced in psi-ADAM10 and SOR alone or the combination groups (P<0.01, Fig. 2B). The psi-Scramble in combination with SOR resulted in an even greater percentage of reduction than the higher doses of either drug alone (P<0.01, Fig. 2B).

Effects of SOR and psi-ADAM10 alone or in combination on HepG2 cell apoptosis

To investigate whether the psi-ADAM10 and SOR alone or in combination induced apoptosis, the apoptosis was analyzed after treatment with the specific drug. It was found that HepG2 cells treated with psi-ADAM10 and SOR alone or in combination significantly induced cell apoptosis compared with the control and psi-Scramble groups (Fig. 3A). Treatment with the combination of psi-ADAM10 and SOR resulted in a marked increase in apoptotic cells compare to the single drug treatment group (P<0.01) (Fig. 3A).

Figure 3

Effect of SOR and psi-ADAM10 alone and in combination on cell apoptosis in HepG2 cells. (A) Apoptosis of HepG2 cells was determined following treatment with SOR and psi-ADAM10 alone or in combination. (B) Caspase-8 activity was determined following treatment with SOR and psi-ADAM10 alone or in combination. (C and D) Expression of survivin and BCl-2 in HepG2 cells was determined by western blotting. Data are presented as the means ± SD. *P<0.05 vs. control, #P<0.05 vs. SOR alone. SOR, sorafenib; ADAM10, a disintegrin and metalloproteinases 10.

To determine the possible mechanism of induction of cell apoptosis of the combination with psi-ADAM10 and SOR, caspase-8 activity was detected using ELISA. The results showed that caspase-8 activity was significantly increased in psi-ADAM10 and SOR alone or in the combination treatment groups compared to the control and psi-Scramble groups (P<0.05; Fig. 3B). Compared to the psi-ADAM10 and SOR groups, the combination treatment significantly increased caspase-8 activity (P<0.05; Fig. 3B). In addition, expression patterns of survivin and Bcl-2 were determined by western blotting. The results showed that the combination with psi-ADAM10 and SOR significantly decreased the expression of apoptosis inhibiting gene survivin and Bcl-2 in HepG2 cells compared to the single drug treatment, and control and psi-Scramble groups (Fig. 3C and D, P<0.05).

Effects of SOR and psi-ADAM10 alone or in combination on HepG2 cell migration and invasion

To ascertain the inhibitory effect of psi-ADAM10 and SOR alone or in combination on HCC cell motility in vitro, a wound-healing assay was performed. As shown in Fig. 4A, cell migration in the psi-ADAM10 and SOR alone or the combination groups was significantly reduced compared to the control and psi-Scramble groups when HepG2 cells were treated with the indicated drug treatment for 48 h (P<0.05). In addition, compared to the SOR and psi-ADAM10 groups, migration was significantly reduced in SOR in combination with the psi-ADAM10 group.

Figure 4

Effect of SOR and psi-ADAM10 alone and in combination on cell migration and invasion in HepG2 cells. (A) Cell migration was determined 48 h following treatment with SOR and psi-ADAM10 alone or in combination. (B) SOR and psi-ADAM10 alone or combination effect of HepG2 cell invasion through Matrigel. (C and D) Expression of MMP-2 and MMP-9 in HepG2 cells was determined by western blotting. Data are presented as the means ± SD. *P<0.05 vs. control, #P<0.05 vs. SOR alone. SOR, sorafenib; ADAM10, a disintegrin and metalloproteinases 10.

To determine whether psi-ADAM10 and SOR alone or their combination affected the invasiveness of human HCC HepG2 cells, the cells were treated with the indicated drug for 48 h. As shown in Fig. 4B, the result of the cell invasiveness assay showed that there was no significant difference in the number of cells that had passed through the simulated basement membrane between the control and psi-Scramble groups. However, the number of cells that had passed through the simulated basement membrane in the psi-ADAM10 and SOR alone or combination group were significantly reduced when compared with the control and psi-Scramble groups (all P<0.05). Compared to the single treatment group, the cell invasion number was significantly reduced (P<0.05, Fig. 4B).

To determine the potential mechanism of SOR in combination with psi-ADAM10 inhibition of cell invasion in vitro, the MMP-2 and MMP-9 protein expression was determined by western blot analysis. Western blot analysis revealed a significant decrease in MMP-2 and MMP-9 proteins in the psi-ADAM10 and SOR alone or in the combination group compared to the control and psi-Scramble groups alone (P<0.05, Fig. 4C and D). Compared to the single treatment group, psi-ADAM10 in combination with the SOR group decreased the protein expression of MMP-2 and MMP-9 (P<0.05, Fig. 4C and D).

ADAM10 silencing sensitizes HCC cells to SOR treatment

To determine whether the downregulation of ADAM10 by siRNA affected the sensitivity of HCC cells to SOR, we stably transfected plasmid psi-ADAM10 and psi-Scramble into HepG2 cells, respectively, and then added SOR (20 μM) to HepG2 for further treatment. After 48 h, cell proliferation and apoptosis were determined. The results of the MTT assay showed that silencing ADAM10 significantly inhibited cell proliferation in the presence of SOR compared to the control and psi-Scramble groups in the presence of SOR (Fig. 5A). In addition, silencing of ADAM10 significantly induced cell apoptosis in the presence of SOR (Fig. 5B). Consistent with the increased apoptosis, the amount of cleaved caspase-8 was profoundly elevated in ADAM10-silenced HCC cells in the presence of SOR (Fig. 5C). Moreover, ADAM10-deficient cells exhibited a reduced expression of the anti-apoptotic factor survivin and Bcl-2 (Fig. 5D).

Figure 5

Downregulation of endogenous ADAM10 sensitizes HCC cells to sorafenib. (A) Cell proliferation and (B) apoptosis were measured 48 h after sorafenib was added to HepG2 cells transfected with psi-scrambled or psi-ADMA10. (C) Caspase-8 activity was determined after sorafenib was added to HepG2 cells transfected with psi-scrambled or psi-ADMA10. (D) Expression of survivin and BCl-2 in HepG2 cells was determined after sorafenib was added to HepG2 cells transfected with psi-scrambled or psi-ADMA10. Data are expressed as the means ± SD. *P<0.05 vs. SOR alone. ADAM10, a disintegrin and metalloproteinases 10; SOR, sorafenib.

PI3K/Akt pathway is involved in ADAM10-mediated chemoresistance to SOR

The PI3K/Akt pathway plays an important role in regulating the chemoresistance of cancer cells (27–29). We examined whether this signaling pathway mediated ADAM10-dependent chemoresistance in HCC cells. Measurements of the phosphorylation/activation pattern of PI3K and Akt was performed by western blotting. Our results showed that the downregulation of ADAM10 expression in HepG2 cells resulted in a marked reduction of phosphorylated PI3K and Akt relative to mock cells, without altering the total protein levels of PI3K or Akt in the presence of SOR (Fig. 6).

Figure 6

Measurements of the phosphorylation/activation pattern of PI3K and Akt was performed by western blotting. Downregulation of ADAM10 by RNAi expression in HepG2 cells resulted in a marked reduction of phosphorylated PI3K and Akt relative to mock cells, without altering the total protein levels of PI3K or Akt in the presence of SOR. ADAM10, a disintegrin and metalloproteinases 10; SOR, sorafenib.

Effects of SOR and psi-ADAM10 alone or in combination on tumor growth in a murine model

The in vivo therapeutic efficacy of psi-ADAM10 and SOR alone or their combination on female BALB mice-bearing HepG2 tumor cells was assessed. The results showed that the tumor weight of psi-ADAM10 and SOR alone or the combination group was lower than that of the control and psi-Scramble groups (P<0.05, Fig. 7A). Compared with the results with either agent alone, the combination of psi-ADAM10 and SOR greatly inhibited tumor growth (Fig. 7A). In addition, we found that tumor volume after treatment with psi-ADAM10 and SOR was significantly reduced for the HepG2 tumor cells compared with the control and psi-Scramble groups at different time points (P<0.05, Fig. 7B). Treatment with the combination of psi-ADAM10 and SOR resulted in marked inhibition of the tumor volume compared to the psi-ADAM10 and SOR groups alone (P<0.05, Fig. 7B).

Figure 7

Antitumor activity of SOR and psi-ADAM10 alone or in combination in BALB/c mice bearing HepG2 cells. (A) Tumor weight in treated and untreated mice for 21 days. (B) The tumor volume in treated and untreated mice at the 7th, 14th and 21st days. (C) MTT assay of proliferation of splenocytes from mice. (D) TUNEL assay of cell apoptosis in vivo. Data are presented as the means ± SD. *P<0.05 vs. control, #P<0.05 vs. SOR alone. SOR, sorafenib; ADAM10, a disintegrin and metalloproteinases 10.

To assess the efficacy of psi-ADAM10 and SOR alone or combination in modulating splenocyte proliferation, MTT assay were performed. As shown in Fig. 7C, the inhibitory rates of psi-ADAM10 and SOR alone or the combination group were higher than those of the control and psi-Scramble groups (P<0.05). Treatment with the combination of psi-ADAM10 and SOR led to marked inhibition of cell proliferation compared to the psi-ADAM10 and SOR groups alone. In addition, we determined tumor tissue cell apoptosis in vivo by TUNEL. The results showed that psi-ADAM10 and SOR alone or the combination group significantly induced cell apoptosis compared to the control and psi-Scramble groups (P<0.05, Fig. 7D). Compared with the results with either agent alone, the combination of psi-ADAM10 and SOR greatly induced tumor cell apoptosis in vivo. These results demonstrated that the combination of psi-ADAM10 and SOR suppressed the tumor growth of HCC in vivo.

Discussion

Sorafenib (SOR) is currently the standard of care for hepatocellular carcinoma (HCC) patients with preserved liver function who have metastatic or unresectable disease not amenable to liver transplantation (30). In two randomized controlled phase III trials, SOR significantly improved overall survival (OS) and time to progression compared with patients administered a placebo. However, the median OS in the SOR arms of the two studies was moderately increased (8,9). As a result, there is a need for new and effective HCC treatments to improve patient outcome.

It has been reported that ADAM is involved in various cell processes such as proliferation, differentiation, migration and invasion (31,32). A large number of studies suggest that ADAMs is important in cancer cell survival (20–24,31,32). ADAM10, a member of the ADAM family, has been shown to be upregulated in various types of cancer including HCC (22). Accumulating evidence have demonstrated that ADAM10 is involved in cancer cell progression and metastasis (21–23,31–35). For example, Klein et al (31) reported that ADAM10 can activate Notch signaling by suppressing ectodomain shedding of δ-1, which subsequently leads to a strong inhibitory effect on tumor cell proliferation and apoptosis (33). Endres et al showed that ADAM10 can cleave collagen type IV in the basement membrane, which is relevant to tumor metastasis and proliferation (34). In addition, it has been shown that the combined therapy with shRNA combination anticancer drug may achieve better antitumor activity (35). The study by Emdad et al demonstrated that when melanoma differentiation-associated gene-7 (mda-7) through a replication-incompetent adenovirus (Ad.mda-7) and gefitinib are used in combination, they may provide an effective therapeutic approach for non-small cell lung cancer (NSCLC) since these agents target various cell survival pathways and are equally effective against NSCLC cells (36). Lu et al showed that lentivirus-carrying COX-2 gene combination with tamoxifen (TAM) in breast cancer cells significantly suppressed tumor growth in vitro and in vivo (26). Consistent with the abovementioned results, results of this study show that plasmid psi-ADAM10 in combination with SOR treatment in HCC cancer cells significantly suppressed proliferation, migration and invasion, and induced tumor apoptosis in vitro and suppressed tumor growth in vivo.

Resistance to chemotherapy poses a challenge for the successful treatment of HCC patients. It has been reported that ADAM10 decreases resistance to chemotherapeutic drugs (24,37). Yang et al demonstrated that ADAM10 plays an important role in modulating the chemosensitivity of HCC cells to doxorubicin (24). Bai et al found that the expression of microRNA-122, as a negative regulator of ADAM10, sensitizes HCC cells to SOR against HCC (37). Consistent with their results, results of the present study have shown that ADAM10 was involved in the modulation of the chemosensitivity of HCC cells to SOR against HCC and that the downregulation ADAM10 by siRNA sensitizes HCC cells to SOR against HCC.

The mediation of drug resistance depends on cellular changes, such as increased repair of DNA damage, alterations in the cell cycle and/or reduction of apoptosis by the activation of anti-apoptotic pathways (38). In this regard, activation of the PI3K/AKT pathway is an important requirement of cancer cells in order to escape cell death following exposure to toxic stimuli. It has been shown that the phosphorylation of AKT was significantly higher among patients who received chemotherapy and this increase was associated with poor prognosis in various types of cancer including HCC (39). Furthermore, accumulating evidence has demonstrated that the activated PI3K/AKT signalling cascade which promotes resistance against several chemotherapeutic drugs was identified in various cell culture model systems including the HCC cell line (24,40–42). In the present study, the results have shown that ADAM10 is important in modulating the chemosensitivity of HCC cells to SOR against HCC, which, at least partially, involves the activation of the PI3K/Akt pathway, a finding that is consistent with results of a previous study (24).

In conclusion, our in vitro studies have demonstrated that when plasmid psi-ADAM10 and SOR are used in combination they may provide an effective therapeutic approach for HCC since this combination may significantly suppress proliferation, migration and invasion and induce tumor apoptosis in vitro. Additionally, studies with in vivo murine models confirmed that psi-ADAM10 combination with SOR may suppress HCC tumor growth. Therefore, it is of note to consider their combination as a novel therapeutic strategy for further evaluation in clinical trials for the treatment of HCC.

Acknowledgements

This study was supported by the Science and Technology Research and Innovation Team Fund of Jilin province (JL2011038).

References

1 

Venook AP, Papandreou C, Furuse J and de Guevara LL: The incidence and epidemiology of hepatocellular carcinoma: a global and regional perspective. Oncologist. 15(Suppl 4): 5–13. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar

3 

Thorgeirsson SS and Grisham JW: Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 31:339–346. 2002. View Article : Google Scholar : PubMed/NCBI

4 

El-Serag HB and Rudolph KL: Hepatocellular carcinoma: epidemiology and molecular carcinogenesis. Gastroenterology. 132:2557–2576. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Wilhelm SM, Carter C, Tang L, et al: BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res. 64:7099–7109. 2004. View Article : Google Scholar

6 

Liu L, Cao Y, Chen C, et al: Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer Res. 66:11851–11858. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Gu FM, Li QL, Gao Q, et al: Sorafenib inhibits growth and metastasis of hepatocellular carcinoma by blocking STAT3. World J Gastroenterol. 17:3922–3932. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Llovet JM, Ricci S, Mazzaferro V, et al: Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 359:378–390. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Cheng AL, Kang YK, Chen Z, et al: Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase III randomised, double-blind, placebo-controlled trial. Lancet Oncol. 10:25–34. 2009. View Article : Google Scholar

10 

Roy M, Luo YH, Ye M and Liu J: Nonsmall cell lung cancer therapy: insight into multitargeted small-molecule growth factor receptor inhibitors. Biomed Res Int. 2013:9647432013.PubMed/NCBI

11 

Nojiri K, Sugimoto K, Shiraki K, et al: Sorafenib and TRAIL have synergistic effect on hepatocellular carcinoma. Int J Oncol. 42:101–108. 2013.PubMed/NCBI

12 

Schmieder R, Puehler F, Neuhaus R, et al: Allosteric MEK1/2 inhibitor refametinib (BAY 86-9766) in combination with sorafenib exhibits antitumor activity in preclinical murine and rat models of hepatocellular carcinoma. Neoplasia. 15:1161–1171. 2013.

13 

Hoffmann K, Glimm H, Radeleff B, et al: Prospective, randomized, double-blind, multi-center, phase III clinical study on transarterial chemoembolization (TACE) combined with Sorafenib versus TACE plus placebo in patients with hepatocellular cancer before liver transplantation - HeiLivCa [ISRCTN24081794]. BMC Cancer. 8:3492008.PubMed/NCBI

14 

Abou-Alfa GK, Johnson P, Knox JJ, et al: Doxorubicin plus sorafenib vs doxorubicin alone in patients with advanced hepatocellular carcinoma: a randomized trial. JAMA. 304:2154–2160. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Hsu CH, Shen YC, Lin ZZ, et al: Phase II study of combining sorafenib with metronomic tegafur/uracil for advanced hepatocellular carcinoma. J Hepatol. 53:126–131. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Pawlik TM, Reyes DK, Cosgrove D, Kamel IR, Bhagat N and Geschwind JF: Phase II trial of sorafenib combined with concurrent transarterial chemoembolization with drug-eluting beads for hepatocellular carcinoma. J Clin Oncol. 29:3960–3967. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Cabrera R, Pannu DS, Caridi J, et al: The combination of sorafenib with transarterial chemoembolisation for hepatocellular carcinoma. Aliment Pharmacol Ther. 34:205–213. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Petrini I, Lencioni M, Ricasoli M, et al: Phase II trial of sorafenib in combination with 5-fluorouracil infusion in advanced hepatocellular carcinoma. Cancer Chemother Pharmacol. 69:773–780. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Mochizuki S and Okada Y: ADAMs in cancer cell proliferation and progression. Cancer Sci. 98:621–628. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Wang YY, Ye ZY, Li L, Zhao ZS, Shao QS and Tao HQ: ADAM 10 is associated with gastric cancer progression and prognosis of patients. J Surg Oncol. 103:116–123. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Lee SB, Schramme A, Doberstein K, et al: ADAM10 is upregulated in melanoma metastasis compared with primary melanoma. J Invest Dermatol. 130:763–773. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Zhang W, Liu S, Liu K, et al: A disintegrin and metalloprotease (ADAM)10 is highly expressed in hepatocellular carcinoma and is associated with tumour progression. J Int Med Res. 42:611–618. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Yue Y, Shao Y, Luo Q, Shi L and Wang Z: Downregulation of ADAM10 expression inhibits metastasis and invasiveness of human hepatocellular carcinoma HepG2 cells. Biomed Res Int. 2013:4345612013.PubMed/NCBI

24 

Yang CL, Jiang FQ, Xu F and Jiang GX: ADAM10 overexpression confers resistance to doxorubicin-induced apoptosis in hepatocellular carcinoma. Tumour Biol. 33:1535–1541. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Brummelkamp TR, Bernards R and Agami R: A system for stable expression of short interfering RNAs in mammalian cells. Science. 296:550–553. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Zhang H, Li Z and Wang K: Combining sorafenib with celecoxib synergistically inhibits tumor growth of non-small cell lung cancer cells in vitro and in vivo. Oncol Rep. 31:1954–1960. 2014.PubMed/NCBI

27 

Gagnon V, Van Themsche C, Turner S, Leblanc V and Asselin E: Akt and XIAP regulate the sensitivity of human uterine cancer cells to cisplatin, doxorubicin and taxol. Apoptosis. 13:259–271. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Chekenya M, Krakstad C, Svendsen A, et al: The progenitor cell marker NG2/MPG promotes chemoresistance by activation of integrin-dependent PI3K/Akt signaling. Oncogene. 27:5182–5194. 2008. View Article : Google Scholar : PubMed/NCBI

29 

McDonald GT, Sullivan R, Paré GC and Graham CH: Inhibition of phosphatidylinositol 3-kinase promotes tumor cell resistance to chemotherapeutic agents via a mechanism involving delay in cell cycle progression. Exp Cell Res. 316:3197–3206. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Benson AB III, Abrams TA, Ben-Josef E, et al: NCCN clinical practice guidelines in oncology: hepatobiliary cancers. J Natl Compr Canc Netw. 7:350–391. 2009.PubMed/NCBI

31 

Klein T and Bischoff R: Active metalloproteases of the a disintegrin and metalloprotease (ADAM) family: biological function and structure. J Proteome Res. 10:17–33. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Seals DF and Courtneidge SA: The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev. 17:7–30. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Zhao H, Zhu J, Cui K, et al: Bioluminescence imaging reveals inhibition of tumor cell proliferation by Alzheimer’s amyloid β protein. Cancer Cell Int. 9:152009.PubMed/NCBI

34 

Endres K and Fahrenholz F: Upregulation of the α-secretase ADAM10 - risk or reason for hope? FEBS J. 277:1585–1596. 2010.

35 

Lin T, Gu J, Zhang L, et al: Enhancing adenovirus-mediated gene transfer in vitro and in vivo by addition of protamine and hydrocortisone. J Gene Med. 5:868–875. 2003. View Article : Google Scholar : PubMed/NCBI

36 

Emdad L, Lebedeva IV, Su ZZ, et al: Combinatorial treatment of non-small-cell lung cancers with gefitinib and Ad. mda-7 enhances apoptosis-induction and reverses resistance to a single therapy. J Cell Physiol. 210:549–559. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Bai S, Nasser MW, Wang B, et al: MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 284:32015–32027. 2009. View Article : Google Scholar : PubMed/NCBI

38 

McCubrey JA, Sokolosky ML, Lehmann BD, et al: Alteration of Akt activity increases chemotherapeutic drug and hormonal resistance in breast cancer yet confers an achilles heel by sensitization to targeted therapy. Adv Enzyme Regul. 48:113–135. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Kunter I, Erdal E, Nart D, et al: Active form of AKT controls cell proliferation and response to apoptosis in hepatocellular carcinoma. Oncol Rep. 31:573–580. 2014.PubMed/NCBI

40 

Chiablaem K, Lirdprapamongkol K, Keeratichamroen S, Surarit R and Svasti J: Curcumin suppresses vasculogenic mimicry capacity of hepatocellular carcinoma cells through STAT3 and PI3K/AKT inhibition. Anticancer Res. 34:1857–1864. 2014.PubMed/NCBI

41 

Xiu P, Xu Z, Liu F, et al: Downregulating sCLU enhances the sensitivity of hepatocellular carcinoma cells to gemcitabine by activating the intrinsic apoptosis pathway. Dig Dis Sci. Mar 27–2014.(Epub ahead of print).

42 

Edling CE, Selvaggi F, Ghonaim R, Maffucci T and Falasca M: Caffeine and the analog CGS 15943 inhibit cancer cell growth by targeting the phosphoinositide 3-kinase/Akt pathway. Cancer Biol Ther. 15:524–532. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang W, Liu S, Liu K, Ji B, Wang Y and Liu Y: Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo. Oncol Rep 32: 1913-1922, 2014.
APA
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., & Liu, Y. (2014). Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo. Oncology Reports, 32, 1913-1922. https://doi.org/10.3892/or.2014.3418
MLA
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., Liu, Y."Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo". Oncology Reports 32.5 (2014): 1913-1922.
Chicago
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., Liu, Y."Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo". Oncology Reports 32, no. 5 (2014): 1913-1922. https://doi.org/10.3892/or.2014.3418
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang W, Liu S, Liu K, Ji B, Wang Y and Liu Y: Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo. Oncol Rep 32: 1913-1922, 2014.
APA
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., & Liu, Y. (2014). Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo. Oncology Reports, 32, 1913-1922. https://doi.org/10.3892/or.2014.3418
MLA
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., Liu, Y."Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo". Oncology Reports 32.5 (2014): 1913-1922.
Chicago
Zhang, W., Liu, S., Liu, K., Ji, B., Wang, Y., Liu, Y."Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo". Oncology Reports 32, no. 5 (2014): 1913-1922. https://doi.org/10.3892/or.2014.3418
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team