20(S)-ginsenoside Rh2 inhibits the proliferation and induces the apoptosis of KG-1a cells through the Wnt/β-catenin signaling pathway

  • Authors:
    • Yi Chen
    • Ze-Hong Liu
    • Jing Xia
    • Xiao-Peng Li
    • Ke‑Qiong Li
    • Wei Xiong
    • Jing Li
    • Di-Long Chen
  • View Affiliations

  • Published online on: April 27, 2016     https://doi.org/10.3892/or.2016.4774
  • Pages: 137-146
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Previous research has shown that total saponins of Panax ginseng (TSPG) and other ginsenoside monomers inhibit the proliferation of leukemia cells. However, the effect has not been compared among them. Cell viability was determined by Cell Counting Kit-8 assay, and ultra-structural characteristics were observed under transmission electron microscopy. Cell cycle distribution and apoptosis were determined by flow cytometry (FCM). Real-time fluorescence quantitative‑PCR, western blotting and immunofluorescence were used to measure the expression of β-catenin, TCF4, cyclin D1 and NF-κBp65. β-catenin/TCF4 target gene transcription were observed by ChIP-PCR assay. We found that 20(S)-ginsenoside Rh2 [(S)Rh2] inhibited the proliferation of KG-1a cells more efficiently than the other monomers. Moreover, (S)Rh2 arrested KG-1a cells in the G0/G1 phase and induced apoptosis. In addition, the levels of β-catenin, TCF4, cyclin D1 mRNA and protein were decreased. The ChIP-PCR showed that (S)Rh2 downregulated the transcription of β-catenin/TCF4 target genes, such as cyclin D1 and c-myc. These results indicated that (S)Rh2 induced cell cycle arrest and apoptosis through the Wnt/β-catenin signaling pathway, demonstrating its potential as a chemotherapeutic agent for leukemia therapy.

Introduction

Leukemia is a type of hematological malignancy of the blood and the bone marrow characterized by an abnormal increase in immature hemamegba called 'blasts' (1). Chemotherapy drugs kill cancer cells as well as normal cells, leading to significant side effects (2). As a step in overcoming this limitation in chemotherapy, medicines prepared from natural traditional Chinese medicine (TCM) are currently being considered as anticancer agents (3,4). In the past decades, a series of studies have demonstrated that many extracted products from natural plants can kill cancer cells including leukemia cells in vitro (5).

Ginsenosides (total saponins of Panax ginseng, TSPG), are important components extracted from the root of Panax ginseng. TSPG as an extract of a medicinal plant is used in a wide range of ailments and has been reported to have various potent biological functions, including improvement of physical and mental capacity, reduction of fatigue, regulation of the central nervous system and antitumor effects (610). TSPG includes many monomers, such as ginsenoside Rb1 (Rb1), ginsenoside Re (Re), ginsenoside Rg1 (Rg1), ginsenoside Rg3 (Rg3), 20(S)-ginsenoside Rh2 [(S)Rh2] and compound K. TSPG shows enhancement of proliferation and differentiation of bone marrow cells (912). To date, TSPG and its monomers have not been compared in regard to their effects on cell viability, thus research on the effects of TSPG and other monomers on proliferation inhibition in KG-1a cells is warranted.

(S)Rh2 belongs to the protopanaxadiol family and has attracted attention in the research concerning chemoprevention and chemotherapy (1315). Recently, researchers have found that (S)Rh2 exhibits anticancer functions and inhibits the growth and induces the apoptosis of various cancer cell lines, including leukemia cells (10,1620). Evidence has proven that (S)Rh2 displays a marked inhibitory effect on leukemia cells, although its specific molecular mechanism is not well understood. Moreover, the Wnt pathway is apparently related to tumor progression. Therefore, we hypothesized that there may be some correlation between (S)Rh2 and the Wnt pathway.

The Wnt signaling pathway plays an important role in embryogenesis and shows little or no activity in fully differentiated cells (21). Self-renewal, proliferation and differentiation are tightly controlled during normal hematopoiesis to ensure lifelong hematopoietic stem cell homeostasis and blood production (22). Deregulation of these processes results in hematologic dysplasia, deficiency, myeloproliferation or leukemia. The unnatural activity of the Wnt pathway is involved in the development of several types of cancer (23). For acute myeloid leukemia (AML), it has been confirmed that Wnt genes are overexpressed and activated (24). The importance of the Wnt pathway for AML cell survival has been demonstrated by the fact that inhibition of the pathway results in the decline of cell growth (25). (S)Rh2 can obviously inhibit proliferation, differentiation and promote apoptosis of leukemia cells, yet its mechanisms are not fully clear. For the purpose of exploiting new strategies for tumor treatment, it is important to illuminate the concrete mechanism of (S)Rh2 in regards to its effect on leukemia, which is vital to clinical experimental research.

Materials and methods

Reagents and cell culture

TSPG, Rb1, Re, Rg1, Rg3 and (S)Rh2 were purchased from Nanjing Ze Lang Pharmaceutical Technology (Nanjing, China). Structures of Rb1, Re, Rg1, Rg3 and (S)Rh2 are shown (Fig. 1). These agents were dissolved in dimethyl sulfoxide (DMSO) at a concentration of 100 mM and stored at −20°C. Human leukemia KG-1a cells were cryo-preserved in our laboratory, and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% fetal bovine serum (HyClone, Waltham, MA, USA) at 37°C in air 5% CO2 incubator at constant humidity, and maintained for logarithmic growth by passaging cells every 48 h.

CCK-8 assay

The CCK-8 assay was employed for determination of cell viability. Briefly, 1.0×104 cells/well were planted in 96-well plates and cultured for different times. At the end of the time, 10 µl CCK-8 working solution was added to each well and then cultured at 37°C for 2 h. Then plates were detected at 450 nm on a spectrophotometric plate reader. The drug concentration resulting in 50% inhibition of growth (IC50) was determined.

Transmission electron microscopic observation

For the ultra-structural characteristic observation assay, cells were harvested and fixed at 1.0×107 with 2.5% glutaraldehyde for 6 h at 4°C and then with 1% osmium tetroxide for 2 h prior to dehydration with ethyl alcohol. Ultra-thin sections (60 nm) were prepared and placed on grids, stained with 2% uranyl acetate solution and 0.2% lead citrate in 0.1 M NaOH. The cells were observed by a H-600 transmission electron microscope (Hitachi, Japan).

Cell cycle assay

The KG-1a cells were plated at a concentration of 2.0×105 cells/ml and incubated with (S)Rh2 or TSPG for 48 h. The cells were collected by centrifugation at 1,000 × g for 3 min, added to 70% ethanol and then washed once with PBS. The cells were then resuspended in 1 ml of PBS containing 2.5 µg/ml ribonuclease and 50 µg/ml propidium iodide (Beyotime Institute of Biotechnology, Shanghai, China), incubated in the dark for 30 min at room temperature and analyzed using flow cytometry (FCM).

Cell apoptosis assay

Briefly, for the Annexin V assay, the cells were seeded at a concentration of 2.0×105 cells/ml and incubated with (S)Rh2 or TSPG for 48 h. Samples were prepared based on the instructions provided together with the Annexin V apoptosis kit. Briefly, after treatment for the indicated times, the cells were collected and washed twice with binding buffer containing 10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2. Next, 1.0×105 cells were resuspended in 100 µl of binding buffer, and then 5 µl of Annexin V-FITC and 10 µl of propidium iodide (50 µg/ml, stock concentration) were added to the cell suspension. After gently mixing, the cells were incubated for 15 min at room temperature, and then 400 µl of binding buffer was added to get the sample ready. Quantification of cell death was analyzed with a BD FACScan.

Immunofluorescence staining

In brief, KG-1a cells cultured in 6-well plates were treated with DMSO or (S)Rh2 (60 µM) for 24 h. The cells were washed with ice-cold phosphate buffered saline (PBS) three times and fixed with 4% paraformaldehyde. The cell membrane was ruptured by 0.3% tristone, and closed with mountain goat serum (HyClone, Waltham, MA, USA). Antibodies against β-catenin (1:100), TCF4 (1:100), cyclin D1 (1:100), NF-κBp65 (1:100) (Santa Cruz Biotechnology Inc., Santa Cruz, USA) were added respectively. Anti-rabbit secondary fluorescent antibody was added and incubated overnight for 1 h, and stained with PI (Beyotime Institute of Biotechnology, Shanghai, China). Then, 50% glycerol was used for mounting, and imaging was carried out under a fluorescence microscope (Olympus, Tokyo, Japan).

Quantitative real-time PCR (qRT-PCR)

Following treatment, the cells were harvested and total RNA was immediately extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. For expression analysis of β-catenin, TCF4, cyclin D1 and NF-κBp65 genes, 2 µg of total RNA was used to synthesize first-strand DNA with reverse transcriptase according to the manufacturer's instructions (Promega, Madison, WI, USA). Quantitative RT-PCR (qRT-PCR) was performed with a Green PCR Master Mix kit (Shanghai, Shine Co, China). Briefly, one microliter of first-strand cDNA and gene-specific primers were used along with Hotstart Fluo-PCR Mix in a 20-µl reaction under the following conditions: pre-denaturation at 95°C for 5 min, 35 cycles of denaturation at 95°C for 10 sec, annealing at 57°C for 15 sec, and extension at 72°C for 20 sec. Each sample was performed in triplicate and was quantified based on the formula 2−ΔCt. The primer pairs for qRT-PCR are listed in Table I.

Table I

Primer pairs for qRT-PCR.

Table I

Primer pairs for qRT-PCR.

Gene nameSequence (5′-3′)
β-cateninF: CAAAGCCTCAGGTCATAAACA
R: GTGGGATGGTGGGTGTAAGA
TCF4F: TGAGGTCCTGATGCGGTTGG
R: TCGCCTTTGTTCTCCTTGATGC
Cyclin D1F: AGGCTGGCTTCATCCACT
R: CACCAAGGGTTAATTCTTCA
NF-κBp65F: CCCCACGAGCTTGTAGGAAAG
R: CCAGGTTCTGGAAACTGTGGAT
GAPDHF: CATCAAGAAGGTGGTGAAGCA
R: CGTCAAAGGTGGAGGAGTGG

[i] F, forward; R, reverse.

Western blotting

Following treatment with (S)Rh2 for 48 h, the cells were lysed in ice-cold RIPA lysis buffer. The lysates were centrifuged at 15,000 × g for 10 min at 4°C to obtain the proteins. The protein content of the cell extracts was determined by bicinchonininc acid (BCA). A total of 30–40 µg of protein was electrophoresed on 10–15% SDS-PAGE gels and transferred to PDVF membranes. The membranes were blocked, incubated with the primary Abs at the appropriate concentration, and subsequently incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (1:2,000 dilutions). Labeled bands were detected by Immun-Star TMHRP Chemiluminescent kit, and images were captured and the intensity of the bands was quantified by the Bio-Rad VersaDoc™ image system (Bio-Rad, Regents Park, Australia).

Chromatin immunoprecipitation (ChIP) assays

For the ChIP assay, KG-1a cells were treated with DMSO (control), or 60 µM (S)Rh2 for 48 h. Treated cells were cross-linked with 1% formaldehyde for 15 min at room temperature. The cross-linked cells were then resuspended in 0.3 ml of lysis buffer (50 mM Tris-HCl, pH 8.1/1% SDS/10 mM EDTA protease inhibitors) and subjected three times for 10 sec followed by centrifugation for 10 min. The average size of the sheared fragment was expected to be 300–1,000 bp. Immunoprecipitates were collected three times with 1% SDS/0.1 M NaHCO3. Eluates were pooled and heated at 65°C for 6 h to reverse the formaldehyde cross-linking. DNA fragments were purified with a QIAquick spin kit (Qiagen, Chatsworth, CA, USA). For PCR, 1 µl from a 50 µl DNA extraction and 38 cycles of amplification were used with the following promoter-specific primers: c-myc forward, 5-GCTTGGCGGGAAAAAGAA GGG-3 and reverse, 5-AGAGCTGCCTTCTTAGGTCG-3; cyclin D1 forward, 5-GTTCCTGGAAGGGCGACTAA-3 and reverse, 5-GGGGTGGGATCTGAGATTTG-3.

Statistical analysis

The intensity of the immunoreactive band was determined by a densitometer (Bio-Rad, Hercules, CA, USA). Data are expressed as the mean ± SEM of three independent experiments, and one-way ANOVA analysis was conducted using the statistical software SPSS 22.0. Each treatment group was compared with the control group with Dunnett's t-test, and P-value <0.05 was considered to indicate a statistically significant result.

Results

TSPG, Rb1, Re, Rg1, Rg3 and (S)Rh2 inhibit the growth of KG-1a cells

We assessed the effects of TSPG, Rb1, Re, Rg1, Rg3 and (S)Rh2 on the cell viability of KG-1a cells using Cell Counting Kit-8 assays. (S)Rh2 was found to have a marked inhibitory effect on KG-1a cells at a lower concentration, compared with Rb1, Re, Rg1 and Rg3. (S)Rh2 had the lowest IC50 values (in the mid-µM range) compared with the other ginsenosides tested. Rb1, Re, Rg1, Rg3 did not significantly decrease cell viability even at the high-µM range. These results showed that (S)Rh2 decreased the viability of the KG-1a cells. TSPG had a lesser effect on viability than the other members of the ginsenosides in the KG-1a cells (Fig. 2).

TSPG and (S)Rh2 induce the apoptosis of KG-1a cells

Further experiments were performed using KG-1a cells to evaluate the effect of TSPG and (S)Rh2 on apoptosis and the mechanism involved. To determine whether the cell growth inhibitory effect of TSPG and (S)Rh2 is associated with the induction of cell apoptosis, we used Annexin V/7-AAD double staining. Annexin V+ and 7-AAD cells were designated as early apoptotic and Annexin V+ and 7-AAD+ cells were designated as necrotic. A higher number of apoptotic cells was observed in the TSPG (400 mg/l) and (S)Rh2 (60 µM) treatment groups than that in the control group (Fig. 3A). Analysis of the cell population revealed distinct sets of populations. Following treatment with TSPG (400 mg/l) and (S)Rh2 (60 µM) for 24 h, the percentage of Annexin V+ and 7-AAD apoptotic cells increased gradually from 3.10 to 8.63 and 19.53%, while the percentage of FITC+/7-AAD+ necrotic cells increased from 2.17 to 6.68 and 16.52% (Fig. 3B). These results revealed that (S)Rh2 was significantly more potent at inducing apoptosis than TSPG. To further characterize the TSPG- and (S)Rh2-induced apoptosis, we observed ultra-microstructures in the KG-1a cells following treatment with TSPG (400 mg/l) or (S)Rh2 (60 µM) for 48 h. These cells had different levels of apoptosis, chromatin occured margination, nucleoli decreased or disappeared, and apoptotic bodies increased (Fig. 3C). In addition to its anti-proliferative effects, we also noted that (S)Rh2 caused an increase in apoptosis in the KG-1a cells. Thus, we assessed the expression of several apoptosis-related proteins, including Bcl-2, Bax and cleaved caspase-3. The effect on apoptosis was consistent with the cell apoptosis assay. (S)Rh2 increased the expression of Bcl-2 and cleaved caspase-3 (Fig. 3D and E). Cleaved caspase-3 was activated. We demonstrated that (S)Rh2 induced apoptosis via both the intrinsic and extrinsic pathways.

(S)Rh2 induces cell cycle arrest at the G0/G1 phase in the KG-1a cells

CCK-8 results showed that TSPG and (S)Rh2 inhibited the proliferation of the KG-1a cells. To determine whether the cell growth inhibitory effect of (S)Rh2 is associated with cell cycle arrest, changes in cell cycle distribution were detected by flow cytometry. Compared with the percentage in the control group, the KG-1a cells after treatment with (S)Rh2 (60 µM) showed an increased percentage of cells in the G0/G1 phase from 20.08±3.12 to 48.76±4.22%; the percentage in the S phase decreased from 64.87±0.52 to 39.22±0.86%; the percentage in the G2/M phase decreased from 15.05±3.92 to 12.02±2.81% (Fig. 4A and B), and the difference was statistically significant (p<0.05). (S)Rh2 induced KG-1a cell cycle arrest at the G0/G1 phase. TSPG also had an effect on cell cycle arrest (data not shown). To further explore the underlying mechanisms, we studied the expression of cell cycle-associated proteins. We found that (S)Rh2 decreased the level of cyclin D1. The decreased expression of cyclin D1 may be associated with the G0/G1 cell cycle arrest induced by (S)Rh2. The results shown that (S)Rh2 induced KG-1a cell cycle arrest at the G0/G1 phase.

(S)Rh2 affects the localization and expression of β-catenin, NF-κBp65, TCF-4, and cyclin D1 protein in the KG-1a cells

Since nuclear β-catenin is a hallmark of the activated Wnt/β-catenin signaling, we performed immunofluorescence to determine the localization of β-catenin to further validate the activation of Wnt/β-catenin signaling. As shown in Fig. 5A, treated cells exhibited strong green fluorescence in the cytoplasm, and a small amount of green fluorescence could be visible in the nucleus. Compared with the control group, β-catenin was obvious altered in the cytoplasm. TCF4 was expressed mainly in the nucleus and the expression of TCF4 in the nucleus, was significantly decreased after (S)Rh2 treatment for 48 h (Fig. 5B). Cyclin D1 was expressed in the cytoplasm or nucleus. The expression level was significantly reduced after (S)Rh2 treatment for 48 h (Fig. 5C). NF-κBp65 is mainly in the nucleus or cytoplasm, and its expression in the nucleus in the cells following treatment with (S)Rh2 for 48 h was significantly reduced (Fig. 5D). Taken together, these data suggest that (S)Rh2 induced KG-1a cell cycle arrest at the G0/G1 phase, and may be responsible for the downregulation of the Wnt/β-catenin signaling pathway enhancing the cell cycle arrest of KG-1a cells.

(S)Rh2 affects the mRNA level and protein expression of β-catenin, TCF-4, cyclin D1 and NF-κBp65 in the KG-1a cells

KG-1a cells were treated with (S)Rh2 (60 µM) for 48 h. We assessed the mRNA level and protein expression of several Wnt/β-catenin pathway-related and cell cycle-related proteins, including β-catenin, TCF-4, cyclin D1 and NF-κBp65 (Fig. 6). Treatment with (S)Rh2 (60 µM) for 48 h caused significant downregulation of the mRNA expression of β-catenin, TCF-4, NF-κBp65 and cyclin D1 in the KG-1a cells, compared with the control group (Fig. 6A). We also found that in the (S)Rh2 treatment group reduced protein expression of β-catenin, TCF4, NF-κBp65 and cyclin D1 was noted in the KG-1a cells (Fig. 6C and D). (S)Rh2 affected the gene transcription of c-myc and cyclin D1 in the KG-1a cells. The ChIP-PCR assay shown that (S)Rh2 decreased the β-catenin/TCF4 target gene transcription, such as c-myc and cyclin D1. These genes are involved in apoptosis and proliferation, The ChIP-PCR assay was performed using TCF4 IgG (Fig. 6B). The downstream genes of the Wnt/β-catenin pathway including β-catenin, NF-κB and cyclin D1 were also downregulated, further suggesting that (S)Rh2 induced KG-1a cell cycle arrest at the G0/G1 phase and apoptosis by the Wnt/β-catenin pathway.

Discussion

While cytotoxic agents are often used as traditional chemotherapy drug, there is an ongoing search for more effective specific agents that spare normal host tissues. Numerous natural TCM products have anticancer properties. These compounds generally have low toxicity and have protective effects against a variety of cancers (26). On the basis of research in vitro, we and other researchers have demonstrated that a structure-activity relationship exists among the ginsenosides, with the panaxadiols generally being more active than the panaxatriols in the killing of cancer cells, and the glycerogelatin compounds being less active as the number of sugar moieties increases (Fig. 1). To our knowledge, (S)Rh2 is one of the most active ginsenosides to be evaluated. (S)Rh2 demonstrated strong effects, and was more effective at lower doses than TSPG, Rb1, Re, Rg1, Rg3 in KG-1a cells. The obvious cancer-specific effects of these compounds can be distinguished from the chemical structure. These may be ascribed to their differential chemical structure. Anticancer activities increase with a decrease in the number of sugar moieties in a ginsenoside molecule. Ginsenosides with four or more sugar molecules, for example Rb1, showed no significant anti-proliferative effects; while Re with three sugar residues weakly inhibited the growth of KG-1a cells; Rg3 and Rg1 (with two sugar residues), and (S)Rh2 (with one sugar residue) have been found to inhibit various types of cancer cells and also enhance the efficacy of chemotherapy agents when treated in combination (27). (S)Rh2 showed a 2- to 14-fold relatively stronger anti-proliferative effect than TSPG, Rb1, Re, Rg1, Rg3. (S)Rh2 inhibited the proliferation and induced the apoptosis of KG-1a cells although the possible molecular mechanisms require further study.

(S)Rh2 demonstrated anti-proliferative, and proapoptotic effects and regulation of cell cycle progression. Although TSPG may be marketed as an anticancer agent, it did not exert any appreciable effect on KG-1a cells. (S)Rh2 demonstrated a more potent effect and was more effective at lower doses than the other compounds. (S)Rh2 exhibited decreases in survival and proliferation, increases in apoptosis and cell cycle arrest at the G1 phase in KG-1a cells (Fig. 4). Apoptosis is an evolutionarily conserved form of cell suicide and is characterized by distinctive morphological changes. We observed that TSPG (400 mg/l) and (S)Rh2 (60 µM) increased condensed apoptotic nuclei (Fig. 3C), as evidenced by chromosomal condensation and formation of apoptotic bodies. TSPG and (S)Rh2 increased the percentage of Annexin V+/7-AAD KG-1a cells as evidence of apoptosis (Fig. 3A and B). Our findings also revealed that (S)Rh2 can induce apoptosis in KG-1a cells more efficiently than TSPG.

The Wnt/β-catenin signaling pathway is an importantly drug discovery target (28). β-catenin is an important factor involved in the regulation of apoptosis and proliferation in the Wnt signaling pathway. The Wnt/β-catenin signaling pathway may have abnormal activation in acute leukemia cells (29). One study has demonstrated that the accumulation of β-catenin is prompted by increased β-catenin/TCF4 transcriptional activity in the cytoplasm and nucleus, and nuclear β-catenin accumulation implicates Wnt signaling pathway activation (30). Therefore, Wnt signaling pathway inhibitors can induce apoptosis and inhibit proliferation in acute leukemia (31). The immunofluorescence experiments confirmed that (S)Rh2 reduced the β-catenin protein transfer from the cytoplasm to the nucleus in KG-1a cells. Real-time PCR, immunofluorescence and western blotting confirmed that (S)Rh2 significantly reduced β-catenin mRNA and protein expression compared with the control group in the KG-1a cells. Thus, the Wnt/β-catenin pathway is likely to be an (S)Rh2 target for the treatment of acute leukemia.

TCF4 is a nuclear transcription factor and has a molecule 'switch' dual function (32). The Wnt/β-catenin pathway depends on the presence of different Wnt molecules that bind to the frizzled receptor. When Wnt/β-catenin pathway proteins are activated, several proteins that are important for the phosphorylation of β-catenin require the receptor. Binding of these proteins enables β-catenin to accumulate in the cytoplasm and translocate into the nucleus, where it interacts with members of the TCF4 transcription factor family to induce target gene expression (33,34). When Wnt/β-catenin pathway proteins are inactivated, several proteins are released from the frizzled receptor and TCF4 family to restraint target gene expression (35,36). Our experiment demonstrated that (S)Rh2 decreased the protein and mRNA expression of TCF4 in KG-1a cells. Immunofluorescence results showed that TCF4 is mainly located in the nucleus, and (S)Rh2 significantly reduced TCF4 expression. ChIP-PCR assays also showed that (S)Rh2 downregulated the transcription of β-catenin/TCF4 target genes, such as cyclin D1 and c-myc. β-catenin/TCF4 associated cell proliferation is provided by cyclin D1 and c-myc which have been reported to be regulated in the wnt pathway (3739). Therefore, we speculate that (S)Rh2 can reduce nuclear β-catenin expression and restrain activation of β-catenin downstream genes in KG-1a cells.

Cyclin D1 is a Wnt/β-catenin downstream target gene (40,41). Wnt/β-catenin pathway activated cyclin D1, disrupting the cell cycle leading to cell abnormal proliferation in AML (42). TCF4/β-catenin complex can directly stimulate the activity of CDKs promoting cell cycle by upregulating cyclin D1. Cyclin D1 is a cell cycle-related oncogene, which significantly reduces the cells in the G1 phase by inactivation of (S)Rh2, suppressing malignant cell proliferation. The experiment showed that (S)Rh2 arrested KG-1a cells in the G0/G1 phase. Immunofluorescence and western blotting showed that cyclin D1 protein was significantly reduced. It can be seen that (S)Rh2 reduced cyclin D1 gene transcription and protein expression levels. ChIP-PCR also showed that (S)Rh2 downregulated β-catenin/TCF4 target gene transcription, such as cyclin D1 which is a downstream gene of the Wnt/β-catenin signaling pathways. Thus, these results indicate that (S)Rh2 induced cycle arrest at the G0/G1 phase, inhibited proliferation and promoted apoptosis in the KG-1a cells.

NF-κB is an important member of the Rel gene family that causes many hematologic malignancies and interacts with members of the TCF transcription factor family to induce target gene expression-induced apoptosis and cell cycle arrest (43,44). This study showed that the expression of NF-κBp65 was reduced and shifted to the cell cytoplasm from the nucleus following gradual treatment with (S)Rh2 in the KG-1a cells. The NF-κB and Wnt signaling pathways can regulate the same target gene transcription which is mainly associated with cell proliferation, cell cycle regulation and apoptosis (45). The irregular activation of gene promoter through NF-κB and TCF targeted activation of cyclin D1 and c-myc resulting in abnormal proliferation of tumor cells (46). (S)Rh2 inhibited proliferation and induced apoptosis possibly through inhibition of the Wnt and NF-κB pathways in the KG-1a cells.

In the present study, we found that (S)Rh2 played an antitumor role accompanied by β-catenin protein expression. When chromatin is in a state of relaxation, β-catenin can combine with TCF4 in the nucleus. Here, TCF4 competes with β-catenin to form a complex and is recruited to target promoters to suppress their expression, such as c-myc, Bcl-2, cyclin D1, thus inhibiting proliferation and promoting apoptosis in human leukemic cells (47). We detected that Bax, Bcl-2, cyclin D1 and cleaved caspase-3 protein was increased in the (S)Rh2-treated group. At the same time, (S)Rh2 inhibited proliferation and apoptosis through the Wnt/β-catenin signaling pathway in human leukemic KG-1a cells.

In conclusion, we initially considered that (S)Rh2 more efficiently inhibits the proliferation and induces the apoptosis than other monomers in KG-1a cells. The mechanism may be through the abnormal Wnt pathway by inhibiting the activation of β-catenin protein, thereby inhibiting its downstream protein TCF4 and cyclin D1 expression. Meanwhile, inhibition of the Wnt pathway in crosstalk also inhibits the NF-κB pathway. Therefore, we believe that (S)Rh2 induced proliferation inhibition and apoptosis through the Wnt/β-catenin signaling pathway in human leukemic KG-1a cells. Therefore, (S)Rh2 could be a potential and powerful chemopreventive agent to treat human leukemia, although further research must be carried out to fully investigate the mechanisms of action.

Acknowledgments

This study was supported by the Science and Technology Foundation of Chongqing Municipal Education Commission (nos. KJ110328 and KJ110308) and the National Natural Science Foundation of China (no. 81171929). The authors would like to acknowledge College of Life Science for the technical support.

References

1 

Pui C-H, Robison LL and Look AT: Acute lymphoblastic leukaemia. Lancet. 371:1030–1043. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Jia WD, Sun HC, Zhang JB, Xu Y, Qian YB, Pang JZ, Wang L, Qin LX, Liu YK and Tang ZY: A novel peptide that selectively binds highly metastatic hepatocellular carcinoma cell surface is related to invasion and metastasis. Cancer Lett. 247:234–242. 2007. View Article : Google Scholar

3 

Wang S, Wu X, Tan M, Gong J, Tan W, Bian B, Chen M and Wang Y: Fighting fire with fire: poisonous Chinese herbal medicine for cancer therapy. J Ethnopharmacol. 140:33–45. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Kitaoka F, Kakiuchi N, Long C, Itoga M, Mitsue A, Mouri C and Mikage M: Molecular characterization of akebia plants and the derived traditional herbal medicine. Biol Pharm Bull. 32:665–670. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Xia T, Wang JC, Xu W, Xu LH, Lao CH, Ye QX and Fang JP: 20S-ginsenoside Rh2 induces apoptosis in human leukaemia Reh cells through mitochondrial signaling pathways. Biol Pharm Bull. 37:248–254. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Toh DF, Patel DN, Chan EC, Teo A, Neo SY and Koh HL: Anti-proliferative effects of raw and steamed extracts of Panax notoginseng and its ginsenoside constituents on human liver cancer cells. Chin Med. 6:42011. View Article : Google Scholar : PubMed/NCBI

7 

Shergis JL, Zhang AL, Zhou W and Xue CC: Panax ginseng in randomised controlled trials: a systematic review. Phytother Res. 27:949–965. 2013. View Article : Google Scholar

8 

Lee HS, Kim MR, Park Y, Park HJ, Chang UJ, Kim SY and Suh HJ: Fermenting red ginseng enhances its safety and efficacy as a novel skin care anti-aging ingredient: in vitro and animal study. J Med Food. 15:1015–1023. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Wang JWLR, Wang YP, et al: The role of total saponins of panax ginseng in vitro induced CD34 hematopoietic stem/progenitor cell proliferation. Chin J Anat. 29:430–432. 2006.

10 

Zhang C, Yu H and Hou J: Effects of 20 (S) -ginsenoside Rh2 and 20 (R)-ginsenoside Rh2 on proliferation and apoptosis of human lung adenocarcinoma A549 cells. Zhongguo Zhong Yao Za Zhi. 36:1670–1674. 2011.In Chinese. PubMed/NCBI

11 

Shi Q, Li J, Feng Z, Zhao L, Luo L, You Z, Li D, Xia J, Zuo G and Chen D: Effect of ginsenoside Rh2 on the migratory ability of HepG2 liver carcinoma cells: recruiting histone deacetylase and inhibiting activator protein 1 transcription factors. Mol Med Rep. 10:1779–1785. 2014.PubMed/NCBI

12 

Guo XX, Li Y, Sun C, Jiang D, Lin YJ, Jin FX, Lee SK and Jin YH: p53-dependent Fas expression is critical for ginsenoside Rh2 triggered caspase-8 activation in HeLa cells. Protein Cell. 5:224–234. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Yang JH, Han SJ, Ryu JH, Jang IS and Kim DH: Ginsenoside Rh2 ameliorates scopolamine-induced learning deficit in mice. Biol Pharm Bull. 32:1710–1715. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Bae EA, Han MJ, Shin YW and Kim DH: Inhibitory effects of Korean red ginseng and its genuine constituents ginsenosides Rg3, Rf, and Rh2 in mouse passive cutaneous anaphylaxis reaction and contact dermatitis models. Biol Pharm Bull. 29:1862–1867. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Nam MH, Kim SI, Liu JR, Yang DC, Lim YP, Kwon KH, Yoo JS and Park YM: Proteomic analysis of Korean ginseng (Panax ginseng C.A. Meyer). J Chromatogr B Analyt Technol Biomed Life Sci. 815:147–155. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Kitts DD, Popovich DG and Hu C: Characterizing the mechanism for ginsenoside-induced cytotoxicity in cultured leukemia (THP-1) cells. Can J Physiol Pharmacol. 85:1173–1183. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Dunn IF and Black PM: The neurosurgeon as local oncologist: cellular and molecular neurosurgery in malignant glioma therapy. Neurosurgery. 52:1411–1422. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Wu N, Wu GC, Hu R, Li M and Feng H: Ginsenoside Rh2 inhibits glioma cell proliferation by targeting microRNA-128. Acta Pharmacol Sin. 32:345–353. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Qu X, Qu S, Yu X, Xu H, Chen Y, Ma X and Sui D: Pseudo-G-Rh2 induces mitochondrial-mediated apoptosis in SGC-7901 human gastric cancer cells. Oncol Rep. 26:1441–1446. 2011.PubMed/NCBI

20 

Kim MJ, Yun H, Kim DH, Kang I, Choe W, Kim SS and Ha J: AMP-activated protein kinase determines apoptotic sensitivity of cancer cells to ginsenoside-Rh2. J Ginseng Res. 38:16–21. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Cadigan KM and Nusse R: Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305. 1997. View Article : Google Scholar

22 

Neppl RL and Wang DZ: The myriad essential roles of microRNAs in cardiovascular homeostasis and disease. Genes Dis. 1:18–39. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Polakis P: Drugging Wnt signalling in cancer. EMBO J. 31:2737–2746. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Lu D, Zhao Y, Tawatao R, Cottam HB, Sen M, Leoni LM, Kipps TJ, Corr M and Carson DA: Activation of the Wnt signaling pathway in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 101:3118–3123. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Lu D, Liu JX, Endo T, Zhou H, Yao S, Willert K, Schmidt-Wolf IG, Kipps TJ and Carson DA: Ethacrynic acid exhibits selective toxicity to chronic lymphocytic leukemia cells by inhibition of the Wnt/beta-catenin pathway. PLoS One. 4:e82942009. View Article : Google Scholar : PubMed/NCBI

26 

Wang W, Wang H, Rayburn ER, Zhao Y, Hill DL and Zhang R: 20(S)-25-methoxyl-dammarane-3beta, 12beta, 20-triol, a novel natural product for prostate cancer therapy: activity in vitro and in vivo and mechanisms of action. Br J Cancer. 98:792–802. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Nag SA, Qin JJ, Wang W, Wang MH, Wang H and Zhang R: Ginsenosides as anticancer agents: in vitro and in vivo activities, structure-activity relationships, and molecular mechanisms of action. Front Pharmacol. 3:252012. View Article : Google Scholar : PubMed/NCBI

28 

Takahashi-Yanaga F and Sasaguri T: The Wnt/beta-catenin signaling pathway as a target in drug discovery. J Pharmacol Sci. 104:293–302. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Mai YJ, Qiu LG, Li ZJ, Yu Z, Li CH, Wang YF, Wang GR and Li Q: The expression of beta-catenin and its significance in leukemia cells. Zhonghua Xue Ye Xue Za Zhi. 28:541–544. 2007.In Chinese. PubMed/NCBI

30 

Saldanha G, Ghura V, Potter L and Fletcher A: Nuclear beta-catenin in basal cell carcinoma correlates with increased proliferation. Br J Dermatol. 151:157–164. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Minke KS, Staib P, Puetter A, Gehrke I, Gandhirajan RK, Schlösser A, Schmitt EK, Hallek M and Kreuzer KA: Small molecule inhibitors of WNT signaling effectively induce apoptosis in acute myeloid leukemia cells. Eur J Haematol. 82:165–175. 2009. View Article : Google Scholar

32 

in't Hout FE, van der Reijden BA, Monteferrario D, Jansen JH and Huls G: High expression of transcription factor 4 (TCF4) is an independent adverse prognostic factor in acute myeloid leukemia that could guide treatment decisions. Haematologica. 99:e257–e259. 2014. View Article : Google Scholar

33 

Chang HR, Cheng TL, Liu TZ, Hu HS, Hsu LS, Tseng WC, Chen CH and Tsao DA: Genetic and cellular characterizations of human TCF4 with microsatellite instability in colon cancer and leukemia cell lines. Cancer Lett. 233:165–171. 2006. View Article : Google Scholar

34 

Tian W, Xu Y, Han X, Duggineni S, Han X, Huang Z and An J: Development of a novel fluorescence polarization-based assay for studying the β-catenin/Tcf4 interaction. J Biomol Screen. 17:530–534. 2012. View Article : Google Scholar

35 

Cadigan KM: Wnt-beta-catenin signaling. Curr Biol. 18:R943–R947. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Lento W, Congdon K, Voermans C, Kritzik M and Reya T: Wnt signaling in normal and malignant hematopoiesis. Cold Spring Harb Perspect Biol. 5:pii: a008011. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Dai WB, Ren ZP, Chen WL, Du J, Shi Z and Tang DY: Expression and significance of APC, beta-catenin, C-myc, and cyclin D1 proteins in colorectal carcinoma. Ai Zheng. 26:963–6. 2007.In Chinese. PubMed/NCBI

38 

Baek SH, Kioussi C, Briata P, Wang D, Nguyen HD, Ohgi KA, Glass CK, Wynshaw-Boris A, Rose DW and Rosenfeld MG: Regulated subset of G1 growth-control genes in response to derepression by the Wnt pathway. Proc Natl Acad Sci USA. 100:3245–3250. 2003. View Article : Google Scholar : PubMed/NCBI

39 

He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ, Vogelstein B and Kinzler KW: Identification of c-MYC as a target of the APC pathway. Science. 281:1509–1512. 1998. View Article : Google Scholar : PubMed/NCBI

40 

Gandhirajan RK, Poll-Wolbeck SJ, Gehrke I and Kreuzer KA: Wnt/β-catenin/LEF-1 signaling in chronic lymphocytic leukemia (CLL): a target for current and potential therapeutic options. Curr Cancer Drug Targets. 10:716–727. 2010. View Article : Google Scholar : PubMed/NCBI

41 

Tung JN, Chiang CC, Tsai YY, Chou YY, Yeh KT, Lee H and Cheng YW: CyclinD1 protein expressed in pterygia is associated with β-catenin protein localization. Mol Vis. 16:2733–2738. 2010.PubMed/NCBI

42 

Wang YX, Zhang JH and Gu ZW: Beta-catenin and cyclin D1 mRNA levels in newly diagnosed patients with acute myeloid leukemia and their significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 17:304–308. 2009.In Chinese. PubMed/NCBI

43 

Fabre C, Carvalho G, Tasdemir E, Braun T, Adès L, Grosjean J, Boehrer S, Métivier D, Souquère S, Pierron G, et al: NF-kappaB inhibition sensitizes to starvation-induced cell death in high-risk myelodysplastic syndrome and acute myeloid leukemia. Oncogene. 26:4071–4083. 2007. View Article : Google Scholar : PubMed/NCBI

44 

Frelin C, Imbert V, Griessinger E, Peyron AC, Rochet N, Philip P, Dageville C, Sirvent A, Hummelsberger M, Bérard E, et al: Targeting NF-kappaB activation via pharmacologic inhibition of IKK2-induced apoptosis of human acute myeloid leukemia cells. Blood. 105:804–811. 2005. View Article : Google Scholar

45 

Li K, Hu C, Mei C, Ren Z, Vera JC, Zhuang Z, Jin J and Tong H: Sequential combination of decitabine and idarubicin synergistically enhances anti-leukemia effect followed by demethylating Wnt pathway inhibitor promoters and downregulating Wnt pathway nuclear target. J Transl Med. 12:1672014. View Article : Google Scholar : PubMed/NCBI

46 

Chun KS and Surh YJ: Signal transduction pathways regulating cyclooxygenase-2 expression: potential molecular targets for chemoprevention. Biochem Pharmacol. 68:1089–1100. 2004. View Article : Google Scholar : PubMed/NCBI

47 

Yeh CT1, Yao CJ, Yan JL, Chuang SE, Lee LM, Chen CM, Yeh CF, Li CH and Lai GM: Apoptotic cell death and inhibition of Wnt/beta-catenin signaling pathway in human colon cancer cells by an active fraction (hs7) from Taiwanofungus camphoratus. Evid Based Complement Alternat Med. 2011:7502302011. View Article : Google Scholar

Related Articles

Journal Cover

July 2016
Volume 36 Issue 1

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Chen, Y., Liu, Z., Xia, J., Li, X., Li, K., Xiong, W. ... Chen, D. (2016). 20(S)-ginsenoside Rh2 inhibits the proliferation and induces the apoptosis of KG-1a cells through the Wnt/β-catenin signaling pathway. Oncology Reports, 36, 137-146. https://doi.org/10.3892/or.2016.4774
MLA
Chen, Y., Liu, Z., Xia, J., Li, X., Li, K., Xiong, W., Li, J., Chen, D."20(S)-ginsenoside Rh2 inhibits the proliferation and induces the apoptosis of KG-1a cells through the Wnt/β-catenin signaling pathway". Oncology Reports 36.1 (2016): 137-146.
Chicago
Chen, Y., Liu, Z., Xia, J., Li, X., Li, K., Xiong, W., Li, J., Chen, D."20(S)-ginsenoside Rh2 inhibits the proliferation and induces the apoptosis of KG-1a cells through the Wnt/β-catenin signaling pathway". Oncology Reports 36, no. 1 (2016): 137-146. https://doi.org/10.3892/or.2016.4774