Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May-2015 Volume 33 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 33 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells

  • Authors:
    • Zhichen Pu
    • Xuefeng Zhang
    • Qun Chen
    • Xiaolong Yuan
    • Haitang Xie
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Pharmacy, Yijishan Hospital of Wannan Medical College, Anhui Province Center for Drug Clinical Evaluation, Wuhu, Anhui 241001, P.R. China, Department of Pharmacy, Wuhu Chinese Medicine Hospital, Wuhu, Anhui 241001, P.R. China
  • Pages: 2420-2428
    |
    Published online on: March 18, 2015
       https://doi.org/10.3892/or.2015.3864
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study was designed to evaluate the gene polymorphisms of organic anion transporting polypeptide 1B1 (OATP1B1) in predicting the therapeutic efficacy of tamoxifen (TAM) for MCF-7. Established plasmids OATP1Bl wild‑type 388GG and 521CC were transfected into MCF-7 cells and used to determine whether the gene polymorphisms affected the therapeutic efficacy of TAM for MCF-7. The established plasmids pcDNA3.1(‑)-OATP1B1 wild‑type 388GG and 521CC were digested by restriction enzymes and analyzed by gene sequencing. The gene polymorphisms of OATP1Bl in MCF-7 breast cancer cells were examined by RT-PCR and western blot analysis. The results showed that the mutations of OATP1B1 388GG and 521CC led to a decrease of the inhibition and apoptotic rates of MCF-7 cells, albeit not significantly compared to the OATP1B1 group. The G0/G1 phase length ratio was reduced, and the S and G2M phases were increased in the OATP1B1 388GG and 521CC groups, although not significantly compared to the OATP1B1 group. The mutations of OATP1B1 388GG and 521CC inhibited the activity of OATP1B1 protein, restrained the turnover capacity of OATP1B1 and reduced the entrance of TAM into MCF-7 cells, resulting in weakened efficacy of TAM in the treatment of breast cancer.

Introduction

Breast cancer continues to be the most common type of cancer diagnosed among women in China, and it was estimated that there were ~232,340 new cases of invasive breast cancer in 2013 (1). The American Cancer Society projected ~39,620 breast cancer-associated mortalities in 2013 (2). In the past three decades, breast cancer has been the second leading cause of cancer death after lung cancer (3). However, breast cancer is a complex disease entity with different biological characteristics and clinical behavior. Many studies have shown that there are no treatment guidelines for triple-negative breast cancer.

Adjuvant endocrine therapy is an important method used for the comprehensive treatment of breast cancer (4). Chemotherapy for breast cancer is closely associated with hormone levels. Tamoxifen (TAM) is non-synthetic cholesterol antiestrogen, which is the basic drug utilized in adjuvant endocrine therapy for breast cancer. TAM is widely used to treat breast cancer patients (5). However, the differences in the gene polymorphism of patients who are administered the drug may lead to individual differences regarding efficacy and toxicity (6). Genetic factors play an important role in these differences.

Organic anion transporting polypeptide 1B1 (OATP1B1) is a type of intake body, distributed in multiple human organs and particularly distributed in specific organs (7). It belongs to the superfamily of solute uptake, of which the encoding genes are known as the SLCO1B1 gene collectively. In the Chinese population, mutation frequencies of OATP1B1 388A>G and OATP1B1 521T>C are 73.4 and 14.0%, respectively, which are similar to those of the Japanese population (8,9). The incidence rate of OATP1B1 521T>C is 16% in Asians and 18% in Caucasians, thus this incidence rate is varied based on ethnicity (10). Studies have shown that in African-Americans, the mutation rate of OATP1B1 388G is 2.5-fold that of Europeans and Americans, with the mutation rate of OATP1B1 521C being higher among the Finnish population. The mutations of OATP1B1*15 (388G and 521C) is 43.4% in the Japanese population simultaneously. However, the incidence rate of OATP1B1*15 is 14% in Caucasians (11).

The majority of current studies concerning the genetic polymorphism of OATPlB1 have focused on statin drugs, which enter the liver cells to exert an inhibitory effect on HMG-CoA reductase. Therefore, OATP1B1 is important in most internalization processes of statin drugs into hepatocytes (12). Recent findings have shown that the genetic polymorphism of OATPlB1 affects the pharmacokinetic process of irinotecan in cancer patients significantly, including OATP1B1*la, OATP1B1*lb, OATP1B1*5 and OATP1B1*15 (13,14).

There were no significant effects on simvastatin pharmacokinetics by SLCO1B1 388A>G, SLCO1B1 521T>C, SLCO1B1 11187G>A, SLCO1B1 571T>C and SLCO1B1 597C>T. Ritonavir intracellular concentrations were associated with OATP1B1 521T>C polymorphism (15). Previous results suggest that the gene mutation of OATP1B1 521T>C influences the transport of rosuvastatin (16). However, no association between the OATP1B1 521T>C polymorphism and the cholesterol synthesis response and rosuvastatin plasma concentration has been identified (17). OATP1B1 388A>G and 521T>C have been shown to lead to altered pharmaco-kinetics of pravastatin. The pharmacokinetics of irinotecan, estrone-3-sulfate and estradiol-17β-glucuronide also affect OATP1B1 388A>G and 521T>C, although without statistical significance (18).

In the present study, we found that the specific mutation of OATP1Bl significantly reduced the uptake activity of OATP1Bl protein, which may affect the internalization of many endogenous substances and drug uptake into hepatocytes and significantly influence the metabolism and efficacy of many drugs. OATP1Bl also influences the adverse reactions of some drugs and the interaction between drugs. A gene polymorphism expression platform of OATP1Bl 388GG and 521CC was also established and utilized to determine whether OATP1Bl 388GG and OATP1Bl 521CC gene polymorphisms can affect TAM treatment of breast cancer in vitro.

Materials and methods

Total RNA extraction

Approximately 100 mg tissue was ground into a powder in liquid nitrogen, and moderate RNAiso Plus (Qiagen, Hilden, Germany) was added for 5–10 min at room temperature. The supernatant was collected by centrifugation at 12,000 rpm for 5 min at 4°C followed by the addition of chloroform. Miscible liquids were agitated and placed for 5–10 min at room temperature. The miscible liquids were collected by centrifugation at 12,000 rpm for 15 min at 4°C. The supernatant was absorbed into the new centrifuge tube. The isopropanol, which was the same volume as that of the supernatant, was added to the centrifuge tube, and placed for 10 min at room temperature. The liquid was centrifuged at 12,000 rpm for 10 min to obtain a sediment. One millimeter 75% ethyl alcohol was added to the centrifuge tube. The liquid was centrifuged at 12,000 rpm for 5 min to obtain sediment again. The sediment obtained was dried at room temperature, and then treated in 20–100 μl DEPC-H2O. Total RNA was maintained at −80°C.

cDNA synthesis

Total RNA (1 μl), 1 μl 0.5 μg/μl oligo(dT)18 and 10 μl DEPC-H2O was mixed, subjected to PCR at 70°C for 5 min and cooled rapidly on ice. Four microliters 5X reaction buffer, 1 μl 20 U/μl RNA enzyme inhibitors and 2 μl 10 mmol/l dNTP were dissolved in miscible liquids and subjected to PCR at 37°C for 5 min. One microliter 200 U/μl reverse transcriptase was added and the mixture was subjected to PCR. Cycling conditions used were: 42°C for 60 min and 70°C for 10 min. cDNA synthesis was maintained at −80°C.

DNA extraction

The primers were designed according to gene coding sequence (CDS) of OATP1B1 in GenBank. KpnI and NotI restriction sites were subsequently inserted. The primers used were: forward: 5′-TTAGCGGCCGCATGGACCAAAATCAACATT-3′ and reverse, 5′-GCCGGTACCTTAACAATGTGTTTCACTATCTG-3′.

cDNA (2–4 μl), 2 μl sense primer (10 pM), 2 μl reverse primer (10 pM), 4 μl dNTP (2 mM), 5 μl 10X PCR buffer, 1 μl Taq DNA Polymerase (Takara, Otsu, Japan) and moderate DEPC-H2O were mixed in the centrifuge tube, and the total volume was 50 μl. Cycling conditions used were: 94°C for 10 min followed by 40 cycles at 95°C for 30 sec, 58°C for 90 sec and 72°C for 30 sec, and then 72°C for 7 min. DNA was kept at −80°C. DNA OATP1B1 was analyzed by electrophoresis of 0.5 or 1% agarose gel followed by gene sequencing.

Construction of plasmids

KpnI and NotI, DNA OATP1B1 and pcDNA3.1(-) plasmid were mixed at 37°C for 1–4 h and at 70°C for 10 min according to the manufacturer’s instructions (Takara). T4 DNA ligase (Takara) was then added to the mixture at 16°C for 1–4 h and at 70°C for 10 min. pcDNA3.1(-)-OATP1B1 plasmid was identified by restriction enzyme digestion (KpnI and NotI), and analyzed by electrophoresis of 0.5% agarose gel and gene sequencing.

Site-directed mutagenesis of OATP1B1 388GG and 521CC

The site-directed mutagenesis primers of OATP1B1 388GG and OATP1B1 521CC were designed according to OATP1B1 gene CDS in GenBank (Table I). The plasmid of 1 μl pcDNA3.1 (-)-OATP1B1, 5 μl 10X Pfu polymerase buffer (Mg2+), 2 μl sense primer (10 pM), 2 μl reverse primer (10 pM), 1 μl Pfu DNA polymerase (5 U) (Promega, Shanghai, China), and 39 μl DEPC-H2O were mixed and subjected to PCR. Cycling conditions were as follows: 95°C for 4 min followed by 25 cycles at 95°C for 60 sec, 62°C for 45 sec and 72°C for 30 sec, and then 72°C for 7 min. PCR amplification products were digested with the restriction endonuclease ClaI (Promega) at 37°C for 1–3 h. The plasmids were maintained at −80°C. The plasmids were separated using 0.5 or 1% agarose gel followed by gene sequencing.

Table I

The site-directed mutagenesis primers of OATP1B1 388GG and 521CC.

Table I

The site-directed mutagenesis primers of OATP1B1 388GG and 521CC.

Name of primer5′→3′
388GG GAAAGAAACTAATATCGATTCATCAGAAAATTC
388GG GATTATAGGTAAGTAGTCTTTTAAGTTGTAGC
521CC ACATGTGGATATATGCGTTCATGGGTAATAT
521CC TATTACCCATGAACCCATATATCCACATG
Plasmid transfection

The plasmids were constructed and transfected into MCF-7 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions in a humidified atmosphere at 37°C with 5% CO2. After 6 h, the transfection medium was replaced with Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) without antibiotic in a humidified atmosphere at 37°C with 5% CO2. The OATP1B1 gene polymorphisms were examined in MCF-7 cell lines by RT-PCR and western blot assay.

Cell culture

MCF-7 human breast cancer cells were obtained from the Shanghai Institute of Cell Biology in the Chinese Academy of Sciences for the present study. MCF-7 cells were maintained in DMEM containing 10% FBS supplemented with 100 U penicillin/streptomycin in a humidified atmosphere at 37°C with 5% CO2.

Experiments

The experiment was divided into six groups: A group was MCF-7; B group was MCF-7 with TAM (10 μM); C group was MCF-7 transfected with pcDNA3.1(-) plasmid and provided with TAM (10 μM); D group was MCF-7 transfected with pcDNA3.1(-)-OATP1B1 plasmid and provided with TAM (10 μM); E group was MCF-7 transfected with pcDNA3.1(-)-OATP1B1 388GG plasmids and provided with TAM (10 μM); and F group was MCF-7 transfected with pcDNA3.1(-)-OATP1B1 521CC plasmids and provided with TAM (10 μM).

MCF-7 cell proliferation assay

MCF-7 cell proliferation was examined using the colorimetric assay using 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. Cells were plated at 2.5−5×105 cells/well in a 96-well plate and incubated for 24 h. The plasmids were transfected into MCF-7 cells. The cells were treated with TAM solutions at concentrations of 10 μM for 24 and 48 h. Phosphate-buffered saline (PBS; pH 7.4) alone was used as the vehicle-group. TAM was dissolved in PBS and was used as treat-groups. For the MTT assay, the vehicle- and treat-groups were incubated with 150 μl MTT for 4 h at 37°C. The medium was extracted from the plates. The plates were incubated with 100 μl dimethyl sulf-oxide for 10 min at room temperature and agitated. The optic density was determined using an ELISA reader at 540 nm.

Quantification of apoptotic cells by flow cytometry

Apoptotic cells were measured by flow cytometry (BD Biosciences, San Diego, CA, USA). The cells were stained using an Annexin V-FITC Apoptosis Detection kit according to the manufacturer’s instructions. Briefly, MCF-7 cells (5.0×105 cells/well) were plated in 6-well plates and incubated for 24 h. The plasmids were subsequently transfected into MCF-7 cells. The cells were treated with TAM solutions at concentrations of 10 μM for 24 and 48 h. PBS (pH 7.4) alone was used as the vehicle-group. TAM was dissolved in PBS and was used as treat-groups. For the apoptotic cell analysis, the cells of the vehicle- and treat-groups were trypsinized without ethylenediaminetetraacetic acid (EDTA) and centrifuged at 2,000 × g for 5 min. The cells were collected, washed in PBS (pH 7.4), and centrifuged at 2,000 ×x g for 5 min. The cell samples were suspended with 500 μl combined buffer solution. Then, 5 μl fluorescein isothiocyanate (FITC)-Annexin V and 10 μl propidium iodide (PI) were added into the cell samples and incubated for 5–15 min at room temperature in the dark. Apoptotic cells were analyzed by flow cytometry (BD Biosciences).

Cell cycle analysis by flow cytometry

Cell cycle analysis of MCF-7 cells was examined using the standard PI method by flow cytometry (BD Biosciences). Briefly, MCF-7 cells (5.0×105 cells/well) were plated in 6-well plates and incubated for 24 h. The plasmids were subsequently transfected into MCF-7 cells. The cells were treated with TAM solutions at concentrations of 10 μM for 24 and 48 h. PBS (pH 7.4) alone was used as the vehicle-group. TAM was dissolved in PBS and was used as treat-groups. For the cell cycle analysis, the cells of the vehicle- and treat-groups were trypsinized without EDTA and centrifuged at 2,000 × g for 5 min. The cells were harvested, washed in PBS (pH 7.4) and fixed in 70% with ice-cold ethanol at 0–4°C overnight. The cells were collected and centrifuged at 2,000 × g for 5 min and the supernatant was removed. The cell pellet was resuspended and washed in PBS (pH 7.4). The cell solution was transferred to a flow tube, and incubated with 10 ml of RNase A (10 mg/ml) for 1 h at 37°C. The cell samples were incubated with 50 ml of PI (250 mg/ml) for 30 min in the dark at 0–4°C. The cell cycle proliferation index was subsequently calculated using the formula: PI = (G2/M + S)/ (G0/G1 + S + G2/M) ×100%. The cell cycle distribution was analyzed by flow cytometry (BD Biosciences).

Statistical analysis

The experiments were repeated at least three times. Data are presented as the mean ± SEM. The differences between means were analyzed using the two-tailed Student’s t-test. Statistical analyses were performed using SPSS 17.0 software. Differences with P<0.05 were considered to indicate a statistically significant result.

Results

DNA fragmentation of OATP1B1

DNA fragmentation of OATP1B1 was analyzed by electrophoresis of 1% agarose gel, which showed that the amplified gene fragment was 2,096 bp (Fig. 1A). The DNA fragmentation of OATP1B1 was analyzed by gene sequencing, which showed that the amplified gene fragment identified the 388 site as A, and the 521 site as T (Fig. 1B and C).

Figure 1

DNA fragmentation of OATP1B1 was analyzed by electrophoresis of 1% agarose gel: (A) left of image is DNA marker and right of image is the OATP1B1 fragment. DNA fragmentation of OATP1B1 was analyzed by gene sequencing: (B) OATP1B1 388 site was A and (C) OATP1B1 521 site was T.

Restriction enzyme and gene sequence of pcDNA3.1(-)-OATP1B1

The established plasmids of pcDNA3.1(-)-OATP1B1 were digested by restriction enzymes (KpnI and NotI). The products were analyzed by electrophoresis of 0.5% agarose gel, which showed that pcDNA3.1(-) was 5.4 kb, while the OATP1B1 fragment was 2,096 bp (Fig. 2A). Gel extraction of the OATP1B1 fragment was performed and the fragment was analyzed by gene sequencing, which showed that the amplified gene fragment identified the 388 site as A, and the 521 site as T (Fig. 2B and C).

Figure 2

Restriction enzyme and gene sequence of pcDNA3.1(-)-OATP1B1. The established plasmids of pcDNA3.1(-)-OATP1B1 were digested by restriction enzymes: (A) left of image is pcDNA3.1(-) and right of image is DNA marker. The established plasmids of pcDNA3.1(-)-OATP1B1 were analyzed by gene sequencing: (B) OATP1B1 388 site was A and (C) OATP1B1 521 site was T.

Restriction enzymes and gene sequencing of pcDNA3.1(-)-OATP1B1 388GG and 521 CC

The established plasmids of pcDNA3.1(-)-OATP1B1 388GG were digested by restriction enzymes, KpnI and NotI. These products were analyzed by electrophoresis of 0.5% agarose gel, which showed that pcDNA3.1(-) was 5.4 kb, and the OATP1B1 fragment was 2,096 bp (Fig. 3A). The OATP1B1 fragment was extracted using gel extraction and analyzed by gene sequencing. The amplified gene fragment identified at the 388 site was G (Fig. 3B).

Figure 3

Restriction enzyme and gene sequence of pcDNA3.1(-)-OATP1B1 388GG and 521 CC. The established plasmids of pcDNA3.1(-)-OATP1B1 388GG were digested by restriction enzymes: (A) left of image is pcDNA3.1(-) 388GG and right of image is DNA marker. The established plasmids of pcDNA3.1 (-)-OATP1B1 388GG were analyzed by gene sequencing: (B) OATP1B1 388 site was G. (C) The established plasmids of pcDNA3.1(-)-OATP1B1 521CC were digested by restriction enzymes: left of the image is pcDNA3.1(-) 521CC and right of the image is DNA marker. The established plasmids of pcDNA3.1(-)-OATP1B1 521CC were analyzed by gene sequencing: (D) OATP1B1 521 site was C.

The established plasmids of pcDNA3.1(-)-OATP1B1 521CC were digested by restriction enzymes, KpnI and NotI. The products were analyzed by electrophoresis of 0.5% agarose gel, which showed that pcDNA3.1(-) was 5.4 kb, and the OATP1B1 fragment was 2,096 bp (Fig. 3C). The OATP1B1 fragment was extracted using gel extraction and was analyzed by gene sequencing, which showed that the amplified gene fragment identified at the 521 site was C (Fig. 3D).

Cataphoresis of plasmid transfection

RNA was extracted from the transfection of MCF-7 cells of each group, and PCR was used to amplify double-stranded DNA. The electrophoretic analysis was performed on the product using 1% agarose gel, which showed that the plasmid was successfully expressed (Fig. 4).

Figure 4

Cataphoresis of plasmid transfection. The OATP1B1 gene polymorphisms in cell lines were examined by RT-PCR. M, 2000 marker. Lanes 1, OATP1B1 521TT was 260 + 179 bp; 2, OATP1B1 388AA was 274 bp; 3, OATP1B1 388GG was 155 + 119 bp; 4, OATP1B1 521CC was 260 + 123 bp.

Western blotting of plasmid transfection

The OATP1B1 gene polymorphisms in MCF-7 cell lines were examined by western blot assay. A was MCF-7 cell, B was pcDNA3.1(-) was transfected into MCF-7 cell, C was pcDNA3.1(-)-OATP1B1 was transfected into MCF-7 cell, D was pcDNA3.1(-)-OATP1B1 388GG was transfected into MCF-7 cell, E was pcDNA3.1(-)-OATP1B1 521CC was transfected into MCF-7 cell. A and B did not express OATP1B1 protein, whereas C-E expressed OATP1B1 protein (Fig. 5).

Figure 5

Western blotting of plasmid transfection. The OATP1B1 gene polymorphisms in cell lines were examined by western blot analysis. (A) MCF-7 cells; (B) pcDNA3.1(-) was transfected into MCF-7 cells; (C) pcDNA3.1 (-)-OATP1B1 was transfected into MCF-7 cells; (D) pcDNA3.1(-)-OATP1B1 388GG was transfected into MCF-7 cells; (E) pcDNA3.1(-)-OATP1B1 521CC was transfected into MCF-7 cells.

TAM effect on the cell inhibition rate of MCF-7 by plasmid transfection

We established expression platforms of OATP1B1 genetic polymorphisms to assess the role of OATP1B1 genetic polymorphisms of the effect of TAM (10 μM) on the inhibition rate of MCF-7 cells. The results showed that at 24 h, the inhibition rate of the D group was markedly increased (P<0.05, n=3), compared to the B group (Fig. 6A). However, the inhibition rate of MCF-7 cells of the E and F groups was slightly decreased (P>0.05, n=3) compared to the D group, although the difference was not statistically significant (Fig. 6A).

Figure 6

TAM effect on the cell inhibition rate of MCF-7 by plasmid transfection. Effect of TAM (10 μM) on the inhibition rate of MCF-7 cells at (A) 24 h and (B) 48 h. *P<0.01 compared with MCF-7 group, #P>0.05 compared with pcDNA3.1(-)-OATP1B1 transfected in the MCF-7 cell group. TAM, tamoxifen.

After the effect of TAM (10 μM) on the proliferation of MCF-7 cells at 48 h, the inhibition rate of D group was markedly increased (P<0.05, n=3), compared to the B group (Fig. 6B). However, the inhibition rate of MCF-7 cells of the E and F groups were slightly decreased (P>0.05, n=3) compared to the D group, although the difference was not statistically significant (Fig. 6B).

TAM effect on the cell apoptotic rate of MCF-7 by plasmid transfection

We established expression platforms of OATP1B1 genetic polymorphisms to assess the role of OATP1B1 genetic polymorphisms on TAM (10 μM) with regard to the apoptosis of MCF-7 cells. The results showed that at 24 h, apoptosis in the D group was markedly increased (P<0.05, n=3), compared to the B group (Fig. 7A and B). However, apoptosis of MCF-7 cells of the E and F groups was slightly decreased (P>0.05, n=3) compared to the D group, although the difference was not statistically significant (Fig. 7A and B).

Figure 7

TAM effect on the cell apoptotic rate of MCF-7 by plasmid transfection. Effect of TAM (10 μM) on the cell apoptotic rate of MCF-7 cells at (A) 24 h and (B) 48 h. *P<0.01 compared with MCF-7 group, #P>0.05 compared with pcDNA3.1(-)-OATP1B1 transfected into MCF-7 cell group. TAM, tamoxifen.

After the effect of TAM (10 μM) on the apoptosis of MCF-7 cells at 48 h, apoptosis of the D group was markedly increased (P<0.05, n=3), compared to the B group (Fig. 7C and D). However, the apoptosis of MCF-7 cells of the E and F groups was slightly decreased (P>0.05, n=3) compared to the D group, although the differences were not statistically significant (Fig. 7C and D).

TAM effect on the cell cycle of MCF-7 by plasmid transfection

We established expression platforms of OATP1B1 genetic polymorphisms to assess the role of OATP1B1 genetic polymorphisms concerning the effect of TAM (10 μM) on the cell cycle of MCF-7 cells. After the effect of TAM (10 μM) on the cell cycle of MCF-7 cells at 24 h, the G0/G1 phase in D group was markedly increased (P<0.05, n=3), the S and G2M phases were markedly decreased (P<0.05, n=3), compared to the B group (Table II, Fig. 8A). In E and F groups, the G0/G1 phase was slightly decreased (P>0.05, n=3), while the S and G2M phases were slightly increased (P>0.05, n=3), respectively, compared to the D group, although the differences were not statistically significant (Table II, Fig. 8A).

Figure 8

TAM effect on the cell cycle of MCF-7 by plasmid transfection. (A) Effect of TAM (10 μM) on the cell cycle of MCF-7 cells at 24 h and (B) 48 h. *P<0.01 compared with MCF-7 group, #P>0.05 compared with pcDNA3.1(-)-OATP1B1 transfected into the MCF-7 cell group. TAM, tamoxifen.

Table II

TAM effect on the cell cycle of MCF-7 by plasmid transfection.

Table II

TAM effect on the cell cycle of MCF-7 by plasmid transfection.

TimeGroup G0/G1 (%)S (%)G2M (%)PI-value
24 hA68.71±3.1222.24±1.215.78±1.0228.97
B74.33±2.2412.71±1.0612.84±1.0125.58
C74.79±2.3114.81±1.119.92±1.0324.85
D79.57±1.6910.13±0.779.86±0.5920.08a
E77.76±1.7811.74±1.0310.4±1.0022.16a,b
F79.02±1.896.88±0.9814.00±0.7620.90a,b
48 hA64.32±3.5321.45±2.3113.93±2.1335.49
B75.90±2.7212.3±1.5811.06±1.3523.53
C76.63±2.6913.00±1.6210.33±1.4023.34
D81.21±2.099.11±1.189.66±1.2118.78a
E80.15±2.1110.66±1.358.81±1.2519.54a,b
F81.00±2.109.31±1.209.39±1.1718.76a,b

{ label (or @symbol) needed for fn[@id='tfn1-or-33-05-2420'] } A group was MCF-7; B group was MCF-7 with TAM (10 μM); C group was MCF-7 transfected with pcDNA3.1(-) plasmid with TAM (10 μM); D group was MCF-7 transfected with pcDNA3.1(-)-OATP1B1 plasmid with TAM (10 μM); E group was MCF-7 transfected with pcDNA3.1 (-)-OATP1B1 388GG plasmids with TAM (10 μM); F group was MCF-7 transfected with pcDNA3.1(-)-OATP1B1 521CC plasmids with TAM (10 μM),

a P<0.01 compared with the MCF-7 group,

b P>0.05 compared with pcDNA3.1(-)-OATP1B1 transfected into the MCF-7 cell group. TAM, tamoxifen.

After the effect of TAM (10 μM) on the cell cycle of MCF-7 cells at 48 h, the G0/G phase in the D group was markedly increased (P<0.05, n=3), while the S and G2M phases were markedly decreased (P<0.05, n=3), compared to the B group (Table II, Fig. 8B). In the E and F groups, the G0/G1 phase was slightly decreased (P>0.05, n=3), while the S and G2M phases were slightly increased (P>0.05, n=3), respectively, compared to D group, although the differences were not statistically significant (Table II, Fig. 8B).

Discussion

The functions of OATP1B1 are numerous, of which the specificity is distributed in the basolateral membrane of liver cells of the human. A variety of endogenous substances and drugs enter the liver cells via the portal system, including thyroid hormones, prostaglandin, bile acid, and statins. The OATP1B1 gene is located on chromosome 12, with the full-length 10.86 kb (7). The encoding gene of SLCO1B1 includes 2,076 bases, encoding 691 amino acids, including 15 exons and 14 introns, as well as 20 function-genetic polymorphisms. The OATP1B1 gene has multiple single-nucleotide polymorphisms that are associated with abnormal uptake in in vitro or in vivo experiments, of which the OATP1B1 gene 388A>G and 521T>C are the most common mutations (19). In a previous study, it was found that the SLCO1B1 gene 388A>G polymorphism was not statistically significantly associated with gallstone formation in a north Indian population (20). SLCO1B1 521 T>C plays a significant role in susceptibility to colorectal cancer risk in the Turkish population (14). SLCO1B1 388A>G and 521T>C polymorphisms were also not associated with response to atorvastatin or simvastatin (21).

In the present study, a molecular biology technique was applied to construct the pcDNA3.1(-)-OATP1B1 plasmid. The site-directed mutagenesis method was then used to establish pcDNA3.1(-)-OATP1B1 388GG and 521CC plasmids successfully. The pcDNA3.1(-)-OATP1B1-MCF-7 gene polypeptide expression platform demonstrated that OATP1B1 388GG and 521CC mutations lead to a decrease of the inhibition and apoptotic rate of breast cancer cells, compared to the OATP1B1 group, although the differences were not statistically significant.

Breast cancer cells in the G0/G1 phase were reduced in the OATP1B1 388GG and 521CC groups, compared to the OATP1B1 group. Breast cancer cells in the S and G2M phases were increased in the OATP1B1 388GG and 521CC groups, compared to the OATP1B1 group, although the differences were not statistically significant. Therefore, pre-synthesis DNA of breast cancer cells in the OATP1B1 388GG and 521CC group were reduced, while DNA increased in the synthesis and post-synthesis phase, causing the decreased inhibition rate of MCF-7 cells, thereby reducing the effect of TAM on MCF-7 cells. This conclusion is consistent with the inhibition rate and apoptosis results.

In summary, our present investigation has shown that OATP1B1 388GG and 521CC mutations may inhibit the activity of the OATP1B1 protein. OATP1B1 388GG and 521CC mutations may lead to restraining of the turn-over capacity of OATP1B1 and a reduction of TAM that is internalized into MCF-7 cells, resulting in weakened TAM treatment for breast cancer.

Nozawa et al (22) and Iwai et al (23) employed HEK293 cells and used estrone sulfate and estradiol-17β-glucuronide as a substrate, finding OATP1B1 388GG and 521CC had no significant effect on OATP1B1 absorbing ability, consistent with the results of the present study. OATP1B1 388GG and 521CC mutations cause decreased capacity of OATP1B1 in absorbing TAM, without statistical significance compared with the gene groups that have not mutated. This occurs due to OATP1B1 388GG and 521CC mutations being single mutation sites, and these changes of the DNA sequence result in such limited change of the protein structure and composition of OATP1B1 protein that effective change for the turn-over capacity cannot be markedly inhibited. This phenomenon is extremely common in gene mutations. The results of that study found that CYP2D6*4 or *10 mutations have a limited impact on the efficacy of TAM, and the difference was not statistically significant (24). Previous findings have shown that CYP2C19*2 and *3 mutations have limited impact on the efficacy of TAM, and the difference was not statistically significant (25).

The ability of SLCO1B1*15 (388G/521C) in absorbing estrone sulfate and estradiol-17β-glucuronide was found to be significantly reduced (26), indicating that the double mutation (SLCO1B1*15) may have greater significance on the transport of TAM. In summary, 388GG and 521CC of OATP1B1 gene polymorphism expression platforms were established in this experiment. The results show that OATP1B1 388GG and 521CC mutations lead to the decreased turn-over capacity of OATP1B1 and a reduction of TAM in the treatment of breast cancer, although the difference was not statistically significant. Thus construction of a OATP1B1*15 double mutation plasmid to study the changes in drug absorption should be carried out in future investigations.

Acknowledgments

This study was supported by the Key Clinical Medicine Application Technology Item of Anhui Provincial Health Department (no. 2010A013), and the Natural Science Foundation of China (grant no. 81173134).

References

1 

Knaul FM, Bhadelia A, Gralow J, et al: Meeting the emerging challenge of breast and cervical cancer in low- and middle-income countries. Int J Gynaecol Obstet. 119(Suppl 1): S85–S88. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Harbeck N: American Society of Clinical Oncology highlights 2013: breast cancer and gynecological malignancies. Future Oncol. 9:1433–1436. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Karaoz B, Aksu H and Küçük M: A qualitative study of the information needs of premenopausal women with breast cancer in terms of contraception, sexuality, early menopause, and fertility. Int J Gynaecol Obstet. 109:118–120. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Kattan J and Kourie HR: The use of everolimus to reverse tamoxifen resistance in men with metastatic breast cancer: a case report. Invest New Drugs. 32:1046–1047. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Yaacob NS, Kamal NN and Norazmi MN: Synergistic anticancer effects of a bioactive subfraction of Strobilanthes crispus and tamoxifen on MCF-7 and MDA-MB-231 human breast cancer cell lines. BMC Complement Altern Med. 14:2522014. View Article : Google Scholar : PubMed/NCBI

6 

Alcazar-González GA, Calderón-Garcidueñas AL, Garza-Rodríguez ML, et al: Comparative study of polymorphism frequencies of the CYP2D6, CYP3A5, CYP2C8 and IL-10 genes in Mexican and Spanish women with breast cancer. Pharmacogenomics. 14:1583–1592. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Hsiang B, Zhu Y, Wang Z, et al: A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem. 274:37161–37168. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Niemi M, Schaeffeler E, Lang T, et al: High plasma pravastatin concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide-C (OATP-C, SLCO1B1). Pharmacogenetics. 14:429–440. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Mwinyi J, Johne A, Bauer S, et al: Evidence for inverse effects of OATP-C (SLC21A6) *5 and *1b haplotypes on pravastatin kinetics. Clin Pharmacol Ther. 75:415–421. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Niemi M, Neuvonen PJ, Hofmann U, et al: Acute effects of pravastatin on cholesterol synthesis are associated with SLCO1B1 (encoding OATP1B1) haplotype *17. Pharmacogenet Genomics. 15:303–309. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Igel M, Arnold KA, Niemi M, et al: Impact of the SLCO1B1 polymorphism on the pharmacokinetics and lipid-lowering efficacy of multiple-dose pravastatin. Clin Pharmacol Ther. 79:419–426. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Chung JY, Cho JY, Yu KS, et al: Effect of OATP1B1 (SLCO1B1) variant alleles on the pharmacokinetics of pitavastatin in healthy volunteers. Clin Pharmacol Ther. 78:342–350. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Ieiri I, Suwannakul S, Maeda K, et al: SLCO1B1 (OATP1B1, an uptake transporter) and ABCG2 (BCRP, an efflux transporter) variant alleles and pharmacokinetics of pitavastatin in healthy volunteers. Clin Pharmacol Ther. 82:541–547. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Ozhan G, Kara M, Sari FM, et al: Influence of the functional polymorphisms in the organic anion transporting polypeptide 1B1 in the susceptibility to colorectal cancer. Genet Test Mol Biomarkers. 17:214–218. 2013. View Article : Google Scholar

15 

D’Avolio A, Carcieri C, Cusato J, et al: Intracellular accumulation of atazanavir/ritonavir according to plasma concentrations and OATP1B1, ABCB1 and PXR genetic polymorphisms. J Antimicrob Chemother. 69:3061–3066. 2014. View Article : Google Scholar

16 

Hua WJ, Hua WX, Nan FY, et al: The influence of herbal medicine ursolic acid on the uptake of rosuvastatin mediated by OATP1B1*1a and *5. Eur J Drug Metab Pharmacokinet. 39:221–230. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Rose RH, Neuhoff S, Abduljalil K, et al: Application of a physiologically based pharmacokinetic model to predict OATP1B1-related variability in pharmacodynamics of rosuvastatin. CPT Pharmacometrics Syst Pharmacol. 3:e1242014. View Article : Google Scholar : PubMed/NCBI

18 

Rohrbacher M, Kirchhof A, Skarke C, et al: Rapid identification of three functionally relevant polymorphisms in the OATP1B1 transporter gene using Pyrosequencing™. Pharmacogenomics. 7:167–176. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Nishizato Y, Ieiri I, Suzuki H, et al: Polymorphisms of OATP-C (SLC21A6) and OAT3 (SLC22A8) genes: consequences for pravastatin pharmacokinetics. Clin Pharmacol Ther. 73:554–565. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Jindal C, Kumar S, Choudhari G, et al: Organic anion transporter protein (OATP1B1) encoded by SLCO1B1 gene polymorphism (388A>G) & susceptibility in gallstone disease. Indian J Med Res. 129:170–175. 2009.PubMed/NCBI

21 

Giannakopoulou E, Ragia G, Kolovou V, et al: No impact of SLCO1B1 521T>C, 388A>G and 411G>A polymorphisms on response to statin therapy in the Greek population. Mol Biol Rep. 41:4631–4638. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Nozawa T, Nakajima M, Tamai I, et al: Genetic polymorphisms of human organic anion transporters OATP-C (SLC21A6) and OATP-B (SLC21A9): allele frequencies in the Japanese population and functional analysis. J Pharmacol Exp Ther. 302:804–813. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Iwai M, Suzuki H, Ieiri I, et al: Functional analysis of single nucleotide polymorphisms of hepatic organic anion transporter OATP1B1 (OATP-C). Pharmacogenetics. 14:749–757. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Sirachainan E, Jaruhathai S, Trachu N, et al: CYP2D6 polymorphisms influence the efficacy of adjuvant tamoxifen in Thai breast cancer patients. Pharmgenomics Pers Med. 5:149–153. 2012.PubMed/NCBI

25 

Okishiro M, Taguchi T, Jin Kim S, et al: Genetic polymorphisms of CYP2D6*10 and CYP2C19*2, *3 are not associated with prognosis, endometrial thickness, or bone mineral density in Japanese breast cancer patients treated with adjuvant tamoxifen. Cancer. 115:952–961. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Tirona RG, Leake BF, Merino G and Kim RB: Polymorphisms in OATP-C: identification of multiple allelic variants associated with altered transport activity among European- and African-Americans. J Biol Chem. 276:35669–35675. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Pu Z, Zhang X, Chen Q, Yuan X and Xie H: Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells. Oncol Rep 33: 2420-2428, 2015.
APA
Pu, Z., Zhang, X., Chen, Q., Yuan, X., & Xie, H. (2015). Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells. Oncology Reports, 33, 2420-2428. https://doi.org/10.3892/or.2015.3864
MLA
Pu, Z., Zhang, X., Chen, Q., Yuan, X., Xie, H."Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells". Oncology Reports 33.5 (2015): 2420-2428.
Chicago
Pu, Z., Zhang, X., Chen, Q., Yuan, X., Xie, H."Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells". Oncology Reports 33, no. 5 (2015): 2420-2428. https://doi.org/10.3892/or.2015.3864
Copy and paste a formatted citation
x
Spandidos Publications style
Pu Z, Zhang X, Chen Q, Yuan X and Xie H: Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells. Oncol Rep 33: 2420-2428, 2015.
APA
Pu, Z., Zhang, X., Chen, Q., Yuan, X., & Xie, H. (2015). Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells. Oncology Reports, 33, 2420-2428. https://doi.org/10.3892/or.2015.3864
MLA
Pu, Z., Zhang, X., Chen, Q., Yuan, X., Xie, H."Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells". Oncology Reports 33.5 (2015): 2420-2428.
Chicago
Pu, Z., Zhang, X., Chen, Q., Yuan, X., Xie, H."Establishment of an expression platform of OATP1B1 388GG and 521CC genetic polymorphism and the therapeutic effect of tamoxifen in MCF-7 cells". Oncology Reports 33, no. 5 (2015): 2420-2428. https://doi.org/10.3892/or.2015.3864
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team