Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November-2016 Volume 36 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2016 Volume 36 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance

  • Authors:
    • Sha Ni
    • Xiaoyu Zhao
    • Ling Ouyang
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology and Obstetrics, Shengjing Hospital Affiliated to China Medical University, Heping, Shenyang, Liaoning 110004, P.R. China
  • Pages: 2571-2578
    |
    Published online on: September 8, 2016
       https://doi.org/10.3892/or.2016.5075
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Researchers have recently demonstrated the key role of long non-coding RNAs (lncRNAs) in regulating embryogenesis and gene expression. However, the exact mechanism used by lncRNAs in carcinogenesis is still unclear. In particular, studies regarding the role of lncRNAs in vulvar squamous cell carcinomas (VSCCs) are limited. Using microarray analysis, the genome-wide expression profile of lncRNAs was investigated in four paired VSCCs and adjacent normal vulvar tissues. Accordingly, several novel lncRNA candidates (HOAIR, MALAT1, MEG3, NEAT1, MIR31HG and LINC00478) were chosen for further study and real-time reverse transcription PCR (RT-PCR) was used to confirm the expression levels among 35 tissue samples. A panel of dysregulated lncRNAs (MEG3 and MALAT1) were also identified as potential biomarkers as they also correlated with VSCC carcinogenesis. In summary, the results revealed that aberrantly expressed lncRNAs may be a factor in VSCC pathogenesis, potentially providing new biomarkers and therapeutic targets for VSCC.

Introduction

Vulvar squamous cell carcinoma (VSCC) is a relatively rare malignant tumor in women which accounts for 80–90% of female genital tract cancers (1). Early stage VSCC is primarily treated with surgery, however, postoperative complications can occur. Several of these complications, such as lower limb lymphatic obstruction and vulvar morphologic changes, can have a deep impact on the quality of life of patients. The treatment for advanced vulvar cancer includes radiotherapy. The survival rate for patients with advanced VSCC is only ~30% due to the reduced tolerance of vulvar tissues to radiation. Thus, it is important to better understand the pathogenesis of VSCC and to identify possible effective biomarkers to aid diagnosis.

Over the past decade, research into the non-coding RNA (ncRNA) domain has attracted significant attention. Long non-coding RNAs (lncRNAs) >200 nucleotides in length do not encode any proteins (2,3) but are involved in regulating gene functions at transcriptional and post-transcriptional levels (4). These gene functions include epigenetic regulation, chromatin modification, cell cycle regulation, nuclear trafficking, transcription and splicing (5–8). The dysregulation of lncRNAs is linked to various human diseases, particularly cancer (9–11).

In the present study, an lncRNA expression profile was established from samples obtained from four paired VSCC subjects and their adjacent non-tumor (NT) tissues through a microarray platform. The aim of the present study was to identify dysregulated lncRNAs and mRNAs in VSCC patients. Six of these lncRNAs were evaluated by real-time reverse transcription-polymerase chain reaction (RT-PCR) in 35 cases with benign vulvar diseases, VSCC and their pericarcinoma tissues according to the top 30 upregulated and top 30 down-regulated lncRNAs.

Materials and methods

Patients and sample collection

The present study protocol was approved by the Institutional Review Board of Shengjing Hospital Affiliated to China Medical University. Written informed consent was obtained from all patients. A total of 16 VSCC patients, diagnosed with VSCC between January 2013 and June 2015, were enrolled in the present study. Adjacent tissues in 4 VSCC patients, 7 cases of vulvar lichen sclerosus, 6 cases of vulvar leukoplakia and 2 cases of vulvar intraepithelial neoplasia (VIN) grade I were obtained as the control group. The clinical characteristics of the patients and their tumors are summarized in Table I. None of the patients had received prior radiotherapy or other anticancer treatment. All histopathological samples were obtained at surgery and were confirmed as VSCC. All samples were stored at −80°C until use.

Table I

Relationship between the expression of NEAT1, LINC00478 or MIR31HG and the clinicopathological features of the patients with VSCC.

Table I

Relationship between the expression of NEAT1, LINC00478 or MIR31HG and the clinicopathological features of the patients with VSCC.

No. of patients (%)NEAT1LINC00478MIR31HG
Age (years)
 ≤638 (50)2.59 (1.23, 2.90)8.44 (5.06, 7.09)9.09 (6.61, 13.67)
 >638 (50)4.09 (1.86, 7.68)8.93 (8.35, 10.45)8.91 (7.67, 10.04)
 P-value0.270.0121.000
FIGO Stage
  I7 (43.8)3.40 (1.49, 8.28)8.33 (5.55, 9.32)10.08 (6.46, 14.49)
  II1 (6.3)
 III8 (50)2.59 (1.23, 2.90)6.68 (5.26, 10.02)8.91 (7.67, 10.04)
 IV0 (0)
 P-value0.080.2521.000
Tumor differentitation
 Well9 (56.3)4.09 (1.86, 7.68)9.32 (8.36, 11.43)10.08 (9.62, 15.58)
 Moderate5 (31.3)2.71 (1.91, 3.00)5.55 (5.28, 6.68)7.08 (6.26, 7.90)
 Poor2 (12.5)1.41 (0.23)4.74 (4.47)7.64 (6.74)
 P-value0.2140.0030.007
Lymphatic metastasis
 N010 (60)3.22 (2.90, 6.46)8.93 (8.33, 10.22)8.91 (6.92, 12.02)
 N1, N2, N36 (37.5)1.34 (0.97, 1.77)5.71 (5.17, 9.32)9.14 (7.28, 11.72)
 P-value0.0020.0651.000

[i] VSCC, vulvar squamous cell carcinoma; FIGO, International Federation of Gynecology and Obstetrics.

Total RNA extraction

Total RNA was isolated from the frozen samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocols. All samples were quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA. USA). The purity of total RNA was examined by its absorbance ratio at 260–280 nm. The absorbance ratios at A260/280 were between 1.8 and 2.0.

lncRNA and mRNA microarray analysis

Four paired samples were chosen for the experiments performed at CapitalBio Corporation Laboratories (CapitalBio Corp., Beijing, China). Generally, total RNA which was extracted using TRIzol reagent for microarray was reverse-transcripted to double-stranded complementary DNA (cDNA). cDNA synthesis, purification, labeling and hybridization were carried out according to the manufacturer's instructions. lncRNA expression profiling was performed using lncRNAs and mRNA 4×180K Human Gene Expression Microarray V4.0 (CapitalBio Corp.). The data extracted were analyzed by Agilent Feature Extraction version 10.7 (Agilent Technologies, Santa Clara, CA, USA), and were summarized and normalized using Agilent GeneSpring software version 11.5. Differentially expressed lncRNAs and mRNAs were identified through an absolute fold-change >2 at a p<0.05.

Functional analysis

Gene ontology (GO) and pathway analyses were performed in order to better understand the functions of differentially expressed lncRNAs and mRNAs in VSCC. GO terms consisted of biological processes, cellular components, and molecular functions that were used to annotate and classify gene function. Pathway analysis was based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database that place differentially expressed mRNAs. In brief, the Fisher's exact test and t-test were used. A p<0.05 was considered to indicate a statistically significant result.

lncRNA-mRNA co-expression network analysis

A correlation analysis was constructed between differentially expressed lncRNAs and mRNA by calculating the Pearson correlation coefficients for each dysregulated lncRNA and mRNA. A significant correlation was defined as a correlation >0.99 or ≤0.99 at a p<0.05.

Real-time PCR

Single-stranded cDNA was reverse transcribed using the PrimeScript RT reagent kit with gDNA Eraser Perfect Real-Time (Takara Bio, Kyoto, Japan), according to the manufacturer's instructions. Real-time PCR was performed using SYBR Premix Ex Taq Tli RNase H Plus (Takara Bio) and a Roche LightCycler 480 II system (Roche, Basel, Switzerland). The 20 μl real-time PCR reaction mixture contained 3 μl cDNA, 10 μl SYBR Premix Ex Taq, 4 μl RNase-Free Water, and 1.5 μl, each, of forward and reverse primers. The PCR conditions were as follows: 30 sec at 95°C, followed by 40 cycles at 95°C for 5 sec and at 60°C for 30 sec. All samples were run in triplicate for analysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control. The relative abundance of lncRNA expression was calculated using the threshold cycle (Ct) method with relative quantitation (12). The primer sequences were designed in the laboratory and were synthesized by Sangon Biotech (Sangon, Shanghai, China), and are shown in Table II.

Table II

RT-PCR primers for lncRNA expression analysis.

Table II

RT-PCR primers for lncRNA expression analysis.

Target namePrimer sequence (5′-3′)
MIR31HG-Forward CAGGTCTCCAGGTGTTCCAG
MIR31HG-Reverse CCCAGGCTATGTCTTTCCTCT
LINC00478-Forward AAGATGACAAGAGCACCTCAAAG
LINC00478-Reverse GACCTCAGCCTCCTCCATTA
MEG3-Forward GCTGCCCATCTACACCTCA
MEG3-1-Reverse CCTCTTCATCCTTTGCCATC
NEAT1-Forward GATGCGCGCCTGGGTGTAGTT
NEAT1-Reverse CATGCAGCCTGCCCCACTGT
MALAT1-Forward CCGAGCTGTGCGGTAGGCATT
MALAT1-Reverse CGGTTTCCTCAAGCTCCGCCT
HOTAIR-Forward GGTCCTGCTCCGCTTCGCAG
HOTAIR-Reverse ACGCCCCTCCTTCCTCTCGC
GAPDH-Forward ACCCACTCCTCCACCTTTGAC
GAPDH-Reverse TGTTGCTGTAGCCAAATTCGT

[i] RT-PCR, real-time reverse transcription PCR; lncRNA, long non-coding RNA.

Statistical analysis

Statistical analysis was performed using Social Sciences (SPSS) 19.0 software (SPSS, Inc., Chicago, IL, USA). The independent-sample t-test was used to evaluate the expression levels of lncRNAs. Association between lncRNAs and clinicopathological factors was analyzed with the Mann-Whitney U test which was used for comparison between the two groups and the Kruskal-Wallis test which was used for comparison among the three groups. A p<0.05 (two-tailed) was regarded as statistically significant.

Results

Expression profiles of lncRNAs in VSCC tissues

From the lncRNA gene expression, dysregulated lncRNAs were identified in four paired vulvar squamous cell tumor tissues and the adjacent normal vulvar tissue samples. Among the 15,840 lncRNA transcripts analyzed, 312 lncRNAs were observed as upregulated (fold-change, >2; p<0.05) whereas 1,469 lncRNAs were detected as downregulated (fold-change >2; p<0.05) in the VSCC samples. Of these, AI769947 (fold-change, 34.2) was the most highly upregulated lncRNA in the VSCC tissues. FER1L4 (fold-change, 48.9) was the most extensively downregulated lncRNA. Hierarchical clustering analysis was performed to determine whether the expression patterns in the VSCC tissues were significantly different from these patterns in the adjacent normal tissues (Fig. 1A).

Figure 1

Heat map showing differentially expressed (A) lncRNAs and (B) mRNAs between VSCC and NT samples (fold-change, >2.0; p<0.05). Each row indicates one non-coding or coding RNA and each column represents one tissue sample. Red indicates high relative regulation and green indicates low relative downregulation.

Overview of the mRNA profile in VSCC

Up to 33,045 coding transcripts were detected in the VSCC tissues and the NTs, of which 21,788 showed significantly differential expression (fold-change, >2; p<0.05). Among them, 1,521 were upregulated and 4,694 were downregulated in the VSCC tissues. Their distinct expression patterns were evaluated by hierarchical clustering analysis (Fig. 1B).

GO and pathway analysis

Go analysis (comprised of biological processes, cellular components and molecular functions) was performed in order to determine the genes and gene product enrichment. Through GO analysis, the significant differentially expressed mRNAs were principally associated with extracellular organelles (Fig. 2), but none were linked with molecular function on GO analysis. Pathway analysis indicated that 38 pathways corresponded to the most significant differential pathways.

Figure 2

GO and pathway analysis of lncRNA co-expressed mRNAs. (A) The top 15 significantly enriched GO categories. The white bars represent biological processess and the black bars represent cellular components. (B) The top 15 pathway analysis of differentially expressed mRNAs. The white bars indicate significantly differential KEGG pathways and the black bars indicate pathways from PANTHER.

Overview of the co-expression network

In order to verify the correlation between differentially expressed lncRNAs and mRNAs, a coding/non-coding gene co-expression network was constructed in VSCC patients compared with the control group. The co-network showed that one lncRNA correlated with multiple mRNAs and reciprocally. According to the network, we found that lncRNA, FLNB-AS1, had the most correlative mRNAs such as HOXD11 and PKM (Fig. 3). Therefore, it was proposed that the expression profile of lncRNAs and mRNAs was significantly correlated.

Figure 3

Co-expression network between the lncRNA (FLNB-AS1) and mRNAs in VSCC tissues with NTs. The green circles represent mRNAs. Red lines represent a positive interaction between transcripts and blue lines a negative interaction.

Real-time PCR validation of several differentially expressed lncRNAs

According to fold difference, one upregulated lncRNA (NEAT1) was initially selected and five downregulated lncRNAs (MIR31HG, MALAT1 HOTAIR, LINC00478 and MEG3) were also selected for verification of expression in two sets of tissue samples. A general consistency between the micro-array and real-time PCR showed that the six selected lncRNAs were dysregulated between VSCC tissues and the control group (Fig. 4). The levels of HOTAIR, MALAT1, MEG3 and LINC00478 (p=0.000, p=0.001, p=0.023 and p=0.009, respectively) expression were decreased and NEAT1 was upregulated as indicated by the microarray analysis (p=0.002); whereas high expression of MIR31HG in the 35 samples, was detected, in opposition to the microarray data (p=0.007).

Figure 4

Validation of the differential expression of candidate lncRNAs using RT-PCR. (A–F) Expression of HOTAIR, MEG3, LINC00478, MALAT1, MIR31HG and NEAT1 in VSCC patients. (G) The expression levels of lncRNAs were quantified using RT-PCR in all samples.

Evaluation of MEG3 and MALAT1 as diagnostic biomarkers for VSCC

We constructed a receiver operating characteristic (ROC) curve to evaluate the diagnostic value of our findings. Both MEG3 and MALAT1 were downregulated in the VSCC samples. Among them, MEG3 was only detected in 19% (3/16) of the tumor samples, meanwhile, MALAT1 was found downregulated in 87.5% (14/16) of the VSCC samples. Furthermore, the areas under the ROC curve (AUCs) were 0.707 and 0.839, respectively (p<0.05) (Fig. 5).

Figure 5

ROC curves of MEG3 and MALAT1. The green line represents MEG3 and the blue one represents MALAT1. The black line is a reference line.

Correlation between NEAT1, LINC00478 and MIR31HG expression and clinicopathological features in VSCC patients

Lymphatic metastasis is the important measure of prognosis. As shown in Table I, we found that the level of NEAT1 expression in VSCC tissues was associated with lymph node metastasis (p=0.002). We also observed that there was a statistical relationship between LINC00478 and MIR31HG expression and tumor differentiation (p=0.003, p=0.007 respectively). However, no significant correlations were found between lncRNAs levels and other clinicopathological factors studied, including the International Federation of Gynecology and Obstetrics (FIGO) stage.

Discussion

Recent research has demonstrated the key role of lncRNAs in regulating embryogenesis and gene expression, and lncRNAs have emerged as drivers of tumor suppressive and oncogenic functions in various human solid tumors (13–16). Our results revealed that aberrantly expressed lncRNAs may be a factor in VSCC pathogenesis, potentially providing new biomarkers and therapeutic targets for VSCC.

VSCC is a rare malignant tumor, however, its morbidity and mortality rates have risen in the past few decades. It is generally believed that VSCC has two etiological pathways, i.e., a high-risk human papillomavirus (HPV)-dependent route and genetic alterations such as p53 mutations and silencing of p16INK4a (17,18).

Homeobox transcript antisense RNA (HOTAIR) is a well-known lncRNA transcribed from the HOXC cluster located on chromosome 12q13.3 (19). It has been proven that HOTAIR is involved in cancer progression and prognosis and may be an important target for cancer diagnosis and therapy (20–22). According to microarray analysis, the present study revealed that the level of HOTAIR expression was decreased in 75% (3/4) of the paired samples of tumor tissues. According to Sharma et al, there is a significant linear trend towards progressive HOTAIR downregulation among HPV-negative controls, HPV-positive non-malignant tumors and cervical carcinoma samples. They speculated that HOTAIR could be a potential target of E7, in HPV16-related cervical cancers (23).

Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is another long lncRNA correlated with HPV. Jiang et al found that MALAT1 was expressed in HPV-positive cervical squamous cells, but not in HPV-negative normal cervical squamous cells, which suggests that HPV correlates with MALAT1 deregulation in cervical cancer (24). Various previous studies have indicated that HOTAIR and MALAT1 are overexpressed in tumor tissues compared with the normal tissues (25–28). It was thought that HOTAIR and MALAT1 contribute to carcinogenesis in most tumors whereas other studies proved the role of HOTAIR and MALAT1 as tumor suppressors. HOTAIR expression was found to be increased in breast cancer patients; nonetheless, knockdown of HOTAIR could inhibit invasion (15). Lu et al found that breast cancer patients with HOTAIR high-expression had lower risk of recurrence and poor prognosis (29). It has also been demonstrated that the level of expression of MALAT1 in gliomas was lower than that in normal tissues (30). These discrepant results suggest that lncRNAs can differentially express depending on the cancer types and that lncRNAs have active roles in tumorigenesis. Moreover, our data revealed the opposite results when compared to many other studies, namely that HOTAIR and MALAT1 were down-regulated in VSCC tissues. Firstly, we inferred that HPV infection may be involved. Both HOTAIR and MALAT1 are correlated with HPV. Unfortunately, some of the patients we evaluated refused HPV examination and we were unable to determine the number of patients originally infected with HPV. HPV infection is not the most crucial factor in the level of expression of lncRNAs, since it is irrelevant in other types of tumors. However, HPV examination is still necessary for VSCC patients. In addition, it is meaningful that HPV infection be considered in lncRNA expression analysis as it is a useful factor. We hypothesized that lncRNAs such as HOTAIR and MALAT1 are expressed differentially in HPV-positive and HPV-negative VSCC samples and that these two lncRNAs may be involved in VSCC tumorigenesis by targeting HPV. Secondly, the number of cases is one limitation in our research. Thus, larger-scale studies are needed to validate our findings for further research.

The TP53-associated route and other genetic changes, such as CDKN2A (p16), also play a key role in the development of VSCC. Genetic mutations in TP53 have been detected in HPV-negative VSCCs. They may represent early changes in HPV-independent vulvar carcinogenesis (31). Expression of p53 was significantly increased in VSCC patient samples compared with the control group (32).

Maternally expressed gene 3 (MEG3) is a lncRNA which has been recently associated with p53. Lu et al found that p53 protein levels are affected by MEG3 overexpression in vitro. MEG3 was significantly downregulated in non-small cell lung cancer (NSCLC) tissues that may be affected by DNA methylation, and it partially regulated NSCLC cell proliferation and apoptosis via the activation of p53 (33). Zhu et al found that the level of MEG3 expression was reduced in hepatoma samples compared with adjacent non-tumor samples and interacts with the p53 DNA binding domain. Moreover, various p53 target genes were found to be deregulated after overexpression of MEG3 in hepatoma cells (34). Our data showed that MEG3 was downregulated in the VSCC patient samples. We speculate that MEG3 may operate as a tumor-suppressor in VSCC, whose mechanism may involve activation of p53.

Epigenetic silencing of p16 is also an early and important event in vulvar neoplasia (19). Montes et al showed that the lncRNA, MIR31HG, is upregulated in oncogene-induced senescence (OIS) which is considered an important mechanism of tumor suppression. They also found that knockdown of MIR31HG promoted a strong p16INK4A-dependent senescence phenotype. These results suggest that MIR31HG may repress p16INK4A expression in human cancer (35). MIR31HG is underactive in most cancers, but in lung and breast cancers, it appears to be upregulated by an, as yet, unknown mechanism (36,37). According to the microarray analysis, the present study revealed that the level of MIR31HG expression was decreased in 75% (3/4) of the paired samples of tumor tissues while it was upregulated in VSCC samples by RT-PCR. These findings imply that the microarray profiling results that are based on a small sample size may not entirely be reliable and need to be further verified by RT-PCR analysis using a greater number of samples.

The lncRNA MIR31HG is also correlated with poor prognosis and may be an important target for cancer diagnosis and therapy in gastric cancer (38). According to the present study, we found that the increased level of MIR31HG expression in VSCC was significantly associated with tumor differentitation (Table I), suggesting that MIR31HG may play a critical role, not only in the tumorigenesis of VSCC, but also in its prognosis. Patients with higher expression levels of MIR31HG may have poorer prognosis. However, not all patients who were diagnosed with VSCC within the last three years at our institution underwent surgery, and only two patients died of VSCC, therefore, we were unable to obtain reliable survival analysis.

Nuclear paraspeckle assembly transcript 1 (NEAT1) is a prognostic biomarker as well as MIR31HG (39). NEAT1 was upregulated in 75% (3/4) of VSCC tissues in accordance with the results of the microarray profile (Fig. 4). According to the study of Li et al, NEAT1 may play an oncogenic role in colorectal cancer which is involved in differentiation, invasion and metastasis (40). Our results revealed a greater association between NEAT1 expression and lymph node metastasis (Table I). Lymphatic metastasis usually indicates poor prognosis, suggesting that NEAT1 may play an important role in the prognosis of VSCC.

lncRNAs are emerging as biomarkers based upon ncRNA biology. Similar to microRNAs, various lncRNAs have been found in both urine and plasma, which can be easily obtained and provide for readily-available and stable diagnostics in order to detect cancers and cancer subtypes (41,42).

lncRNAs, such as MEG3 and MALAT1, have been shown to be potential biomarkers in other types of cancers. However, there are some critical issues that still need to be resolved before they can be applied clinically. Most recent studies have been performed using only small-scale samples. Therefore, further large-scale studies are needed to validate their findings. In addition, since conventional methods such as RNA extraction take too long and the quality of lncRNAs can be influenced by multiple factors during the analytical process, more stable platforms and more rapid analytical methods are required. Finally, the expression of lncRNAs could be confounded by multiple factors in tumorigenesis procedures such as pathology. Thus, our results must be validated in larger independent cohorts to confirm that lncRNAs can be used as reliable biomarkers for cancer detection.

The present study had several limitations including its small sample size. Although our results suggested that several lncRNAs were potentially important biomarkers in VSCC, we collected only 16 samples from VSCC patients. Thus, our results require validation using larger prospective studies involving a larger number of samples. Furthermore, not all patients who were diagnosed with VSCC within the last three years underwent surgery; some were lost in the follow-up and only two patients died from VSCC. Thus, it was difficult to arrive at a reliable survival curve due to the small number of cases available. In addition, there were no stage IV patients in our cases since most patients with stage IV chose not to undergo surgery. Therefore, future experiments targeting these aspects are needed to verify our results.

In conclusion, the present study was the first to determine global aberrant lncRNA expression in VSCC tissues compared with the adjacent non-tumorous tissues using microarray analysis. We also identified a panel of dysregulated lncRNAs that may be potential biomarkers as they were also correlated with VSCC carcinogenesis. These dysregulated lncRNAs may be VSCC-specific lncRNAs and may form the basis for future diagnostic, therapeutic and functional research on VSCC.

References

1 

Woelber L, Kock L, Gieseking F, Petersen C, Trillsch F, Choschzick M, Jaenicke F and Mahner S: Clinical management of primary vulvar cancer. Eur J Cancer. 47:2315–2321. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Bertone P, Stolc V, Royce TE, Rozowsky JS, Urban AE, Zhu X, Rinn JL, Tongprasit W, Samanta M, Weissman S, et al: Global identification of human transcribed sequences with genome tiling arrays. Science. 306:2242–2246. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, Guernec G, Martin D, Merkel A, Knowles DG, et al: The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res. 22:1775–1789. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Geisler S and Coller J: RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol. 14:699–712. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Roberts TC, Morris KV and Weinberg MS: Perspectives on the mechanism of transcriptional regulation by long non-coding RNAs. Epigenetics. 9:13–20. 2014. View Article : Google Scholar :

6 

Wang KC and Chang HY: Molecular mechanisms of long noncoding RNAs. Mol Cell. 43:904–914. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP, et al: Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 458:223–227. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Mercer TR, Dinger ME and Mattick JS: Long non-coding RNAs: Insights into functions. Nat Rev Genet. 10:155–159. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Huarte M and Rinn JL: Large non-coding RNAs: Missing links in cancer? Hum Mol Genet. 19:R152–R161. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Takahashi K, Yan I, Haga H and Patel T: Long noncoding RNA in liver diseases. Hepatology. 60:744–753. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Song H, Sun W, Ye G, Ding X, Liu Z, Zhang S, Xia T, Xiao B, Xi Y and Guo J: Long non-coding RNA expression profile in human gastric cancer and its clinical significances. J Transl Med. 11:2252013. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC T method. Methods. 25:402–408. 2001. View Article : Google Scholar

13 

Prensner JR and Chinnaiyan AM: The emergence of lncRNAs in cancer biology. Cancer Discov. 1:391–407. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Tsai MC, Spitale RC and Chang HY: Long intergenic noncoding RNAs: New links in cancer progression. Cancer Res. 71:3–7. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, et al: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long noncoding RNAs. Cell. 136:629–641. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Trietsch MD, Nooij LS, Gaarenstroom KN and van Poelgeest MI: Genetic and epigenetic changes in vulvar squamous cell carcinoma and its precursor lesions: A review of the current literature. Gynecol Oncol. 136:143–157. 2015. View Article : Google Scholar

18 

Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA, Goodnough LH, Helms JA, Farnham PJ, Segal E, et al: Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell. 129:1311–1323. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Gasco M, Sullivan A, Repellin C, Brooks L, Farrell PJ, Tidy JA, Dunne B, Gusterson B, Evans DJ and Crook T: Coincident inactivation of 14-3-3σ and p16INK4a is an early event in vulval squamous neoplasia. Oncogene. 21:1876–1881. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Lv XB, Lian GY, Wang HR, Song E, Yao H and Wang MH: Long noncoding RNA HOTAIR is a prognostic marker for esophageal squamous cell carcinoma progression and survival. PLoS One. 8:e635162013. View Article : Google Scholar : PubMed/NCBI

21 

Chen FJ, Sun M, Li SQL, Wu QQ, Ji L, Liu ZL, Zhou GZ, Cao G, Jin L, Xie HW, et al: Upregulation of the long non-coding RNA HOTAIR promotes esophageal squamous cell carcinoma metastasis and poor prognosis. Mol Carcinog. 52:908–915. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Ge XS, Ma HJ, Zheng XH, Ruan HL, Liao XY, Xue WQ, Chen YB, Zhang Y and Jia WH: HOTAIR, a prognostic factor in esophageal squamous cell carcinoma, inhibits WIF-1 expression and activates Wnt pathway. Cancer Sci. 104:1675–1682. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Sharma S, Mandal P, Sadhukhan T, Roy Chowdhury R, Ranjan Mondal N, Chakravarty B, Chatterjee T, Roy S and Sengupta S: Bridging links between long noncoding RNA HOTAIR and HPV oncoprotein E7 in cervical cancer pathogenesis. Sci Rep. 5:117242015. View Article : Google Scholar : PubMed/NCBI

24 

Jiang Y, Li Y, Fang S, Jiang B, Qin C, Xie P, Zhou G and Li G: The role of MALAT1 correlates with HPV in cervical cancer. Oncol Lett. 7:2135–2141. 2014.PubMed/NCBI

25 

Li D, Feng J, Wu T, Wang Y, Sun Y, Ren J and Liu M: Long inter-genic noncoding RNA HOTAIR is overexpressed and regulates PTEN methylation in laryngeal squamous cell carcinoma. Am J Pathol. 182:64–70. 2013. View Article : Google Scholar

26 

Wu ZH, Wang XL, Tang HM, Jiang T, Chen J, Lu S, Qiu GQ, Peng ZH and Yan DW: Long non-coding RNA HOTAIR is a powerful predictor of metastasis and poor prognosis and is associated with epithelial-mesenchymal transition in colon cancer. Oncol Rep. 32:395–402. 2014.PubMed/NCBI

27 

Ishibashi M, Kogo R, Shibata K, Sawada G, Takahashi Y, Kurashige J, Akiyoshi S, Sasaki S, Iwaya T, Sudo T, et al: Clinical significance of the expression of long non-coding RNA HOTAIR in primary hepatocellular carcinoma. Oncol Rep. 29:946–950. 2013.PubMed/NCBI

28 

Li X, Wu Z, Mei Q, Li X, Guo M, Fu X and Han W: Long non-coding RNA HOTAIR, a driver of malignancy, predicts negative prognosis and exhibits oncogenic activity in oesophageal squamous cell carcinoma. Br J Cancer. 109:2266–2278. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Lu L, Zhu G, Zhang C, Deng Q, Katsaros D, Mayne ST, Risch HA, Mu L, Canuto EM, Gregori G, et al: Association of large noncoding RNA HOTAIR expression and its downstream intergenic CpG island methylation with survival in breast cancer. Breast Cancer Res Treat. 136:875–883. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Han Y, Wu Z, Wu T, Huang Y, Cheng Z, Li X, Sun T, Xie X, Zhou Y and Du Z: Tumor-suppressive function of long noncoding RNA MALAT1 in glioma cells by downregulation of MMP2 and inactivation of ERK/MAPK signaling. Cell Death Dis. 7:e21232016. View Article : Google Scholar : PubMed/NCBI

31 

Del Pino M, Rodriguez-Carunchio L and Ordi J: Pathways of vulvar intraepithelial neoplasia and squamous cell carcinoma. Histopathology. 62:161–175. 2013. View Article : Google Scholar

32 

Sadalla JC, Lourenço SV, Sotto MN, Baracat EC and Carvalho JP: Claudin and p53 expression in vulvar lichen sclerosus and squamous-cell carcinoma. J Clin Pathol. 64:853–857. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Lu KH and Li W, Liu XH, Sun M, Zhang ML, Wu WQ, Xie WP, Hou YY, Lu KH and Li W: Long non-coding RNA MEG3 inhibits NSCLC cells proliferation and induces apoptosis by affecting p53 expression. BMC Cancer. 13:4612013. View Article : Google Scholar : PubMed/NCBI

34 

Zhu J, Liu S, Ye F, Shen Y, Tie Y, Zhu J, Wei L, Jin Y, Fu H, Wu Y, et al: Long noncoding RNA MEG3 interacts with p53 protein and regulates partial p53 target genes in hepatoma cells. PLoS One. 10:e01397902015. View Article : Google Scholar : PubMed/NCBI

35 

Montes M, Nielsen MM, Maglieri G, Jacobsen A, Højfeldt J, Agrawal-Singh S, Hansen K, Helin K, van de Werken HJ, Pedersen JS, et al: The lncRNA MIR31HG regulates p16INK4A expression to modulate senescence. Nat Commun. 6:69672015. View Article : Google Scholar

36 

Shi Y, Lu J, Zhou J, Tan X, He Y, Ding J, Tian Y, Wang L and Wang K: Long non-coding RNA Loc554202 regulates proliferation and migration in breast cancer cells. Biochem Biophys Res Commun. 446:448–453. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Xi S, Yang M, Tao Y, Xu H, Shan J, Inchauste S, Zhang M, Mercedes L, Hong JA, Rao M, et al: Cigarette smoke induces C/EBP-β-mediated activation of miR-31 in normal human respiratory epithelia and lung cancer cells. PLoS One. 5:e137642010. View Article : Google Scholar

38 

Nie FQ, Ma S, Xie M, Liu YW, De W and Liu XH: Decreased long noncoding RNA MIR31HG is correlated with poor prognosis and contributes to cell proliferation in gastric cancer. Tumour Biol. Dec 21–2015.Epub ahead of print. PubMed/NCBI

39 

Wu Y, Yang L, Zhao J, Li C, Nie J, Liu F, Zhuo C, Zheng Y, Li B, Wang Z, et al: Nuclear-enriched abundant transcript 1 as a diagnostic and prognostic biomarker in colorectal cancer. Mol Cancer. 14:1912015. View Article : Google Scholar : PubMed/NCBI

40 

Li Y, Li Y, Chen W, He F, Tan Z, Zheng J, Wang W, Zhao Q and Li J: NEAT expression is associated with tumor recurrence and unfavorable prognosis in colorectal cancer. Oncotarget. 6:27641–27650. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Huang X, Yuan T, Tschannen M, Sun Z, Jacob H, Du M, Liang M, Dittmar RL, Liu Y, Liang M, et al: Characterization of human plasma-derived exosomal RNAs by deep sequencing. BMC Genomics. 14:3192013. View Article : Google Scholar : PubMed/NCBI

42 

Lee GL, Dobi A and Srivastava S: Prostate cancer: Diagnostic performance of the PCA3 urine test. Nat Rev Urol. 8:123–124. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ni S, Zhao X and Ouyang L: Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance. Oncol Rep 36: 2571-2578, 2016.
APA
Ni, S., Zhao, X., & Ouyang, L. (2016). Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance. Oncology Reports, 36, 2571-2578. https://doi.org/10.3892/or.2016.5075
MLA
Ni, S., Zhao, X., Ouyang, L."Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance". Oncology Reports 36.5 (2016): 2571-2578.
Chicago
Ni, S., Zhao, X., Ouyang, L."Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance". Oncology Reports 36, no. 5 (2016): 2571-2578. https://doi.org/10.3892/or.2016.5075
Copy and paste a formatted citation
x
Spandidos Publications style
Ni S, Zhao X and Ouyang L: Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance. Oncol Rep 36: 2571-2578, 2016.
APA
Ni, S., Zhao, X., & Ouyang, L. (2016). Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance. Oncology Reports, 36, 2571-2578. https://doi.org/10.3892/or.2016.5075
MLA
Ni, S., Zhao, X., Ouyang, L."Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance". Oncology Reports 36.5 (2016): 2571-2578.
Chicago
Ni, S., Zhao, X., Ouyang, L."Long non-coding RNA expression profile in vulvar squamous cell carcinoma and its clinical significance". Oncology Reports 36, no. 5 (2016): 2571-2578. https://doi.org/10.3892/or.2016.5075
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team