Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2015 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2015 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells

  • Authors:
    • Shaohui Jia
    • Zhongxia Du
    • Hua Jiang
    • Xingyuan Huang
    • Zhengwang Chen
    • Ning Chen
  • View Affiliations / Copyright

    Affiliations: College of Health Science, Wuhan Sports University, Wuhan, Hubei 430079, P.R. China, Key Laboratory of Molecular Biophysics of the Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, Hubei 430074, P.R. China, School of Life Science and Technology, Hubei Engineering University, Xiaogan, Hubei 432000, P.R. China
  • Pages: 511-517
    |
    Published online on: May 20, 2015
       https://doi.org/10.3892/or.2015.4002
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Daintain/allograft inflammatory factor-1 (AIF-1), as a novel inflammatory factor, has been reported to accelerate the proliferation and migration of breast cancer cells. However, the effect of daintain/AIF-1 on hepatocarcinogenesis remains unclear. In order to explore the effect of daintain/AIF-1 on the progression of hepatocellular carcinoma (HCC), enzyme-linked immunosorbent assay (ELISA) and reverse transcription polymerase chain reaction (RT-PCR) were performed to examine the secretion and gene expression of (IGF)-1, IGF-2 and IGFBP-3. The expression of IGF-1R and its downstream targets was evaluated by western blotting. In addition, the proliferation and cell‑cycle progression of HepG2 cells was assessed by 3-(4,5-dimethylthiazol-2-yl)‑2,5-diphenylterazolium bromide (MTT) and flow cytometric analysis. The results showed that HepG2 cells subjected to daintain/AIF-1 treatment revealed an obvious increase in the secretion of IGF-1 and IGF-2, and a reduction in the secretion of IGFBP-3. Moreover, daintain/AIF-1 accelerated the activation of IGF-1-induced IGF-1R and its downstream AKT signaling pathway, and subsequently promoted the activation of cyclin D1 pathway, thus accelerating the progression of the cell cycle and eventually promoting the proliferation of HepG2 cells. In conclusion, daintain/AIF-1 promoted the proliferation of HepG2 cells by accelerating the activation of IGF-1R and its downstream signaling pathway, which confirms that daintain/AIF-1 plays a crucial role in the development of HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common lethal cancers worldwide (1). Following the diagnosis of liver cancer, approximately 20% patients benefit from curative surgical therapies such as liver resection and transplantation. Accumulating evidence has shown that insulin-like growth factors (IGF-1 and IGF-2) and their receptors (IGF-1R) are involved in the progression of cancers (2–5). The interaction between IGF-1 or IGF-2 and IGF-1R plays a pivotal role in tumorigenesis and the proliferation of cancer cells due to promotion of the cell-cycle progression (6). The mRNA expression level of IGF-1 in human HCC tissues is much lower than that in normal liver tissues, whereas, IGF-2 and IGF-1R reveal the overexpression in animal models of hepatocarcinogenesis and in HCC tissues (7). Mounting evidence confirms that the IGFs/IGF-1R axis is crucial in the development of HCC (7,8).

Daintain was first isolated from porcine intestine (9) and allograft inflammatory factor-1 (AIF-1) was first identified in heterotopic cardiac allografts of rats (10). Daintain has a high homology with AIF-1, thus this peptide has been deisgnated as as daintain/AIF-1. Daintain/AIF-1 can be constitutively expressed in monocytes and macrophages, and is involved in macrophage activation (11,12). It plays a crucial role in many autoimmune diseases (9,13–15). In previous studies, daintain/AIF-1 was confirmed to promote the proliferation and migration of breast cancer cells (16,17). However, whether daintain/AIF-1 has any impact on the progression of HCC remain unknown.

The association of inflammation with cancer has been previously suggested (18). A clear example of inflammation-associated cancer is HCC. Although mounting evidence is gathered to explore its molecular mechanisms, an accurate molecular connection between inflammation and HCC remains elusive. It has been demonstrated that inflammatory factors such as TNF-α, IL-6 and IL-1α contribute to the progression of HCC (19,20). Daintain/AIF-1, as a novel inflammatory factor, has been found to be expressed in activated Kupffer cells lining the walls of liver sinusoids (21,22). Therefore, we hypothesized that daintain/AIF-1 may be involved in the development of HCC. Based on this hypothesis, the effects of daintain/AIF-1 on the activation of IGF-1R and its downstream signaling pathway in HepG2 cells were investigated. The results revealed that daintain/AIF-1 accelerated the activation of IGF-1-induced IGF-1R and its downstream signaling pathway.

Materials and methods

Reagents and antibodies

3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenylterazolium bromide (MTT), propidium iodide (PI), Triton X-100 and recombinant human IGF-1 were all purchased from Sigma Chemical Co. (St. Louis, MO, USA). Recombinant human daintain/AIF-1 was prepared by our laboratory according to previous instructions (22). An Annexin V-FITC apoptosis detection kit was obtained from th eBiyuntian Institute of Biotechnology (Shanghai, China). Enzyme-linked immunosorbent assay (ELISA) kits were purchased from R&D Systems (Minneapolis, MN, USA). Primary antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

Cell line and culture

HepG2 cells were purchased from the China Center for Type Culture Collection (CCTCC) and cultured into Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% (v/v) fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/l streptomycin at 37°C in an incubator supplied with 5% CO2.

Secretion of IGF-1, IGF-2 and IGFBP-3

HepG2 cells were plated in 6-well plates and incubated with daintain/AIF-1 at various concentrations in serum-free medium for 72 h. The cell supernatants were then collected to examine the secretion of IGF-1, IGF-2 and IGFBP-3 using commercial ELISA kits.

Reverse transcription polymerase chain reaction (RT-PCR) analysis

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to cDNA using a RevertAid™ cDNA Synthesis kit (Fermentas, Vilnius, Lithuania) according to the manufacturer’s instructions. The primer sequences and reaction conditions of IGF-1, IGF-2, IGFBP-3, IGF-1R and GAPDH are shown in Table I. The PCR products were evaluated by 2% agarose gel electrophoresis.

Table I

Primer sequences and reaction conditions of RT-PCR.

Table I

Primer sequences and reaction conditions of RT-PCR.

GenesPrimersSequences (5′-3′)Annealing temperature (°C)Cycle no.
IGF-1Forward GCATTGTGGATGAGTGTTGC5330
Reverse GGCTCCTCCTACATTCTGTA
IGF-2Forward GAGCTCGAGGCGTTCAGG5830
Reverse GTCTTGGGTGGGTAGAGCAATC
IGFBP-3Forward ATATGGTCCCTGCCGTAGA5530
Reverse AAATCGAGGCTGAGCCAG
GAPDHForward CAAGGTCATCCATGACAACTTTG5625
Reverse GTCCACCACCCTGTTGCTGTAG

[i] IGF, insulin-like growth factor; RT-PCR, reverse transcription polymerase chain reaction.

Western blot analysis

Cell samples were lysed in 20 μl cell lysis buffer containing 1 mM PMSF. The extracted proteins were separated by 12% SDS-PAGE and transferred to PVDF membrane by 2-h electroblotting. The blots were blocked in 5% non-fat dry milk for 1 h at room temperature, and then incubated overnight with corresponding primary antibodies at 4°C. The membrane was washed with TBS containing 0.05% Tween-20 (TBS-T) three times and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The blots were then developed with the enhanced chemiluminescence (ECL) kit (Pierce Biotechnology, Rockford, IL, USA). The optical density of the protein bands was assessed using Image J software.

Cell proliferation assays

Cell proliferation was evaluated by an MTT assay. For the MTT assay, the cells were plated in 96-well plates at a density of 2.5×103 cells/well and incubated overnight with standard culture medium. The cells were then starved for 24 h in serum-free medium. After 24-h cell culture, the original medium was replaced with fresh serum-free medium containing 40 μg/l IGF-1 in the presence or absence of daintain/AIF-1. After incubation for another 24 h, the medium was replaced with 100 μl MTT (0.5 mg/ml) and incubated at 37°C for 4 h. After 4 h, the MTT solution was removed and 100 μl DMSO was added into each well. After agitation for 10 min, the absorbance of each well was measured by a micro-plate reader (Tecan Sunrise, Salzburg, Austria) at a wavelength of 570 nm.

Cell cycle analysis

In order to investigate the distribution of the cell cycle, HepG2 cells were seeded in 6-well plates at a density of 1×106cells/well. After adhesion, the cells were starved for 24 h in serum-free DMEM. The original medium was then replaced with fresh serum-free medium containing 40 μg/l IGF-1 in the presence or absence of daintain/AIF-1. After incubation for 24 h, the cells were collected and analyzed by flow cytometer (FC500; Beckman Coulter, La Brea, CA, USA).

Statistical analysis

The experiments were repeated at least three times. The data were presented as mean ± SD and calculated using the Student’s t-test using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA). A statistically significant difference was considered at P<0.05.

Results

Daintain/AIF-1 promotes the secretion of IGF-1, IGF-2 and IGFBP-3 in HepG2 cells, but fails to modulate their gene expression

Accumulating data have demonstrated that alteration of the autocrine/paracrine loops involving IGFs and IGFBP-3 is associated with the proliferation of HCC cells (8,23–25). Therefore, we examined the effects of daintain/AIF-1 on the production of IGFs and IGFBP-3 in the present study. Enhanced secretion of IGF-1 and IGF-2 was observed due to the stimulation of daintain/AIF-1 (Fig. 1A and B). By contrast, daintain/AIF-1 at the concentration of 5 μM obviously decreased the secretion of IGFBP-3 (Fig. 1C). However, semi-quantitative RT-PCR analysis clearly showed that daintain/AIF-1 had no obvious effect on the gene expression of IGF-1, IGF-2 and IGFBP-3 (Fig. 1D).

Figure 1

Daintain/AIF-1 accelerates the secretion of IGF-1, IGF-2 and IGFBP-3 in HepG2 cells, but has no impact on their gene expression. HepG2 cells were treated with daintain/AIF-1 at designated concentrations for 72 h in serum-free medium. Then, cell-free medium was collected to assess the secretion of (A) IGF-1, (B) IGF-2) and (C) IGFBP-3 by commercial ELISA kits. The mRNA expression of IGF-1, IGF-2 and IGFBP-3 (D) in daintain/AIF-treated cells was evaluated. Data were presented as mean ± SD. A significant difference was considered at *P<0.05 when compared with the control. AIF-1, allograft inflammatory factor-1; ELISA, enzyme-linked immunosorbent assay; IGF, insulin-like growth factor.

Daintain/AIF-1 accelerates the activation of IGF-1-induced IGF-1R in HepG2 cells

Western blot analysis was conducted to examine the effect of daintain/AIF-1 on the IGF-1-induced activation of IGF-1R. As shown in Fig. 2A and C, IGF-1 induced an obvious phosphorylation of IGF-1R and daintain/AIF-1 accelerated IGF-1-induced activation of IGF-1R in a dose-dependent manner (Fig. 2B and D). Similarly, the increased level of phospho-IGF-1R was observed due to the co-incubation of IGF-1 and daintain/AIF-1. HepG2 cells treated with IGF-1 (40 μg/l) for 3 h in the presence of 5 μM daintain/AIF-1 resulted in the maximum increase in phospho-IGF-1R.

Figure 2

Daintain/AIF-1 accelerates the activation of IGF-1R and its downstream signaling pathways in the presence of IGF-1. HepG2 cells were treated with daintain/AIF-1 at the designated concentrations for 24 h in serum-free medium. The daintain/AIF-1-treated HepG2 cells were then stimulated with 40 μg/l IGF-1 for another 15 min and collected to examine the protein expression levels of phospho-IGF-1R and total IGF-1R by (A) western blot analysis. The relative expression or fold-changes of phosphor-IGF-1R after 15 min IGF stimulation was statistically analyzed (C) by measuring the optical density of the protein bands using Image J software. The daintain/AIF-1-treated HepG2 cells were then incubated with 40 μg/l IGF-1 at various time-points and the expression levels of phospho-IGF-1R and total IGF-1R were evaluated by western blot analysis (B). The relative expression or fold-changes of phosphor-IGF-1R during IGF-1 stimulation at various time-points was statistically analyzed (D) by measuring the optical density of protein bands using Image J software. AIF-1, allograft inflammatory factor-1; IGF, insulin-like growth factor. Data were expressed as mean ± SD, and asterisks indicated the statistically significant differences (*P<0.05, **P<0.01 and ***P<0.001) when compared with the control.

Daintain/AIF-1 enhances the activation of IGF-1-induced IGF-1R downstream signaling pathway in HepG2 cells

To determine the role of daintain/AIF-1 in the activation of IGF-1-induced IGF-1R, activation of the downstream signaling pathway of IGF-1R was also examined by western blot analysis. Consistent with the results shown in Fig. 3, IGF-1 enhanced the expression of phospho-AKT, which was further promoted by daintain/AIF-1 in a dose-dependent manner. Similarly, daintain/AIF-1 at the increasing concentration resulted in an elevated expression of phospho-pS6K1. Moreover, in the presence of IGF-1, daintain/AIF-1 stimulation enhanced the expression of cyclin D1, CDK4 and phosphorylated Rb, but had no effect on the expression of cyclin E although IGF-1 alone resulted in an increased expression of cyclin E.

Figure 3

HepG2 cells were treated with daintain/AIF-1 at designated concentrations for 24 h in serum-free medium and then incubated with 40 μg/l IGF-1 for another 3 h. After treatment, the cell proteins were isolated and subjected to the examination of downstream targets of IGF-1R such as p-AKT, p-pS6K1, p-Rb, cyclin E and D1 and CDK4 by western blot analysis. AIF-1, allograft inflammatory factor-1; ELISA, enzyme-linked immunosorbent assay; IGF, insulin-like growth factor.

Daintain/AIF-1 promotes IGF-1-induced proliferation of HepG2 cells

As shown in Fig. 4A, IGF-1 significantly accelerated the cell growth (115% of the control) and daintain/AIF-1 promoted IGF-1-induced cell proliferation. The flow cytometric analysis revealed that IGF-1 stimulation decreased the proportion of HepG2 cells in the G0/G1 phase (from 67.7±5.4 to 54.0±5.1%), but increased the proportion of HepG2 cells in S phase (from 21.9±1.4 to 31.5±2.8%) and G2/M phase (from 12.1±2.4 to 14.3±3.0%) (Fig. 4B). More significant changes in the cell cycle were observed due to the combinatorial application of daintain/AIF-1 and IGF-1. In the presence of IGF-1 (40 μg/l), daintain/AIF-1 reduced the ratio of HepG2 cells in the G0/G1 phase and enhanced the proportion of HepG2 cells in the S and G2/M phase in a dose-dependent manner (Fig. 4B).

Figure 4

Daintain/AIF-1 promotes IGF-1-induced HepG2 cell proliferation and cell-cycle progression. (A) Cell proliferation was analyzed by MTT. (B) The distribution of the cell cycle was analyzed by flow cytometry. Data are presented§ as mean ± SD, and asterisks indicated the statistically significant differences (*P<0.05, and **P<0.01) when compared with the control. AIF-1, allograft inflammatory factor-1; IGF, insulin-like growth factor.

IGF-1R is involved in the promotion of daintain/AIF-1 on IGF-1-induced HepG2 cell proliferation

To confirm whether IGF-1R plays a role in the promotion of daintain/AIF-1 on the IGF-1-induced proliferation of HepG2 cells, the anti-IGF-1R antibody was used to suppress the expression of IGF-1R. The results showed that the anti-IGF-1R neutralizing antibody decreased the proliferation of HepG2 cells under the induction of IGF-1. Furthermore, the promotion effect of daintain/AIF-1 on IGF-1-induced cell proliferation was eliminated due to the blockage of IGF-1R. Of note, after the blockage of IGF-1R, treatment of HepG2 cells with daintain/AIF-1 only caused a slight increase in the cell number (Fig. 5).

Figure 5

The blockage of IGF-1R inhibits IGF-1-induced HepG2 cell proliferation and eliminates the promotion effect of daintain/AIF-1 on IGF-1-induced HepG2 cell proliferation. HepG2 cells were treated with daintain/AIF-1 (5 μM) or anti-IGF-1R antibody (10 ng/ml) alone for 24 and 48 h, or a combinatorial application of daintain/AIF-1 and anti-IGF-1R antibody for 24 and 48 h. Subsequently, 40 μg/l IGF-1 was incubated with the pretreated cells for another 3 h. Following treatment, the cells were collected to analyze the cell proliferation by MTT assay. AIF-1, allograft inflammatory factor-1; IGF, insulin-like growth factor.

Discussion

Although previous findings have demonstrated that daintain/AIF-1 promotes breast cancer cell proliferation via the activation of the NF-κB/cyclin D1 pathway, (16) the precise mechanisms of daintain/AIF-1 for promoting cancer cell proliferation are not completely understood. In the present study, we employed HepG2 cell lines to investigate the molecular mechanism of daintain/AIF-1 on promoting cell proliferation. Our results showed that daintain/AIF-1 is closely associated with the activation of IGF-1-induced IGF-1R and its downstream signaling pathway.

The IGF/IGF-1R axis has been previously found to play a critical role in the development of HCC (3,7,8). IGF-1R is predominantly activated by its ligands, such as IGF-1 and IGF-2. The bioactivity of IGFs can be modulated by IGFBPs due to the high affinity to IGF-1 and IGF-2 (26). IGFBPs can sequester IGF from IGF-1R, thereby attenuating the bioactivity of these growth factors. IGFBP-3 accounts for the majority of circulating IGF (3,27,28). Treatment of HCC cells with recombinant IGFBP-3 can lead to a significant reduction in cell proliferation by inhibiting the activation of IGF-1-induced IGF-1R, ERK and AKT signaling pathways (23). In our study, daintain/AIF-1 enhanced the secretion of IGF-1 and IGF-2, reduced the secretion of IGFBP-3, but had no impact on their gene expression. On the basis of these results, daintain/AIF-1 may be involved in the activation of IGF-1R signaling pathway in HepG2 cells through the elevated IGF-1 and IGF-2.

The activation of IGF-1R is a vital process in the promotion of cell proliferation. Therefore, we monitored IGF-1-induced activation of IGF-1R in the presence of daintain/AIF-1 by western blot analysis. Treatment of HepG2 cells with daintain/AIF-1 for 24 h significantly enhanced IGF-1-induced tyrosine phosphorylation of IGF-1R in a dose- and time-dependent manner.

When IGF-1R is stimulated, the tyrosine kinase activates its downstream signaling pathways, including the Ras/MAPK and PI3K/AKT pathways. The phosphorylation of MAPK can induce a subsequent increase in cell proliferation, and the activation of PI3K/AKT can lead to the modulation of mammalian target of rapamycin (mTOR), thus resulting in translational adaptation (29–31). mTOR can regulate cyclin D1 expression and Rb phosphorylation, and the inhibition of mTOR can arrest cells in the G0/G1 phase of the cell cycle (32,33). Based on our study, daintain/AIF-1 revealed an obvious enhancement on the IGF-1-induced phosphorylation of PI3K/AKT and its downstream target pS6K1. pS6K1 is a key downstream element of the AKT signaling pathway, and the de-phosphorylation of pS6K1 can block the G1 cell cycle progression (34). We have also demonstrated that the incubation of HepG2 cells with daintain/AIF-1 upregulated the expression of cyclin D1, CDK4 and phosphorylated Rb in the presence of IGF-1. Cyclin D1 is important in the transition from G1 to S phase (35,36). Cyclin D1 can couple with CDK4 or CDK6 to form cyclin D1/CDK complexes, thus correspondingly resulting in the activation of CDKs and the phosphorylation of Rb (37,38). Hypophosphorylated Rb can abrogate the inhibitory effect of Rb on the cell-cycle progression and accelerate cell entry into the S phase (39).

The physiological function of daintain/AIF-1 on promoting IGF-1-induced activation of the IGF-1R signaling pathway was confirmed by the MTT assay. The results showed that daintain/AIF-1 markedly promoted IGF-1-induced HepG2 cell proliferation. Data from the flow cytometric analysis also revealed that daintain/AIF-1 accelerated HepG2 cell entry into the S and G2/M phase, which is consistent with our previous observation that daintain/AIF-1 promoted cyclin D1 expression and Rb phosphorylation.

In our study, the blockage of IGF-1R using the anti-IGF-1R antibody inhibited IGF-1-induced HepG2 cell proliferation and eliminated the promotion effect of daintain/AIF-1 on IGF-1-induced HepG2 cell proliferation. These results suggest that the IGF/IGF-1R signaling pathway plays a crucial role in the promotion function of daintain/AIF-1 on IGF-1-induced HepG2 cell proliferation. However, daintain/AIF-1 may have other pathways to promote HepG2 cell proliferation besides the activation of IGF-1R signaling pathway. Moreover, we observed the accelerated migration of HepG2 cells in the presence of IGF-1. However, daintain/AIF-1 failed to modulate IGF-1-induced cell migration (data not shown).

Taken together, according to our current studies and knowledge, daintain/AIF-1 induces activation of the IGF/IGF-1R axis and its downstream signaling pathways by regulating IGF-1, IGF-2 and IGFBP-3 secretion and enhancing IGF-1R sensitivity in the presence of IGF-1 stimulation, thereby resulting in the proliferation of HepG2 cells. However, more studies are required to elucidate the exact mechanisms of daintain/AIF-1 involved in the activation of the IGF-1R signaling pathway and its downstream signaling pathways.

Acknowledgments

This study was supported by the National Science Foundation of China (grant no. 31370773 and 81172511) and the Chutian Scholar Program to N.C. from Education Department of Hubei Province.

References

1 

Bosch FX, Ribes J, Díaz M and Cléries R: Primary liver cancer: worldwide incidence and trends. Gastroenterology. 127(Suppl 1): S5–S16. 2004. View Article : Google Scholar : PubMed/NCBI

2 

LeRoith D and Roberts CT Jr: The insulin-like growth factor system and cancer. Cancer Lett. 195:127–137. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Pollak MN, Schernhammer ES and Hankinson SE: Insulin-like growth factors and neoplasia. Nat Rev Cancer. 4:505–518. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Khandwala HM, McCutcheon IE, Flyvbjerg A and Friend KE: The effects of insulin-like growth factors on tumorigenesis and neoplastic growth. Endocr Rev. 21:215–244. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Baserga R: Oncogenes and the strategy of growth factors. Cell. 79:927–930. 1994. View Article : Google Scholar : PubMed/NCBI

6 

Reynolds AR and Kyprianou N: Growth factor signalling in prostatic growth: significance in tumour development and therapeutic targeting. Br J Pharmacol. 147(Suppl 2): S144–S152. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Scharf JG and Braulke T: The role of the IGF axis in hepatocar-cinogenesis. Horm Metab Res. 35:685–693. 2003. View Article : Google Scholar

8 

Alexia C, Fallot G, Lasfer M, Schweizer-Groyer G and Groyer A: An evaluation of the role of insulin-like growth factors (IGF) and of type-I IGF receptor signalling in hepatocarcinogenesis and in the resistance of hepatocarcinoma cells against drug-induced apoptosis. Biochem Pharmacol. 68:1003–1015. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Chen ZW, Ahren B, Ostenson CG, Cintra A, Bergman T, Möller C, Fuxe K, Mutt V, Jörnvall H and Efendic S: Identification, isolation, and characterization of daintain (allograft inflammatory factor 1), a macrophage polypeptide with effects on insulin secretion and abundantly present in the pancreas of prediabetic BB rats. Proc Natl Acad Sci USA. 94:13879–13884. 1997. View Article : Google Scholar

10 

Utans U, Arceci RJ, Yamashita Y and Russell ME: Cloning and characterization of allograft inflammatory factor-1: a novel macrophage factor identified in rat cardiac allografts with chronic rejection. J Clin Invest. 95:2954–2962. 1995. View Article : Google Scholar : PubMed/NCBI

11 

Tian Y, Kelemen SE and Autieri MV: Inhibition of AIF-1 expression by constitutive siRNA expression reduces macrophage migration, proliferation, and signal transduction initiated by atherogenic stimuli. Am J Physiol Cell Physiol. 290:C1083–C1091. 2006. View Article : Google Scholar

12 

Yang ZF, Ho DW, Lau CK, Lam CT, Lum CT, Poon RT and Fan ST: Allograft inflammatory factor-1 (AIF-1) is crucial for the survival and pro-inflammatory activity of macrophages. Int Immunol. 17:1391–1397. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Kimura M, Kawahito Y, Obayashi H, Ohta M, Hara H, Adachi T, Tokunaga D, Hojo T, Hamaguchi M, Omoto A, et al: A critical role for allograft inflammatory factor-1 in the pathogenesis of rheumatoid arthritis. J Immunol. 178:3316–3322. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Del Galdo F, Maul GG, Jiménez SA and Artlett CM: Expression of allograft inflammatory factor 1 in tissues from patients with systemic sclerosis and in vitro differential expression of its isoforms in response to transforming growth factor beta. Arthritis Rheum. 54:2616–2625. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Pashenkov M, Efendic S, Zhu J, Zou LP, Ostenson CG and Mustafa M: Augmented expression of daintain/allograft inflammatory factor-1 is associated with clinical disease: dynamics of daintain/allograft inflammatory factor-1 expression in spleen, peripheral nerves and sera during experimental autoimmune neuritis. Scand J Immunol. 52:117–122. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Liu S, Tan WY, Chen QR, Chen XP, Fu K, Zhao YY and Chen ZW: Daintain/AIF-1 promotes breast cancer proliferation via activation of the NF-kappaB/cyclin D1 pathway and facilitates tumor growth. Cancer Sci. 99:952–957. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Li T, Feng Z, Jia S, Wang W, Du Z, Chen N and Chen Z: Daintain/AIF-1 promotes breast cancer cell migration by up-regulated TNF-α via activate p38 MAPK signaling pathway. Breast Cancer Res Treat. 131:891–898. 2012. View Article : Google Scholar

18 

Balkwill F and Mantovani A: Inflammation and cancer: back to Virchow? Lancet. 357:539–545. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM and Karin M: Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production. Science. 317:121–124. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Fausto N, Campbell JS and Riehle KJ: Liver regeneration. Hepatology. 43(Suppl 1): S45–S53. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Nagakawa Y, Nomoto S, Kato Y, Montgomery RA, Williams GM, Klein AS and Sun Z: over-expression of AIF-1 in liver allografts and peripheral blood correlates with acute rejection after transplantation in rats. Am J Transplant. 4:1949–1957. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Hirsch J, Hansen KC, Choi S, Noh J, Hirose R, Roberts JP, Matthay MA, Burlingame AL, Maher JJ and Niemann CU: Warm ischemia-induced alterations in oxidative and inflammatory proteins in hepatic Kupffer cells in rats. Mol Cell Proteomics. 5:979–986. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Huynh H, Chow PK, Ooi LL and Soo KC: A possible role for insulin-like growth factor-binding protein-3 autocrine/paracrine loops in controlling hepatocellular carcinoma cell proliferation. Cell Growth Differ. 13:115–122. 2002.PubMed/NCBI

24 

Aishima S, Basaki Y, Oda Y, Kuroda Y, Nishihara Y, Taguchi K, Taketomi A, Maehara Y, Hosoi F, Maruyama Y, et al: High expression of insulin-like growth factor binding protein-3 is correlated with lower portal invasion and better prognosis in human hepatocellular carcinoma. Cancer Sci. 97:1182–1190. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Lund P, Schubert D, Niketeghad F and Schirmacher P: Autocrine inhibition of chemotherapy response in human liver tumor cells by insulin-like growth factor-II. Cancer Lett. 206:85–96. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Firth SM and Baxter RC: Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23:824–854. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Yakar S, Wu Y, Setser J and Rosen CJ: The role of circulating IGF-I: lessons from human and animal models. Endocrine. 19:239–248. 2002. View Article : Google Scholar

28 

Bach LA, Headey SJ and Norton RS: IGF-binding proteins - the pieces are falling into place. Trends Endocrinol Metab. 16:228–234. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Adams TE, Epa VC, Garrett TP and Ward CW: Structure and function of the type 1 insulin-like growth factor receptor. Cell Mol Life Sci. 57:1050–1093. 2000. View Article : Google Scholar : PubMed/NCBI

30 

Butler AA, Yakar S, Gewolb IH, Karas M, Okubo Y and LeRoith D: Insulin-like growth factor-I receptor signal transduction: at the interface between physiology and cell biology. Comp Biochem Physiol B Biochem Mol Biol. 121:19–26. 1998. View Article : Google Scholar

31 

Dearth RK, Cui X, Kim HJ, Hadsell DL and Lee AV: Oncogenic transformation by the signaling adaptor proteins insulin receptor substrate (IRS)-1 and IRS-2. Cell Cycle. 6:705–713. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Hashemolhosseini S, Nagamine Y, Morley SJ, Desrivières S, Mercep L and Ferrari S: Rapamycin inhibition of the G1 to S transition is mediated by effects on cyclin D1 mRNA and protein stability. J Biol Chem. 273:14424–14429. 1998. View Article : Google Scholar : PubMed/NCBI

33 

Chen Y, Knudsen ES and Wang JY: The RB/p107/p130 phosphorylation pathway is not inhibited in rapamycin-induced G1-prolongation of NIH3T3 cells. Oncogene. 13:1765–1771. 1996.PubMed/NCBI

34 

Gao N, Flynn DC, Zhang Z, Zhong XS, Walker V, Liu KJ, Shi X and Jiang BH: G1 cell cycle progression and the expression of G1 cyclins are regulated by PI3K/AKT/mTOR/p70S6K1 signaling in human ovarian cancer cells. Am J Physiol Cell Physiol. 287:C281–C291. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Burkhart DL and Sage J: Cellular mechanisms of tumour suppression by the retinoblastoma gene. Nat Rev Cancer. 8:671–682. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Santamaria D and Ortega S: Cyclins and CDKS in development and cancer: lessons from genetically modified mice. Front Biosci. 11:1164–1188. 2006. View Article : Google Scholar

37 

Malumbres M and Barbacid M: Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer. 9:153–166. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Lindqvist A, Rodríguez-Bravo V and Medema RH: The decision to enter mitosis: feedback and redundancy in the mitotic entry network. J Cell Biol. 185:193–202. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Schuuring E, Verhoeven E, Mooi WJ and Michalides RJ: Identification and cloning of two overexpressed genes, U21B31/PRAD1 and EMS1, within the amplified chromosome 11q13 region in human carcinomas. Oncogene. 7:355–361. 1992.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jia S, Du Z, Jiang H, Huang X, Chen Z and Chen N: Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells. Oncol Rep 34: 511-517, 2015.
APA
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., & Chen, N. (2015). Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells. Oncology Reports, 34, 511-517. https://doi.org/10.3892/or.2015.4002
MLA
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., Chen, N."Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells". Oncology Reports 34.1 (2015): 511-517.
Chicago
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., Chen, N."Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells". Oncology Reports 34, no. 1 (2015): 511-517. https://doi.org/10.3892/or.2015.4002
Copy and paste a formatted citation
x
Spandidos Publications style
Jia S, Du Z, Jiang H, Huang X, Chen Z and Chen N: Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells. Oncol Rep 34: 511-517, 2015.
APA
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., & Chen, N. (2015). Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells. Oncology Reports, 34, 511-517. https://doi.org/10.3892/or.2015.4002
MLA
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., Chen, N."Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells". Oncology Reports 34.1 (2015): 511-517.
Chicago
Jia, S., Du, Z., Jiang, H., Huang, X., Chen, Z., Chen, N."Daintain/AIF-1 accelerates the activation of insulin-like growth factor-1 receptor signaling pathway in HepG2 cells". Oncology Reports 34, no. 1 (2015): 511-517. https://doi.org/10.3892/or.2015.4002
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team