Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2016 Volume 36 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 36 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR-194 is a negative regulator of GEF-H1 pathway in melanoma

  • Authors:
    • Bingyu Guo
    • Qiang Hui
    • Yu Zhang
    • Peng Chang
    • Kai Tao
  • View Affiliations / Copyright

    Affiliations: Reconstructive and Plastic Surgery, The General Hospital of Shenyang Military Region, Shenhe, Shenyang, Liaoning 110016, P.R. China
  • Pages: 2412-2420
    |
    Published online on: August 12, 2016
       https://doi.org/10.3892/or.2016.5020
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The incidence and associated mortality of melanoma continues to increase worldwide. At present, there is no curative therapy for advanced stage of melanoma. It is necessary to find new indicators of prognosis and therapeutic targets. Increasing evidence shows that miRNA can provide potential candidate biomarkers for melanoma and therapeutic targets. GEF-H1, a regulator of RhoA, as oncogenic driver in melanoma, promotes the growth and invasion of melanoma. miR-194 is a tumor-suppressor gene in multiple tumors, such as bladder and non-small cell lung cancer, and clear cell renal cell carcinoma. In the present study, we demonstrated that GEF-H1 serves as target of miR-194. Overexpression of miR-194 downregulates the GEF-H1/RhoA pathway, inhibits melanoma cancer cell proliferation and metastasis. Furthermore, miR-194 expression is negatively associated with tumor-node-metastasis (TNM) stages. Briefly, our findings provided new theoretical basis for melanoma treatment.

Introduction

Melanoma is a common malignant tumor, and the most aggressive form of skin cancer, which incidence keeps increasing worldwide (1). Despite expectations that targeted therapies based on mutations intended to improve the survival of patients, current regiments are not satisfactory (2). New therapies, including mitogen-activated protein kinase (3) pathway inhibitors, such as BRAF and MEK inhibitors, as well as other signaling pathways inhibitors, are being tested in metastatic melanoma either as immunotherapy or in combination, and have yielded promising results (4). However, we still need to find novel targets for treatment of melanoma.

Rho guanine nucleotide exchange factor (5) is a protein which regulates the activity of Rho GTP enzyme through regulating the exchange of GDP/GTP (6). GEF-H1 has a wide range of biological functions, such as regulating vesicle transport and cell movement (6,7), stabling cytoskeleton (8), affecting the cell barrier function (9–12), promoting cell cycle progression and inhibiting cell apoptosis and other biological functions (5,10,12–15). GEF-H1 has been reported to have abnormal activation in many types of cancers, such as breast, prostate and myeloid cell cancer (10,16–20). There are also several studies showing that GEF-H1 was overexpressed in brain metastatic melanoma (12). GEF-H1 induces the activation of RhoA oncogene (21–23), and then activates various signals pathways, such as proliferation, metastasis and cytoskeleton reorganization (24).

MicroRNA (miRNA) is an endogenous short chain RNA with a length of ~22 nt. Through endogenous RNA interference machinery they can repress multiple target genes (25–27). In a variety of cancers, the prognosis of patients was considered to be close to the expression of miRNAs. Increasing reports show that miRNAs played important roles in cell differentiation, individual development, cell growth and metastasis (28). Muller and Bosserhoff found that several of the miR-let-7 family members had decreased expression in melanoma and miR-let-7a reduced NRAS expression in melanoma (29). In melanoma miR-193b has been reported to be downregulated with overexpression of cyclin D1; then, promoting the proliferative capacity of melanoma (30). Also it was demonstrated that cancer growth was reduced when miR-205 was overexpressed (31,32). All these studies indicated that miRNA regulates multiple targets then affect the biological functions of melanoma cells.

miR-194 has been reported to suppress invasion and migration of liver cancer cells (33). Experiments showed that miR-194 has a low expression in colon cancer (34). Previous research showed that miR-194 expression was associated with the advanced stage in gastric cancer (35). However, there is no previous study concerning the expression and function of miR-194 in melanoma.

In the present study, we studied the expression of miR-194 and GEF-H1 in melanoma using real-time PCR, and investigated the association between miR-194 and GEF-H1. Results showed that miR-194 had a negative correlation with the tumor-node-metastasis (TNM) stage of melanoma, and it suppresses the growth and metastasis of melanoma cells by downregulating the expression of GEF-H1.

Materials and methods

Tissue samples and cell lines

We obtained 60 paired samples of tumor and adjacent normal tissues from patients with melanoma in the General Hospital of Shenyang Military Command. The protocols were approved by the Ethics Committee of the General Hospital of Shenyang Military Command. All cases were diagnosed with melanoma and treated between January 2009 and December 2009 at the General Hospital of Shenyang Military Command. The case details are shown in Table II.

Table II

The relationship between miR-194 and melanoma.

Table II

The relationship between miR-194 and melanoma.

VariablesDescriptionNo. of patientsmiR-194 expression
χ2P-value
LowHigh
GenderMale2621100.6300.202
Female34309
Age (years)<55292273.7940.051
≥55311615
Primary tumor ulcerationWith3820185.1110.024a
Without22184
Tumor thickness<4 mm3115166.1700.013a
>4 mm29236
Family historyNo4831170.1610.688
Yes1275
TNM gradeI221848.0120.046a
II20812
III1284
IV642

{ label (or @symbol) needed for fn[@id='tfn1-or-36-04-2412'] } Association between the expression of miR-194 with clinicopathological features in patients with melanoma. Through the Chi-square test we found there was little correction between miR-194 with the gender, age or family history. However there was correction between the miR-194 and the primary tumor ulceration, tumor thickness and TNM stage of melanoma. TNM, tumor-node-metastasis.

a Statistically significant.

Laser capture microdissection was performed on melanoma tumors that were selected when tumor blocks were readily available for the tissue sectioning required for laser capture microdissection (36).

A375 was purchased from the American Type Culture Collection (ATCC; CRL-1619; Manassas, VA, USA) and A875 was purchased from Shanghai Maisha Biotech. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (HyClone, Logan, UT, USA) at 37°C under 5% CO2.

MTT assays

Cells were seeded at a density of 1×103 cells/well of 96-well plates, and transfected with miR-194 mimic (AUGGUGUUAUCAAGUGUAACAGCAACUCCAUGUGGACUGUGUACCAAUUUCCAGUGGAGAUGCUGUUACUUUUGAUGGUUACCAA), miR-194 inhibitor (UCCACAUGGAGUUGCUGUUACA) or negative control (UCACAACCUCCUAGAAAGAGUAGA); 12 h later, the cell proliferation was evaluated by MTT assay. Microplate reader (Bio-Rad, Hercules, CA, USA) was used to measure the optical densities at 490 nm.

Transwell assay

The Matrigel invasion chamber was used to assess cell invasion ability (24-well plates, 8-µm pore size; Corning, Corning, NY, USA). In brief, 1×105 cells in serum-free media were seeded in Transwell chambers with Matrigel membranes covered or uncovered with the media containing 0.1% bovine serum albumin, while the media containing 30% FBS was placed in the lower well. Twenty-four hours after transfection with miR-194 mimic, miR-194 inhibitor or negative control cells, the non-invading cells were removed with cotton swabs. Cells at the bottom of the membrane were stained with 0.1% crystal violet and were counted by microscopy.

Quantitative real-time PCR

Total RNA from tissue samples and cells was extracted by TRIzol (Invitrogen, Carlsbad, CA, USA) through the protocol. Real-time PCR was carried out using Real-time PCR Universal reagent and the MX3000P real-time PCR instrument following the protocols. The expression of miR-194 was detected by stem-loop RT-PCR assay as previously reported (37,38). The primers are shown in Table I. All the reactions were carried out as previously described (39).

Table I

The primer sequences used in the experiments.

Table I

The primer sequences used in the experiments.

NameForward primer (5′≥3′)Reverse primer (5′≥3′)
miR-194 ACACTCCAGCTGGGCCAGTGGGGCTGC CTCAACTGGTGTCGTGGAGTCGG
CAATTCAGTTGAGCAGATAAC
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GEF-H1 GAGTGCTTTAGGCCGCTTG GACCTTGGTACAGTTGGCG
RhoA GTCCACGGTCTGGTCTTCAG GTGTCCCACAAAGCCAAC
p21 GTGGCTATTTTGTCCTTGGG GGCGCCTGAACAGAAGAAA
Ecad GGAGGCTCTCCCGTCTTTTG CTTTGTCGACCGGTGCAATC
vim GGACCAGCTAACCAACGAC GGTCAAGACGTGCCAGAG
GAPDH CTCTGCTCCTCCTGTTCGAC GCGCCCAATACGACCAAATC
Western blot analyses

The cells and tissues were lysed in lysis buffer (25 mM Tris, pH 7.6, 150 mM NaCl, 1% Nonidet P-40, 1 mM EDTA), supplemented with proteinase and phosphatase inhibitors (Sigma-Aldrich, St. Louis, MO, USA). The cell lysates were fractionated by 10% SDS-PAGE, and were transferred to a polyvinylidene difluoride membrane (Millipore Corporation, Billerica, MA, USA). Target proteins were probed with specific antibodies: GEF-H1 (sc-134827), RhoA (sc-119), p21 (sc-21532), Ecad (sc-21791), vim (sc-80975) and GAPDH (sc-365062) (Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Dual-luciferase reporter assay

Dual-luciferase activity assays were performed as previously described (40). The GEF-H1 3′-untranslated region (3′-UTR) was PCR amplified and cloned into the pMIR-REPORT™ vector (Ambion, Carlsbad, CA, USA). The primers used were: GEF-H1-WT F, 5′-CCCGTCCGATTATGTCTCGG-3′ and R, 5′-GCTGTCGGAGGGGTAG-3′; GEF-H1-DEL F, 5′-CCCGTCCGATTATGTCTCGG-3′ and R, 5′-CGCCCCCTCACATGGTGC-3′. A375 cells were seeded into 24-well plates and co-transfected with 500 ng WT or DEL reporter vector and 10 ng pMIR-REPORT™-βgal control plasmid in miR-194 mimic and miR-194 AS. Luciferase activity was determined using the dual-luciferase reporter assay system after 36 h transfection; the luciferase activity was measured using the Dual-luciferase Reporter Assay System (Promega, Madison, WI, USA).

Immunofluorescence staining

All the reactions were carried out as previously described (41). Briefly, ~4-µm thick slices were cut from paraffin-embedded specimens, and IHC staining was performed on tissue slices. These sections were treated at 80°C for 30 min, deparaffinized with xylene and rehydrated after washing with different alcohol concentrations. All dewaxed slices were immersed in 0.01 mmol/l citrate buffer (pH 6.0) and maintained in high-pressure steam at 121°C for 4 min to fix antigenicity. Afterwards, the slices were cooled to room temperature. To remove the endogenous peroxidase activity, the slices were placed in 3% hydrogen peroxide for 10 min. Tissue sections were incubated with GEF-H1 antibody (sc-134827) (1:200) at 4°C overnight, washed three times (5 min each) with phosphate-buffered saline, and finally incubated with biotin-labeled secondary antibody and horseradish peroxidase-conjugated streptavidin for 20 min. All slices were immersed in 3,3′-diamino-benzidine tetrahydrochloride (Dako Corporation, Glostrup, Denmark) at 37°C, which was followed by hematoxylin counterstaining.

Statistical analysis

In the present study χ2 test was used to analyze the relationship between miR-194 and clinicopathological variables. A univariate analysis of log-rank test was used to evaluate the differences among the levels of possible prognostic factors. All the data were analyzed with SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). Statistical significance was defined as p<0.05. All experiments were repeated three times.

Results

Expression of GEF-H1 in melanoma tissues

In order to study the relationship between GEF-H1 and melanoma, we detected the expression of GEF-H1 in tumor and adjacent tissues by real-time PCR, western blotting and immunofluorescence staining (Fig. 1A, B and E). The adjacent tissues were used as a control. Results showed that there was a higher expression of GEF-H1 in melanoma tissues than the adjacent tissues. Furthermore, in order to explore the relationship between GEF-H1 and melanoma, we selected melanoma tissues of different TNM stages to test the expression of GEF-H1 by real-time PCR, western blotting and immunofluorescence staining (Fig. 1C, D and F). We found that with the increase of TNM grade of melanoma, the expression of GEF-H1 was increased.

Figure 1

Expression of GEF-H1 in melanoma tissues. (A) The protein level of GEF-H1 expression in melanoma and adjacent tissues were detected using western blotting. The expression of GEF-H1 was higher in the melanoma tissues. Data are shown as mean ± SEM; **p<0.01 vs. the adjacent tissues group. (B) mRNA expression of GEF-H1 in 60 samples of melanoma and adjacent tissues were respectively detected by real-time PCR. The expression of GEF-H1 was higher in the melanoma tissues. Data are shown as mean ± SEM; **p<0.01 vs. the adjacent tissues group. (C) The protein levels of GEF-H1 expression in different TNM stages of melanoma tissues were detected using western blotting. The expression of GEF-H1 was increased with the TNM stages. Data are shown as mean ± SEM; **p<0.01 vs. I stage. (D) mRNA level of GEF-H1 expression in different TNM stages of melanoma tissues were detected by real-time PCR. The expression of GEF-H1 was increased with the TNM stages. Data are shown as mean ± SEM; **p<0.01 vs. I stage. (E) Immunofluorescence staining was used to test the expression of GEF-H1 in 60 samples of melanoma and adjacent tissues. The expression of GEF-H1 was higher in the melanoma tissues. Data are shown as mean ± SEM; **p<0.01 vs. the adjacent tissues group. (F) Immunofluorescence staining was used to test the expression of GEF-H1 in different TNM stages of melanoma tissues. The expression of GEF-H1 was increased with the TNM stages. Data are shown as mean ± SEM; **p<0.01 vs. I stage.

miR-194 inhibits the expression of GEF-H1 in A375 cells

miR-194 has been reported downregulated in various types of cancers (42), however, its expression in melanoma has not been reported. To test the expression of miR-194 in tumor and adjacent tissues, we used real-time PCR assay (Fig. 2A). We found that the expression of 194 in tumor tissues was lower than that in the adjacent tissues. Then, we classified 60 patients with melanoma according to the literature (43), and the results showed that the expression of miR-194 was correlated with TNM stage, primary tumor ulceration, tumor thickness and age of melanoma (Table II). It is concluded that miR-194 may have a certain effect on the occurrence and development of melanoma, and then through miRDB tool we found many proteins which can interact with miR-194 (Fig. 2B). After detailed analysis we concluded that the low expression of GEF-H1 in melanoma tissues may be related to miR-194. Since miR-194 could be combined with 3′-UTR of GEF-H1 (Fig. 2C). We confirmed our inference by the luciferase reporter assay, which showed that miR-194 can indeed reduce the expression of GEF-H1 at the transcriptional level (Fig. 2D). Results showed that when cells were co-transfected with GEF-H1-WT and miR-194 a lower luciferase activity was achieved, however, the cells co-transfected with EGFR-DEL or miR-194 antisense (AS) did not show significant variations. Furthermore, we found there was a negative correlation between miR-914 and GEF-H1 in melanoma tissues (Fig. 2E). In order to further verify the relationship between miR-194 and GEF-H1, we transfected miR-194 mimic or miR-194 inhibitor into A375 cells. Then, we used real-time PCR and western blotting to detect the expression of GEF-H1 and miR-194 (Fig. 2F–I). Results showed that the expression of GEF-H1 was markedly downregulated by miR-194.

Figure 2

miR-194 inhibits the expression of GEF-H1 in A375 cells. (A) The levels of miR-194 in 60 samples of melanoma and adjacent tissues were detected by real-time PCR. There was lower expression of miR-194 in melanoma tissues. Data are shown as mean ± SEM. **p<0.01 vs. the adjacent tissues group. (B) Site prediction showed that miR-194 could target at a several of proteins. (C) miRDB predicted that miR-194 could specifically be combined with GEF-H1. (D) The interaction between miR-194 and the GEF-H1 3′-UTR was tested by luciferase reporter assays. Assays were performed by co-transfection of miR-194 or miR-194 antisense and WT-UTR or DEL-UTR. Data are shown as mean ± SEM; **p<0.01 vs. the TK-GEF-H1 group. (E) Western blotting showed that when the miR-194 was overexpressed the expression of GEF-H1 was downregulated. Data are shown as mean ± SEM; **p<0.01 vs. the control group. (F–I) Real-time PCR showed the same result. Data are shown as mean ± SEM; **p<0.01 vs. the control group. (G) Western blotting showed that when the miR-194 was repressed the expression of GEF-H1 was upregulated. Data are shown as mean ± SEM; **p<0.01 vs. the control group. Data are shown as mean ± SEM; **p<0.01 vs. the control group.

miR-194 inhibits the proliferation of melanoma cells by suppressing GEF-H1 pathway

Numerous studies have indicated that GEF-H1 promotes cell proliferation by regulating the expression of RhoA, thus, we wanted to investigate whether miR-194 regulates the proliferation of melanoma cells by affecting the GEF-H1/RhoA pathway. MTT assay was used to examine the effect of miR-194 on cell proliferation. The proliferation of A375 and A875 were significantly depressed by transfection with miR-194 mimic (Fig. 3A). On the contrary, when transfected with miR-194 inhibitor, we found promotion of cell proliferation (Fig. 3B). As known, p21 is an important downstream protein in GEF-H1/RhoA pathway. Thus, we overexpressed or downregulated miR-194 and then examined the expression of p21 by western blotting and real-time RT-PCR (Fig. 3C–F). Results showed that miR-194 can inhibit the expression of GEF-H1 and RhoA, but it significantly increased the expression of p21. Thus, the results showed that miR-194 negatively regulates GEF-H1, then inhibiting the proliferation of A375 by inhibiting the GEF-H1/RhoA pathway.

Figure 3

miR-194 inhibits the proliferation of melanoma cells by suppressing GEF-H1 pathway. (A) After transfected with miR-194 mimic A375 and A875 cell proliferation was repressed, which was detected by MTT assay. Data are shown as mean ± SEM. (B) A375 and A875 cells were downregulated by miR-194, cell growth was detected by MTT assay. Data are shown as mean ± SEM. (C and D) After transfection with miR-194 mimic in A375, the indicated proteins and mRNA were detected by western blotting and real-time PCR. Data are shown as mean ± SEM; **p<0.01. (E and F) After downregulation of miR-194, the indicated proteins and mRNA in A375 cells were detected by western blotting and real-time PCR. Data are shown as mean ± SEM; **p<0.01.

miR-194 inhibits the metastasis of melanoma cells by suppressing the GEF-H1/RhoA pathway

GEF-H1 affects metastasis of cells in various manner. GEF-H1/RhoA is a common pathway. We wondered whether miR-194 inhibited the metastasis of A375 cells by suppressing GEF-H1/RhoA pathway. We used Transwell assay (with or without Matrigel) to study whether miR-194 is involved in metastasis of A375 cells (Fig. 4A–D). Results showed that the invasion and migration of the A375 cells were significantly inhibited when miR-194 was overexpressed, whereas the invasion and migration of A375 cells were promoted when miR-194 expression was decreased. In addition, through western blotting and real-time PCR we found Ecad and vim were significantly downregulated by miR-194 through GEF-H1/RhoA pathway (Fig. 4E–H). These experiments confirmed that miR-194 inhibited the metastasis of melanoma cells by inhibiting the GEF-H1/RhoA pathway.

Figure 4

miR-194 inhibits the metastasis of melanoma cells by suppressing GEF-H1/RhoA pathway. (A and B) After overexpression of miR-194 in A375 cells, Transwell assay with or without Matrigel were performed. Cells were counted and results represent the mean ± SD of three experiments; **p<0.01. (C and D) After downregulation of miR-194 in A375 cells, Transwell assay with or without Matrigel were performed. Cells were counted and results represent the mean ± SD of three experiments; **p<0.01. (E and F) A375 cells were overexpressed with miR-194, then detected the indicated proteins, and mRNA by western blotting and real-time PCR. Data are shown as mean ± SEM; **p<0.01. (G and H) A375 cells were downregulated with miR-194, the indicated proteins and mRNA levels were detected by western blotting and real-time PCR. Data are shown as mean ± SEM; **p<0.01.

Discussion

GEF-H1 affects the occurrence and development of a tumor by regulating tumor cell migration, promotes the proliferation of tumor cells and inhibits the apoptosis of tumor cells (19). It has been reported that GEF-H1 is highly expressed in breast and prostate cancer, myeloid cell tumor and metastatic melanoma, but there were few studies concerning the expression of GEF-H1 in melanoma (10,19,20). GEF-H1 promotes the metastasis of breast cancer cells by inducing the rearrangement of cytoskeleton (20). In prostate cancer cells GEF-H1 participate in the formation of lamellipodia to promote the migration of cells (44). GEF-H1 plays a role in promoting tumor cell growth and invasion and metastasis by regulating the expression of RhoA, and then affects the downstream pathway (18).

In colorectal, gastric and non-small cell lung cancer, miR-194 was proved to be able to inhibit the occurrence and development of tumor (42,45–47). Studies have shown that overexpression of miR-194 inhibited cell proliferation and metastasis by targeting proteins such as RBX1 and BMI1 (42,48). However, we first demonstrated that miR-194 inhibited the growth and metastasis of melanoma by inhibiting the GEF-H1/RhoA pathway.

In the present study, real-time PCR assay showed that the expression of GEF-H1 in the melanoma tissue was ~27.62% higher than that in the adjacent tissues, however, the expression of miR-194 was ~29.97% lower in tumor tissues than the adjacent tissues. Moreover, we found that miR-194 negatively regulates the expression of GEF-H1, and their correlation formula is y = −0.4054 × x + 0.8377 R2 = 0.5777. Furthermore, we overregulated or downregulated the expression of miR-194 in melanoma cells, then detected the functions of miR-194 in melanoma cells through the MTT and Transwell assays. We found that miR-194 inhibited the proliferation and invasion of melanoma cells by inhibiting the expression of GEF-H1. In addition, western blotting and real-time PCR showed that miR-194 depresses the expression of Ecad and promotes the expression of p21 which are the proteins in GEF-H1/RhoA pathway.

In conclusion, our studies have demonstrated that miR-194 is closely related to the occurrence and development of melanoma. miR-194 inhibited the proliferation and invasion of melanoma cells by negative regulation the expression of GEF-H1. Clinically, miR-194 expression may be associated with melanoma TNM grade as well as the prognosis of melanoma. In summary, our findings suggest that miR-194 may be considered in targeted therapy in melanoma.

References

1 

Demierre MF and Merlino G: Chemoprevention of melanoma. Curr Oncol Rep. 6:406–413. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Friedman AA, Amzallag A, Pruteanu-Malinici I, Baniya S, Cooper ZA, Piris A, Hargreaves L, Igras V, Frederick DT, Lawrence DP, et al: Landscape of targeted anti-cancer drug synergies in melanoma identifies a novel BRAF-VEGFR/PDGFR combination treatment. PLoS One. 10:e01403102015. View Article : Google Scholar : PubMed/NCBI

3 

Achiwa Y, Hasegawa K and Udagawa Y: Effect of ursolic acid on MAPK in cyclin D1 signaling and RING-type E3 ligase (SCF E3s) in two endometrial cancer cell lines. Nutr Cancer. 65:1026–1033. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Ascierto PA, Atkins M, Bifulco C, Botti G, Cochran A, Davies M, Demaria S, Dummer R, Ferrone S, Formenti S, et al: Future perspectives in melanoma research: Meeting report from the 'Melanoma Bridge': Napoli, December 3rd–6th 2014. J Transl Med. 13:3742015. View Article : Google Scholar

5 

Aijaz S, D'Atri F, Citi S, Balda MS and Matter K: Binding of GEF-H1 to the tight junction-associated adaptor cingulin results in inhibition of Rho signaling and G1/S phase transition. Dev Cell. 8:777–786. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Hiyoshi H, Okada R, Matsuda S, Gotoh K, Akeda Y, Iida T and Kodama T: Interaction between the type III effector VopO and GEF-H1 activates the RhoA-ROCK pathway. PLoS Pathog. 11:e10046942015. View Article : Google Scholar : PubMed/NCBI

7 

Song EH, Oh W, Ulu A, Carr HS, Zuo Y and Frost JA: Acetylation of the RhoA GEF Net1A controls its subcellular localization and activity. J Cell Sci. 128:913–922. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Guilluy C, Swaminathan V, Garcia-Mata R, O'Brien ET, Superfine R and Burridge K: The Rho GEFs LARG and GEF-H1 regulate the mechanical response to force on integrins. Nat Cell Biol. 13:722–727. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Huynh TK, Meeus P, Cassier P, Bouché O, Lardière-Deguelte S, Adenis A, André T, Mancini J, Collard O, Montemurro M, et al: Primary localized rectal/pararectal gastrointestinal stromal tumors: Results of surgical and multimodal therapy from the French Sarcoma group. BMC Cancer. 14:1562014. View Article : Google Scholar : PubMed/NCBI

10 

Ridgway LD, Wetzel MD, Ngo JA, Erdreich-Epstein A and Marchetti D: Heparanase-induced GEF-H1 signaling regulates the cytoskeletal dynamics of brain metastatic breast cancer cells. Mol Cancer Res. 10:689–702. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Guo F, Tang J, Zhou Z, Dou Y, Van Lonkhuyzen D, Gao C and Huan J: GEF-H1-RhoA signaling pathway mediates LPS-induced NF-κB transactivation and IL-8 synthesis in endothelial cells. Mol Immunol. 50:98–107. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Ridgway LD, Wetzel MD and Marchetti D: Modulation of GEF-H1 induced signaling by heparanase in brain metastatic melanoma cells. J Cell Biochem. 111:1299–1309. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Cullis J, Meiri D, Sandi MJ, Radulovich N, Kent OA, Medrano M, Mokady D, Normand J, Larose J, Marcotte R, et al: The RhoGEF GEF-H1 is required for oncogenic RAS signaling via KSR-1. Cancer Cell. 25:181–195. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Gawlak G, Tian Y, O'Donnell JJ III, Tian X, Birukova AA and Birukov KG: Paxillin mediates stretch-induced Rho signaling and endothelial permeability via assembly of paxillin-p42/44MAPK-GEF-H1 complex. FASEB J. 28:3249–3260. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Huang IH, Hsiao CT, Wu JC, Shen RF, Liu CY, Wang YK, Chen YC, Huang CM, del Álamo JC, Chang ZF, et al: GEF-H1 controls focal adhesion signaling that regulates mesenchymal stem cell lineage commitment. J Cell Sci. 127:4186–4200. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Kakiashvili E, Dan Q, Vandermeer M, Zhang Y, Waheed F, Pham M and Szászi K: The epidermal growth factor receptor mediates tumor necrosis factor-alpha-induced activation of the ERK/GEF-H1/RhoA pathway in tubular epithelium. J Biol Chem. 286:9268–9279. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Kakiashvili E, Speight P, Waheed F, Seth R, Lodyga M, Tanimura S, Kohno M, Rotstein OD, Kapus A and Szászi K: GEF-H1 mediates tumor necrosis factor-alpha-induced Rho activation and myosin phosphorylation: Role in the regulation of tubular paracellular permeability. J Biol Chem. 284:11454–11466. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Mizuarai S, Yamanaka K and Kotani H: Mutant p53 induces the GEF-H1 oncogene, a guanine nucleotide exchange factor-H1 for RhoA, resulting in accelerated cell proliferation in tumor cells. Cancer Res. 66:6319–6326. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Biondini M, Duclos G, Meyer-Schaller N, Silberzan P, Camonis J and Parrini MC: RalB regulates contractility-driven cancer dissemination upon TGFβ stimulation via the RhoGEF GEF-H1. Sci Rep. 5:117592015. View Article : Google Scholar

20 

Liao YC, Ruan JW, Lua I, Li MH, Chen WL, Wang JR, Kao RH and Chen JH: Overexpressed hPTTG1 promotes breast cancer cell invasion and metastasis by regulating GEF-H1/RhoA signalling. Oncogene. 31:3086–3097. 2012. View Article : Google Scholar :

21 

Krendel M, Zenke FT and Bokoch GM: Nucleotide exchange factor GEF-H1 mediates cross-talk between microtubules and the actin cytoskeleton. Nat Cell Biol. 4:294–301. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Matsuzawa T, Kuwae A, Yoshida S, Sasakawa C and Abe A: Enteropathogenic Escherichia coli activates the RhoA signaling pathway via the stimulation of GEF-H1. EMBO J. 23:3570–3582. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Ren Y, Li R, Zheng Y and Busch H: Cloning and characterization of GEF-H1, a microtubule-associated guanine nucleotide exchange factor for Rac and Rho GTPases. J Biol Chem. 273:34954–34960. 1998. View Article : Google Scholar : PubMed/NCBI

24 

Aznar S, Fernández-Valerón P, Espina C and Lacal JC: Rho GTPases: Potential candidates for anticancer therapy. Cancer Lett. 206:181–191. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Erhard F, Haas J, Lieber D, Malterer G, Jaskiewicz L, Zavolan M, Dölken L and Zimmer R: Widespread context dependency of microRNA-mediated regulation. Genome Res. 24:906–919. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Suzuki HI, Mihira H, Watabe T, Sugimoto K and Miyazono K: Widespread inference of weighted microRNA-mediated gene regulation in cancer transcriptome analysis. Nucleic Acids Res. 41:e622013. View Article : Google Scholar : PubMed/NCBI

27 

Krol J, Loedige I and Filipowicz W: The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet. 11:597–610. 2010.PubMed/NCBI

28 

Bennett PE, Bemis L, Norris DA and Shellman YG: miR in melanoma development: miRNAs and acquired hallmarks of cancer in melanoma. Physiol Genomics. 45:1049–1059. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Müller DW and Bosserhoff AK: Integrin beta 3 expression is regulated by let-7a miRNA in malignant melanoma. Oncogene. 27:6698–6706. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Chen J, Feilotter HE, Paré GC, Zhang X, Pemberton JG, Garady C, Lai D, Yang X and Tron VA: MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 176:2520–2529. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Dar AA, Majid S, de Semir D, Nosrati M, Bezrookove V and Kashani-Sabet M: miRNA-205 suppresses melanoma cell proliferation and induces senescence via regulation of E2F1 protein. J Biol Chem. 286:16606–16614. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Noguchi S, Iwasaki J, Kumazaki M, Mori T, Maruo K, Sakai H, Yamada N, Shimada K, Naoe T, Kitade Y, et al: Chemically modified synthetic microRNA-205 inhibits the growth of melanoma cells in vitro and in vivo. Mol Ther. 21:1204–1211. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Meng Z, Fu X, Chen X, Zeng S, Tian Y, Jove R, Xu R and Huang W: miR-194 is a marker of hepatic epithelial cells and suppresses metastasis of liver cancer cells in mice. Hepatology. 52:2148–2157. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM, Schepeler T, Ørntoft TF, Andersen CL and Dobbelstein M: p53-Responsive micrornas 192 and 215 are capable of inducing cell cycle arrest. Cancer Res. 68:10094–10104. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Song Y, Zhao F, Wang Z, Liu Z, Chiang Y, Xu Y, Gao P and Xu H: Inverse association between miR-194 expression and tumor invasion in gastric cancer. Ann Surg Oncol. 19(Suppl 3): S509–S517. 2012. View Article : Google Scholar

36 

Kemper K, Krijgsman O, Cornelissen-Steijger P, Shahrabi A, Weeber F, Song JY, Kuilman T, Vis DJ, Wessels LF, Voest EE, et al: Intra- and inter-tumor heterogeneity in a vemurafenib-resistant melanoma patient and derived xenografts. EMBO Mol Med. 7:1104–1118. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Feng J, Wang K, Liu X, Chen S and Chen J: The quantification of tomato microRNAs response to viral infection by stem-loop real-time RT-PCR. Gene. 437:14–21. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, et al: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33:e1792005. View Article : Google Scholar : PubMed/NCBI

39 

Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e452001. View Article : Google Scholar : PubMed/NCBI

40 

Yang TS, Yang XH, Wang XD, Wang YL, Zhou B and Song ZS: MiR-214 regulate gastric cancer cell proliferation, migration and invasion by targeting PTEN. Cancer Cell Int. 13:682013. View Article : Google Scholar : PubMed/NCBI

41 

Patel D and Chaudhary J: Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis. Biochem Biophys Res Commun. 422:146–151. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Chen X, Wang Y, Zang W, Du Y, Li M and Zhao G: miR-194 targets RBX1 gene to modulate proliferation and migration of gastric cancer cells. Tumour Biol. 36:2393–2401. 2015. View Article : Google Scholar

43 

Balch CM, Gershenwald JE, Soong SJ, Thompson JF, Atkins MB, Byrd DR, Buzaid AC, Cochran AJ, Coit DG, Ding S, et al: Final version of 2009 AJCC melanoma staging and classification. J Clin Oncol. 27:6199–6206. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Wells CM, Whale AD, Parsons M, Masters JR and Jones GE: PAK4: A pluripotent kinase that regulates prostate cancer cell adhesion. J Cell Sci. 123:1663–1673. 2010. View Article : Google Scholar : PubMed/NCBI

45 

Basati G, Razavi AE, Pakzad I and Malayeri FA: Circulating levels of the miRNAs, miR-194, and miR-29b, as clinically useful biomarkers for colorectal cancer. Tumour Biol. 37:1781–1788. 2016. View Article : Google Scholar

46 

Wang B, Shen ZL, Gao ZD, Zhao G, Wang CY, Yang Y, Zhang JZ, Yan YC, Shen C, Jiang KW, et al: MiR-194, commonly repressed in colorectal cancer, suppresses tumor growth by regulating the MAP4K4/c-Jun/MDM2 signaling pathway. Cell Cycle. 14:1046–1058. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Wu X, Liu T, Fang O, Leach LJ, Hu X and Luo Z: miR-194 suppresses metastasis of non-small cell lung cancer through regulating expression of BMP1 and p27kip1. Oncogene. 33:1506–1514. 2014. View Article : Google Scholar

48 

Dong P, Kaneuchi M, Watari H, Hamada J, Sudo S, Ju J and Sakuragi N: MicroRNA-194 inhibits epithelial to mesenchymal transition of endometrial cancer cells by targeting oncogene BMI-1. Mol Cancer. 10:992011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo B, Hui Q, Zhang Y, Chang P and Tao K: miR-194 is a negative regulator of GEF-H1 pathway in melanoma. Oncol Rep 36: 2412-2420, 2016.
APA
Guo, B., Hui, Q., Zhang, Y., Chang, P., & Tao, K. (2016). miR-194 is a negative regulator of GEF-H1 pathway in melanoma. Oncology Reports, 36, 2412-2420. https://doi.org/10.3892/or.2016.5020
MLA
Guo, B., Hui, Q., Zhang, Y., Chang, P., Tao, K."miR-194 is a negative regulator of GEF-H1 pathway in melanoma". Oncology Reports 36.4 (2016): 2412-2420.
Chicago
Guo, B., Hui, Q., Zhang, Y., Chang, P., Tao, K."miR-194 is a negative regulator of GEF-H1 pathway in melanoma". Oncology Reports 36, no. 4 (2016): 2412-2420. https://doi.org/10.3892/or.2016.5020
Copy and paste a formatted citation
x
Spandidos Publications style
Guo B, Hui Q, Zhang Y, Chang P and Tao K: miR-194 is a negative regulator of GEF-H1 pathway in melanoma. Oncol Rep 36: 2412-2420, 2016.
APA
Guo, B., Hui, Q., Zhang, Y., Chang, P., & Tao, K. (2016). miR-194 is a negative regulator of GEF-H1 pathway in melanoma. Oncology Reports, 36, 2412-2420. https://doi.org/10.3892/or.2016.5020
MLA
Guo, B., Hui, Q., Zhang, Y., Chang, P., Tao, K."miR-194 is a negative regulator of GEF-H1 pathway in melanoma". Oncology Reports 36.4 (2016): 2412-2420.
Chicago
Guo, B., Hui, Q., Zhang, Y., Chang, P., Tao, K."miR-194 is a negative regulator of GEF-H1 pathway in melanoma". Oncology Reports 36, no. 4 (2016): 2412-2420. https://doi.org/10.3892/or.2016.5020
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team