Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
December-2016 Volume 36 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 36 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells

  • Authors:
    • Peizhen Li
    • Jun Ying
    • Qingli Chang
    • Wen Zhu
    • Guangjian Yang
    • Teng Xu
    • Huiguang Yi
    • Ruowang Pan
    • Enyong Zhang
    • Xiaofeng Zeng
    • Chunxia Yan
    • Qiyu Bao
    • Shengbin Li
  • View Affiliations / Copyright

    Affiliations: School of Forensic Medicine, Xi'an Jiaotong University, Xi'an, Shaanxi 710000, P.R. China, School of Laboratory Medicine and Life Science/Institute of Biomedical Informatics, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China, 118 Hospital of PLA, Wenzhou, Zhejiang 325000, P.R. China
  • Pages: 3536-3544
    |
    Published online on: October 11, 2016
       https://doi.org/10.3892/or.2016.5162
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

We studied phycoerythrin (PE) in human SW480 tumor cells and the underlying molecular mechanisms of action. PE inhibited cell proliferation as evidenced by CCK-8 assay. The IC50 values of phycoerythrin were 48.2 and 27.4 µg/ml for 24 and 48 h of exposure, respectively. PE induced apoptosis and cell cycle arrest in SW480 cells as observed under electron microscopy and with flow cytometry. Apoptosis increased from 5.1 (controls) to 39.0% in 80.0 µg/ml PE-treated cells. Differences in protein expression were identified using proteomic techniques. Protein spots (1018±60 and 1010±60) were resolved in PE-treated and untreated group. Forty differential protein spots were analyzed with MALDI-TOF-MS, including GRP78 and NPM1. The expression as measured by qPCR and western blotting agreed with data from two-dimensional electrophoresis. GRP78, NPM1, MTHSP75, Ezrin and Annexin A2 were decreased and HSP60 was increased after PE treatment, indicating that PE may target multiple proteins to induce apoptosis.

Introduction

Colon cancer, a highly malignant tumor, is the 3rd most common cause of cancer-related death according to global epidemiological data and the prevalence is increasing in the face of better nutrition and improved living conditions (1). Traditional therapeutic methods for treating colon cancer include surgical tumor removal, chemotherapy and radiotherapy, but these are limited by tumor recurrence and significant side-effects. Specifically, 5-year survival of hepatic metastases from large bowel carcinomas with surgical treatment is less than 30% (2), thus, better therapies or approaches are needed urgently. Investigations of signaling molecules that are expressed in tumors may be a promising avenue.

Gracilaria lemaneiformis (kelp referred to as Nostoc), is a Gracilaria species (gigartinales rhodophyta) and a rich source of polysaccharides, protein, vitamins and multiple minerals such as phosphorus, calcium, iodine, iron, zinc and magnesium (3). Phycoerythrin (PE) from G. lemaneiformis is an important light-harvesting protein with potential use in the food and drug industries with potential antioxidant, immunomodulatory, antitumor, radiation-resistant, anti-anemic and anti-aging properties as well as few side-effects (4). Chen et al (5) demonstrated that PE facilitated macrophage phagocytic activity in tumor-bearing mice and enhanced non-specific immunity. Gao et al (6) revealed that PE inhibited human breast cancer MCF-7 cells and induced apoptosis related to cell cycle arrest but the antitumor effects were complex and the molecular mechanism for this outcome remains unclear.

Genomics permits the study of tumorigenesis at the molecular level and proteomics allows a focus on expression and function of tumor proteins (7) for screening and identifying tumor biomarkers (8,9), classifying tumors (10), and for developing drugs as well as assessing mechanisms of oncogenesis (11). Thus, with proteomic technology and bioinformatic analysis we investigated molecular mechanisms of PE inhibition of SW480 cells and identified the proteins associated with proliferation and inhibition. These data will offer a theoretical foundation for future development of cancer therapeutics.

Materials and methods

Cell strain

The human colon cancer SW480 cell line was purchased from the Cell Bank at the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI-1640 containing 10% fetal bovine serum (FBS) in an incubator with 5.0% CO2 at 37°C.

Reagents

PE was extracted from fresh Gracilaria lemaneiformis (12) and the purity of PE was 5.37 (A565/280 nm). RPMI-1640 medium and trypsin were products of Gibco (Waltham, MA, USA). FBS was purchased from Hangzhou Chinese Holly Biotechnology Ltd. (Hangzhou, China). CCK-8 was a product of Sigma-Aldrich (St. Louis, MO, USA). An Annexin V/PI staining kit was purchased from Lianke Biotechno Co., Ltd., (Hangzhou, China). Cell culture plates were obtained from Corning Costar Corp. (Cambridge, MA, USA). Reverse transcription and PCR kits were products of Takara Biotechnology Ltd. (Dalian, China). Primary and secondary antibodies were from Beyotime Institute of Biotechnology (Shanghai, China).

CCK-8 testing inhibition of PE on SW480 growth

Cells (5×104/ml) were inoculated into 96-well culture plates (100 µl each well) and 24 h later, supernatant was removed and PE medium was added at 6 different concentrations (0, 5, 10, 20, 40 and 80 µg/ml) in sextuplicate. Cisplatin was a positive control. After incubation CCK-8 was added (20 µl/well) for another 4 h. Absorbance was read at 490 nm and IC50 values for PE were calculated (R = (Acontrol - Apositive)/Acontrol × 100%) using the Logit method.

Microscopic observation

Polylysine-preprocessed coverslips were seeded in 6-well plates and 1.5 ml cell suspension (1.5×104/ml) was added to each well. Next, 24 h later, cells were treated with PE (0, 20, 40 and 80 µg/ml) for 48 h. Some samples were examined under an inverted microscope, and others were collected, rinsed three times with 0.01 mol/l PBS (pH 7.0), followed by fixation with 2.5% glutaraldehyde and 1% osmic acid. Ethanol was used for dehydration. After drying under CO2 and ion sputtering and metal spraying, samples were visualized under a scanning electron microscope (Hitachi S-3000N; Hitachi, Ltd., Tokyo, Japan) (13).

FCM measurement of apoptosis

Cells were seeded (5×104/ml) into 25-ml culture flasks for 24 h and were treated with PE at different concentrations (0, 10, 20, 40 and 80 µg/ml, respectively) for 48 h. According to the Annexin V/PI kit instructions, primary medium was removed and pancreatin solution without EDTA was added for digestion which was terminated by adding medium. After centrifugation, 0.5 ml PBS (10 mmol/l, pH 7.0), 10 ml media with binding reagent, 1.25 µl FITC (200 µg/ml) and 10 µl PI (50 µg/ml) were added into each tube successively. The reaction was at room temperature and in the dark for 10 min and flow cytometry (BD Biosciences, San Jose, CA USA) was used to measure cells and data were analyzed using WinMDI 3.0 (14). All experiments were performed in triplicate.

FCM cell cycle determination

Cell samples were prepared and analyzed as described above. Cells treated with PE for 48 h were collected and fixed with pre-cooled 70% ethanol overnight at 4°C and washed with 0.01 mol/l PBS three times. After permeabilization, cells were treated with RNAse (final concentration, 10 µg/ml) for 1 h at 37°C and then stained with PI (final concentration, 50 µg/ml). The reaction was incubated at 37°C in the dark for 30 min and flow cytometry was used to measure cell cycle arrest. Data were analyzed using BD FACSDiva software (14). All experiments were repeated three times.

Proteomics for analyzing protein

Cell lysis buffer (200 µl, 7 mol/l Urea, 2 mol/l thiourea, l4% CHAPS, 40 mmol/l Tris, 65 mmol/l DTT, 5 mmol/l PMSF, 1 mg/ml DNaseI and 0.25 mg/ml RNase A) was added to 1.5×106 cells and incubated for 30 min with intermittent swirling. The solution was centrifuged at 15,000 rpm for 30 min at 4°C and supernatant was collected. Total protein was quantified with a BCA protein assay kit (15) and stored at −80°C.

First-dimension of analysis with isoelectric focusing electrophoresis was used on 200 µg samples mixed with loading buffer (7 mol/l urea, 2 mol/l thiourea, 4% CHAPS, 65 mmol/l DTT, 0.2% BioLyte and 0.001% bromophenol blue). IPG glue solid state strips were used as carriers. The maximum current was 60 µA/IPG strip, which were hydrated and focused at 20°C. Isoelectric focusing was performed under 8,000 V (total voltage-time of 30,000 Vh). Focused tapes were put into equilibration buffer (6 mol/l urea, 2% SDS, 50 mmol/l Tris-HCl, pH 8.8 and 20% glycerol) containing 1% DTT and 4% iodoacetamide for 15 min. Then, tapes were transferred to 12% PAGE covered with agarose. 2D analysis SDS-PAGE was electrophoresed. The current (10 mA/gel) was maintained for 15 min and increased to 30 mA/gel until bromophenol blue reached the bottom. After silver staining (16), GS-800 transmission and scans were used to collect and analyze gel images (resolution 63.5×63.5). For protein identification by MS, protein dot matching was performed between analytical silver stained gels and preparative gels to correlate the precise spot position to be excised. Protein spots were compared by image-matching analysis using PDQuest 7.4.0.

Mass spectrum identification of differential protein spots

Differential spots were excised from gels and placed into 1.5-ml tubes, washed with Milli-Q water three times followed by addition of destaining solution (15 mmol/l potassium ferricyanide and 50 mmol/l sodium thiosulfate were premixed at a volume ratio of 1:1) and samples were incubated for 20 min. After two additional washes with Milli-Q water, pellets were immersed in acetonitrile and dehydrated. Acetonitrile was discarded and trypsin digestion (12.5 mg/l, performed with 20 mmol/l ammonium bicarbonate) was added and incubated at 4°C. Then the gel was kept at 37°C for 18 h for enzymatic hydrolysis. Enzymatic reaction liquid was collected and the gel was washed with 0.1% TFA/50% acetonitrile mixture twice with slight agitation to extract peptide fragments. Extraction liquid was dried under nitrogen and redissolved in 0.7 µl 5.0 g/l CHCA matrix (dissolved in 50% acetonitrile and 0.1% TFA). Samples were loaded on a stainless steel 192-well target plate and air-dried. Peptide mass fingerprints were obtained with MALDI-TOF-M (Bruker Daltonics, Inc., Billerica, MA, USA) and precision peaks quality was corrected according to automatic switching peaks of trypsin as an interior reference. Mass spectrometric data were retrieved using Mascot software (www.matrixscience.co.uk) in Swiss-Prot and NCBI nr database (retrieval parameters: trypsin digestion, permissible error ± 0.2 Da, oxidative modification of methionine, iodoacetamide modification of cysteine) (17).

qPCR technique identifying mRNA expression of differential proteins

The primer sets (Table I) were designed for amplification of β-actin and the expressed genes using the Premier 5.0 software and synthesized by Shanghai Sunny Biological Technology Co, Ltd. (Shanghai, China). Total RNA was extracted from PE-treated and untreated SW480 cells with Dnase I by RNase-Free Dnase Set (Qiagen, Hilden, Germany). cDNA was obtained by reverse transcription using PrimeScript RT-PCR kit (Takara). SYBR-Green I-based qPCR was performed according to routine protocols (18) using the ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA) and three replicates were performed for all genes in each sample. Relative changes of gene expression were measured using the 2−ΔΔCt method. Relative quantification of targets in each sample was carried out using β-actin as a control.

Table I.

Primer sequences and product sizes.

Table I.

Primer sequences and product sizes.

Gene symbolNucleotide sequenceProduct size (bp)Temperature (°C)
GRP78Forward: GGGCCCTGTCTTCTCAACAT21059
Reverse: GAGTCGAGCCACCAACAAGA
NPM1Forward: GGAGGTGGTAGCAAGGTTCC14960
Reverse: GATTTCTTCACTGGCGCTTTT
Annexin A2Forward: GGACGCGAGATAAGGTCCTG14559
Reverse: GCTTTCTGGTAGTCGCCCTT
EzrinForward: CGCTCTAAGGGTTCTGCTCTG11460
Reverse: TTGGTTTCGGCATTTTCGGT
HSP60Forward: ACAAGAACATTGGAGCTAAACTTGT10459
Reverse: TTGGCTATAGAGCGTGCCAG
MTHSP75Forward: AGGGAGCTCCTGGCTAGAAA14459
Reverse: GCCAGAACTTCCAGAGCCTT
p53Forward: GAGCACTGCCCAACAACAC22458
Reverse: ATGGCGGGAGGTAGACTGA
Caspase-3Forward: ATGGAAGCGAATCAATGGAC24256
Reverse: ATCACGCATCAATTCCACAA
Caspase-9Forward: GCGAACTAACAGGCAAGCA14458
Reverse: CCAAATCCTCCAGAACCAAT
Bcl-2Forward: GTGGAGGAGCTCTTCAGGGA30456
Reverse: AGGCACCCAGGGTGATGCAA
β-actinForward: CTTCCAGCCTTCCTTCCTGG11060
Reverse: CTGTGTTGGCGTACAGGTCT
Western blotting testing

Samples were mixed with Laemmli's loading buffer, boiled for 5 min, and subjected to 12% SDS-PAGE at 120 V followed by electroblotting to nitrocellulose membrane for 2 h at 80 V. Membranes were blocked for 1 h with 5% skim milk in TBS at room temperature and subsequently probed overnight with anti-p53, anti-caspase-3 and anti-β-actin. The membranes were rinsed and incubated with an HRP-conjugated secondary antibody. Following the secondary antibody incubation, the membranes were rinsed and bound antibodies were detected using enhanced chemiluminescence according to the manufacturer's instructions. The protein bands were quantified by densitometry analysis.

Statistical methods

The SPSS 16.0 software was used to carry out statistical analysis and data are means ± SD. A Students t-test was used to assess differences which were considered statistically significant at P<0.05.

Results

PE inhibits SW480 cell growth

PE inhibited SW480 cell growth in a dose- and time-dependent manner (Fig. 1A). In addition, IC50 values of PE for 24 and 48 h of exposures were 48.2 and 27.4 µg/ml, respectively. PE inhibited cell growth at 80 µg/ml for 24 h and data for beyond 48 h with 40 µg/ml were similar to those of positive controls (Fig. 1B).

Figure 1.

Inhibitory effects of PE on SW480 cell growth.

Morphological effect of PE on SW480 cells

Microscopic data indicate that control SW480 cells had spindle shapes, adhered to the cell wall and tight junctions and were partially overlapped. Nuclei were large and the nucleolus was clear and dark. Increasing PE concentration caused cell shrinkage, loosening of cell junctions and some cell detachment and floating. In addition, nuclei were shrunk and some were broken (Fig. 2A). Control SW480 cells had denser and bigger microvilli on the surface, radially stretching outward and regularly arranged as observed under a scanning electron microscope. Increasing PE concentrations caused shortening of microvilli and cell morphology was abnormal and damaged. After treatment with 40 µg/ml PE cell shrinkage was obvious, and many apoptotic bodies budded from the cell membrane (Fig. 2B).

Figure 2.

Morphological changes in SW480 cells treated with PE. (A1-A4) Inverted microscope (magnification, ×20); (B1-B4) scanning electron microscope (R, ×5,000); (1–4) 0, 20, 40 and 80 µg/ml PE for 48 h.

PE-induced apoptosis in SW480 cells

The results of the Annexin V-FITC/PI staining showed that, with the increase of the PE concentration, the apoptosis rate correspondingly increased (Fig. 3). The early stage apoptosis rate increased from 3.8 to 29.0% while in the later stage it increased from 3.3 to 10.0%.

Figure 3.

Effects of PE on SW480 cell apoptosis. (A-E) 0, 10, 20, 40 and 80 µg/ml PE for 48 h. (F) Histogram of percent apoptotic cells from A-E. Values are means ± SD of three measurements. *P<0.05, **P<0.01 a significant difference between control and PE groups, as analyzed by the Students t-test).

PE affects cell cycle distribution in SW480 cells. After PE treatment for 48 h, FCM was used to analyze the cell cycle. Table II shows that most cells were arrested in the G0/G1 phase and cells were arrested in the S stage in controls. PE treatment increased cells arrested in G2/M phases. Flow cytometry confirmed that PE induced G2/M cell cycle arrest in SW480 cells and this was concentration-dependent. PE-induced apoptosis may be related to cell cycle inhibition at G2/M stages.

Table II.

Effect of PE on SW480 cell cycle.

Table II.

Effect of PE on SW480 cell cycle.

Group G0/G1 (%)S (%)G2/M (%)
Control91.04±0.038.83±0.050.13±0.03
10 µg/ml PE69.45±0.0422.92±0.04 7.63±0.06a
20 µg/ml PE69.52±0.0520.06±0.09 10.41±0.12a
40 µg/ml PE66.34±0.0420.20±0.08 13.46±0.12a
80 µg/ml PE47.66±0.0723.39±0.06 28.95±0.09b

a P<0.05

b P<0.01 indicates a significant difference between the control and PE groups.

DE atlas analysis

Total proteins of control and PE-treated group were subjected to 2DE analysis and data show that 3 gels from controls generated an average of 1010±60 protein dots whereas 3 gels from the treatment group had 1018±60 dots and matching score was 99%. Comparing two groups of proteins with expression that was 2-fold more or less were consistent with the data from the gels and these proteins were selected for additional analysis. A total of 379 proteins were identified (Fig. 4A), including 188 upregulated and 191 downregulated proteins. Of these 40 protein dots were chosen for MS analysis (Fig. 4B). Fifteen of their positive protein spots (Table III) are implicated in apoptosis, oxidative stress, lipid and ion transport and tumor cell growth. To validate the MS data, qPCR and western blotting were used to analyze effects of PE on the expression of GRP78, MTHSP75, HSP60, NPM1, Ezrin, Annexin A2, p53, caspase-3 and Bcl-2 (Figs. 5 and 6). Compared with controls, differences were statistically significant (P<0.05 or P<0.01) and these data agreed with protein analyses.

Figure 4.

Representative 2-DE images of proteins after PE treatment. (A) 2-DE GE of total proteins from SW480 cells; control group (0 µg/ml PE for 48 h), PE group (40.0 µg/ml PE for 48 h); (B) enlargement of gel protein spots.

Figure 5.

Effects of PE on gene expression in SW480 cells. Values are means ± SD of three measurements. *P<0.05, **P<0.01 a significant difference between the control and PE groups, as analyzed by the Students t-test).

Figure 6

(A and B). Western blots of differentially expressed proteins (p53 and caspase-3). Values are means ± SD of three measurements. *P<0.05, **P<0.01 significant difference between control and PE groups, as analyzed by the Students t-test).

Table III.

Protein spot data identified by MS.

Table III.

Protein spot data identified by MS.

No.Spot no.Match toProteinRelative expressionMatchSequence coverageScorePIMr
  12655gi|1650723778 kDa glucose-regulated protein precursor (GRP78)$396 (328)53%83555.0772402
  22531gi|21961605Keratin 10$27 (16)36%5365.0959020
  33330gi|10835063Nucleophosmin isoform 1 (NPM1)$68 (49)37%16454.6432726
  44373gi|119607256hCG1988300, isoform CRA_a$98 (89)41%28955.0947241
  54485gi|181573Cytokeratin 8 (CK8)$266 (226)59%54145.5253529
  65164gi|1568551Histone (H2B)$27 (53)26%155510.3113928
  76082gi|435476Cytokeratin 9$32 (28)17%9265.1962320
  86302gi|4757756Annexin A2 isoform 2$104 (87)61%25237.5738808
  96379gi|28317Unnamed protein product$19 (18)4%6485.1759720
106658gi|21614499Ezrin$152 (98)41%19205.9469484
1117111gi|18285580K-H protein#21 (21)8%3204.3460228
123524gi|3154294760 kDa heat shock protein, mitochondrial HSP60#123 (107)46%34405.761187
134762gi|292059MTHSP75$167 (138)58%39745.9774019
142344gi|306875C protein#87 (70)28%23155.132004
151041gi|7331218Keratin 1#16 (16)0.054538.1666149

Discussion

PE, a phycobiliprotein found in plants such as red alga and G. lemaneiformis, is the product of covalent binding of apoprotein and an open-chain tetrapyrrole chromophore via the formation of thioether and it fluoresces orange (19). Its antitumor effects are of interest for treating tumors as a photosensitizer or a fluorescent probe but few studies suggest any direct cancer inhibition (20). Recent reports of antitumor effects of PE indicate that PE significantly suppresses growth of human cervical cancer HeLa cells and this is dose-dependent. With PE treatment, HeLa cells were arrested at the G2/M phase and cell proliferation was inhibited and apoptosis occurred (21) but how this happened was unclear. Previous studies suggest that PE induced cell apoptosis perhaps by reducing mitochondrial membrane potentials and damaging their integrity (22), which was essential for live cancer cells. Also, PE caused cell cycle arrest and apoptosis by upregulating expression of cyclin dependent kinase CDC25A which increased cyclin at G1 and S stages and indirectly downregulated its binding protein, CDK2 (23). With proteomics, we screened and identified 15 proteins related to PE inhibition of colon cancer, including metabolism- and apoptosis-related proteins, a cytoskeletal and a carrier protein and another protein of unknown function. Thus, 6 proliferation-associated protein proteins had modified expression and most were related to apoptosis, or signal pathway interference.

Heat shock proteins (HSPs) have highly conserved structures and are common to all biological cells as they participate in cell growth and metabolism. HSPs exist as HSP70, 90, 60 and micromolecular HSP (24). Among the Hsp70 family are cytoplasmic HSP70, mitochondria HSP75 and endoplasmic reticulum (ER) glucose regulatory protein GRP78 or immune globulin heavy chain binding protein, which can promote correct protein folding to maintain normal ER function of and interaction with enzyme 1 (IRE1), PKR-like ER kinase (PERK) and activating transcription factor 6 (ATF6) to turn on/ER stress for tumor cells to escape stress-induced apoptosis. Also, GRP78 may upregulate expression of anti-apoptotic molecule Bc1-2 within the nucleus to bind with caspase-7 and caspase-12 in the cytoplasm to prevent ER stress and subsequent cell cascades (25). GRP78 was reported to be critical to tumor cell growth by inhibiting expression of fibrosarcoma cells and constraining tumor formation in animals. Neuroglioma cells proliferate well when GRP78 is highly expressed. When the GRP78 gene was knocked out (26), cancer cell apoptosis was accelerated via induction of ER stress. Dong et al (27) reported that GRP78 facilitated tumor growth by improving proliferation and the anti-apoptotic ability of cancer cells. MTHSP75 is a chaperone located in mitochondria that helps regulate biological functions including cell survival, proliferation, chondriosome synthesis and transfer of intracellular protein (28). MTHSP75 decreases cell damage by regulating opening of the mitochondrial permeability transition pore (29) and high expression of HSP75 may enhance anti-apoptotic capacities and motility of cancer cells and cause cell proliferation and transfer. Chen and Hang (30) observed changes in tumor growth and transfer ability using siRNA to silence HSP75 in a human osteosarcoma cell line and reported that this decreased cancer cell growth and transference. In most apoptotic systems, Hsp60 can be released from the mitochondria and aggregate cytoplasmically and enhance apoptosis. Cell death was also induced by active substance BMD188. Hsp60 accelerated caspase maturity and activation of caspase-3 (31). In the marrow stromal HS-5 cell line, HSP60 could activate caspase-3 and caspase-9 but not caspase-8, prompting release of mitochondrial cytochrome c to the cytoplasm, causing apoptosis (32). In the present study, we found that SW480 cells underwent cell cycle arrest and increased apoptosis after PE treatment and that GRP78, mtHSP75 and HSP60 were downregulated, indicating similar functions.

NPM (or B23, NO38 and nurnatri), is a multifunctional phosphorylated shuttle protein (33) important to various physiological and pathological processes including centrosome duplication, ribosome synthesis, DNA repair, molecular chaperone and stress response caused by stimulants in vitro and in vivo. Previous studies confirmed that downregulation of mRNA of NPM slowed cell cycle progression and mitosis, and induced apoptosis and this may occur via p53 inhibition (34). After UV radiation cells were damaged and NPM reset the nucleoplasm and regulated p53 and HDM2. By binding to HDM2, NPM negatively regulated HDM2-p53 and stabilized p53 (35). Colombo et al (36) demonstrated that NPM interacted with p53 after stress and the p53 enhanced function may be attributable to transcriptional activity of downstream factor p21 to inhibit tumorigenesis. When NPM siRNA transfected A431 cells were tested, cell proliferation decreased and stopped at the S stage, and fewer cells were in the mitotic phase, inhibiting cell growth (37). NPM1 in SW480 cells was down-regulated significantly after PE treatment and was similar to NPM1 silencing: SW480 cell growth was reduced indicating that NPM1 may be a target of PE to inhibit tumorigenesis.

Ezrin, the coding gene of vli2, as a member of the ezrin-radixin-moesin (ERM) family is a membrane cytoskeletal cross-linker protein involved in cell interaction and cell matrices via regulation of actin, controlling cellular morphology, adjusting cell adhesion molecules, signal transduction and engulfing tumor cells (38). Ezrin has a significant role in the development, infiltration and transfer of tumor cells. Localized to a specific membrane area, ezrin combines with membrane proteins (such as CD44, CD95 and ICAM-2) and scaffolding proteins (such as E3KARR and EBP50) to activate the membrane cytoskeletal chain via signal transduction. Also, tyrosine phosphorylation sites on ezrin, when linked to PIP2, are activated and polar-oriented (39). As a receptor of tyrosine kinase, ezrin can intracellularly signal to control cell proliferation and differentiation after a particular tyrosine kinase phosphorylation. Decreasing expression of ezrin protein inhibits cell proliferation and cells in metaphase cells decrease (40). Also, a significant reduction of cellular pseudopod formation and their migration and invasiveness was reduced. Ezrin may do this through many pathways, but specifics are not known. Similarly, in SW480 cells, PE can reduce the expression of ezrin which could be the target spot of inhibiting proliferation of colon cancer cells.

Annexin A2 (ANXA2), a calcium-dependent phospholipid binding protein, is widely distributed in eukaryotic cell membranes, the cytoplasm and extracellular media, accounting for up to 0.5–2.0% of total cell protein (41). It mainly participates in membrane transportation and in activities dependent on membrane calmodulin such as membrane fusion of exocytosis, vesicle trafficking, cell adhesion, proliferation, apoptosis, DNA replication, signal transduction and ion channel formation (42,43). Reports suggest that highly expressed ANXA2 in human colorectal cancer tissues/cells may be a diagnostic marker as well as a target for treatment and tumor prognosis (44). Here, ANXA2 in SW480 control cells were more highly expressed than cells treated with PE which inhibited proliferation and induced apoptosis and this likely occurred via regulation of the epidermal growth factor receptor signal transduction pathway with phosphorylation of tyrosin residues that signal through the Ras and PI3K pathways to control nuclear target gene expression (45). In addition, ANXA2 may regulate expression of several apoptosis-related proteins (such as caspase-3, p53, or Bc1-2; Figs. 5 and 6) to block apoptosis-related pathways (46). Given the essential role in intracellular information conduction, ANXA2 may be an essential therapeutic target for tumor therapy by inhibiting its expression or eliminating its influence on signaling pathway.

In conclusion, SW480 treated with PE underwent significant changes in expression of various proteins that may serve as related targets for PE-inhibition of tumors in vitro. HSP, NPM1, Ezrin and Annexin A2 expression were upregulated or downregulated by PE and had antitumor effects by influencing cell apoptosis, proliferation and energy metabolism. This is a novel theory for further study the mechanism of action at a protein level and verification and functional analysis of these proteins requires further study.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (nos. 30571009 and 81501808) the Natural Science Foundation of Zhejiang Province, China (Z307471 and LQ17H160015) and the Science and Technology Foundation of Zhejiang Province, China (2009C33040).

References

1 

Dunn K Bullard: Retrorectal tumors. Surg Clin North Am. 90:163–171. 2010.Table of Contents. doi: 10.1016/j.suc.2009.09.009. View Article : Google Scholar : PubMed/NCBI

2 

Seitz U, Bohnacker S, Seewald S, Thonke F, Brand B, Bräiutigam T and Soehendra N: Is endoscopic polypectomy an adequate therapy for malignant colorectal adenomas? Presentation of 114 patients and review of the literature. Dis Colon Rectum. 47:1789–1796; discussion 1796–1787. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Zhang GR: Determination of seven trace elements in Gracilaria Lemaneiformis by atomic absorption spectrometry. Chin J Spectrosc Lab. 24:1005–1008. 2007.

4 

Li BH, Xie SS and Lu ZK: Spectral properties of new photosensitizers for photodynamic diagnosis and therapy. Guang Pu Xue Yu Guang Pu Fen Xi. 22:902–904. 2002.(In Chinese). PubMed/NCBI

5 

Chen MZ, Du H and Xu BJ: Gracilaria phycoerythrin influence on H-22 tumor immune function in mice. Chin Tradit Herbal Drugs. 42:1329–1332. 2010.

6 

Gao SY, Wang J and Ji YB: Study on phycoerythrin induces MCF-7 apoptosis by controlling variation of ΔΨ_m. J Harbin University of Commerce. 28:8–13. 2012.

7 

He QY and Chiu JF: Proteomics in biomarker discovery and drug development. J Cell Biochem. 89:868–886. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Seliger B and Kellner R: Design of proteome-based studies in combination with serology for the identification of biomarkers and novel targets. Proteomics. 2:1641–1651. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Srinivas PR, Verma M, Zhao Y and Srivastava S: Proteomics for cancer biomarker discovery. Clin Chem. 48:1160–1169. 2002.PubMed/NCBI

10 

Alaiya AA, Franzén B, Hagman A, Silfverswärd C, Moberger B, Linder S and Auer G: Classification of human ovarian tumors using multivariate data analysis of polypeptide expression patterns. Int J Cancer. 86:731–736. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Utleg AG, Yi EC, Xie T, Shannon P, White JT, Goodlett DR, Hood L and Lin B: Proteomic analysis of human prostasomes. Prostate. 56:150–161. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Liu LN, Chen XL, Zhang XY, Zhang YZ and Zhou BC: One-step chromatography method for efficient separation and purification of R-phycoerythrin from Polysiphonia urceolata. J Biotechnol. 116:91–100. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Jaganathan SK, Supriyanto E and Mandal M: Events associated with apoptotic effect of p-Coumaric acid in HCT-15 colon cancer cells. World J Gastroenterol. 19:7726–7734. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Lu W, Yu P and Li J: Induction of apoptosis in human colon carcinoma COLO 205 cells by the recombinant α subunit of C-phycocyanin. Biotechnol Lett. 33:637–644. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Saini MK, Sanyal SN and Vaiphei K: Piroxicam and C-phycocyanin mediated apoptosis in 1,2-dimethylhydrazine dihydrochloride induced colon carcinogenesis: Exploring the mitochondrial pathway. Nutr Cancer. 64:409–418. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Görg A, Obermaier C, Boguth G, Harder A, Scheibe B, Wildgruber R and Weiss W: The current state of two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis. 21:1037–1053. 2000. View Article : Google Scholar : PubMed/NCBI

17 

Li C, Tan YX, Zhou H, Ding SJ, Li SJ, Ma DJ, Man XB, Hong Y, Zhang L, Li L, et al: Proteomic analysis of hepatitis B virus-associated hepatocellular carcinoma: Identification of potential tumor markers. Proteomics. 5:1125–1139. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Wang H, Yang Y, Chen W, Ding L, Li P, Zhao X, Wang X, Li A and Bao Q: Identification of differentially expressed proteins of Arthrospira (Spirulina) plantensis-YZ under salt-stress conditions by proteomics and qRT-PCR analysis. Proteome Sci. 11:62013. View Article : Google Scholar : PubMed/NCBI

19 

Bermejo R, Acién FG, Ibáñez MJ, Fernández JM, Molina E and Alvarez-Pez JM: Preparative purification of B-phycoerythrin from the microalga Porphyridium cruentum by expanded-bed adsorption chromatography. J Chromatogr B Analyt Technol Biomed Life Sci. 790:317–325. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Huang B, Wang GC and Li ZG: Antitumor studies of C-phycocyanin chromophore peptides mediated photodynamic therapy. Acta Laser Biology Sinica. 11:194–198. 2002.

21 

Morcos NC, Berns M and Henry WL: Phycocyanin: Laser activation, cytotoxic effects, and uptake in human atherosclerotic plaque. Lasers Surg Med. 8:10–17. 1988. View Article : Google Scholar : PubMed/NCBI

22 

Phillips D: Chemical mechanisms in phothodynamic therapywith Phthal ocyanines. Prog Reaction Kinet. 22:175–300. 1997.

23 

Xu BH: Study on the apoptosis induced by phycoerythrin through cell cycle in human breast cancer MCF-7. D Harbin University of Commerce. 33–34. 2010.

24 

Joo M, Chi JG and Lee H: Expressions of HSP70 and HSP27 in hepatocellular carcinoma. J Korean Med Sci. 20:829–834. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Suzuki T, Lu J, Zahed M, Kita K and Suzuki N: Reduction of GRP78 expression with siRNA activates unfolded protein response leading to apoptosis in HeLa cells. Arch Biochem Biophys. 468:1–14. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Rauschert N, Brändlein S, Holzinger E, Hensel F, Müller-Hermelink HK and Vollmers HP: A new tumor-specific variant of GRP78 as target for antibody-based therapy. Lab Invest. 88:375–386. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Dong D, Stapleton C, Luo B, Xiong S, Ye W, Zhang Y, Jhaveri N, Zhu G, Ye R, Liu Z, et al: A critical role for GRP78/BiP in the tumor microenvironment for neovascularization during tumor growth and metastasis. Cancer Res. 71:2848–2857. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Hua G, Zhang Q and Fan Z: Heat shock protein 75 (TRAP1) antagonizes reactive oxygen species generation and protects cells from granzyme M-mediated apoptosis. J Biol Chem. 282:20553–20560. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Xiang F, Huang YS, Shi XH and Zhang Q: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening. FEBS J. 277:1929–1938. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Chen JH and Hang W: Effects of HSP75 small interfering RNA on cell proliferation and migration in human osteosarcoma cell line U2-OS. J China Med Univ. 42:1145–1147. 2013.

31 

Chandra D, Choy G and Tang DG: Cytosolic accumulation of HSP60 during apoptosis with or without apparent mitochondrial release: Evidence that its pro-apoptotic or pro-survival functions involve differential interactions with caspase-3. J Biol Chem. 282:31289–31301. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Kim YS, Koh JM, Lee YS, Kim BJ, Lee SH, Lee KU and Kim GS: Increased circulating heat shock protein 60 induced by menopause, stimulates apoptosis of osteoblast-lineage cells via up-regulation of toll-like receptors. Bone. 45:68–76. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Grisendi S, Mecucci C, Falini B and Pandolfi PP: Nucleophosmin and cancer. Nat Rev Cancer. 6:493–505. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Chen D, Yoon JB and Gu W: Reactivating the ARF-p53 axis in AML cells by targeting ULF. Cell Cycle. 9:2946–2951. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Kurki S, Peltonen K, Latonen L, Kiviharju TM, Ojala PM, Meek D and Laiho M: Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell. 5:465–475. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Colombo E, Marine JC, Danovi D, Falini B and Pelicci PG: Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol. 4:529–533. 2002. View Article : Google Scholar : PubMed/NCBI

37 

Chen JH and Hang W: Effects of regulating NPM on the proliferative activity of human SCC A431 cells. Soochow University. 18–22. 2013.

38 

Jonstrup SP, Koch J and Kjems J: A microRNA detection system based on padlock probes and rolling circle amplification. RNA. 12:1747–1752. 2006. View Article : Google Scholar : PubMed/NCBI

39 

Fais S, De Milito A and Lozupone F: The role of FAS to ezrin association in FAS-mediated apoptosis. Apoptosis. 10:941–947. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Lozupone F, Lugini L, Matarrese P, Luciani F, Federici C, Iessi E, Margutti P, Stassi G, Malorni W and Fais S: Identification and relevance of the CD95-binding domain in the N-terminal region of ezrin. J Biol Chem. 279:9199–9207. 2004. View Article : Google Scholar : PubMed/NCBI

41 

Lokman NA, Ween MP, Oehler MK and Ricciardelli C: The role of annexin A2 in tumorigenesis and cancer progression. Cancer Microenviron. 4:199–208. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Fatimathas L and Moss SE: Annexins as disease modifiers. Histol Histopathol. 25:527–532. 2010.PubMed/NCBI

43 

Zhang X, Liu S, Guo C, Zong J and Sun MZ: The association of annexin A2 and cancers. Clin Transl Oncol. 14:634–640. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Duncan R, Carpenter B, Main LC, Telfer C and Murray GI: Characterisation and protein expression profiling of annexins in colorectal cancer. Br J Cancer. 98:426–433. 2008. View Article : Google Scholar : PubMed/NCBI

45 

Grewal T and Enrich C: Annexins - modulators of EGF receptor signalling and trafficking. Cell Signal. 21:847–858. 2009. View Article : Google Scholar : PubMed/NCBI

46 

Huang Y, Jin Y, Yan CH, Yu Y, Bai J, Chen F, Zhao YZ and Fu SB: Involvement of Annexin A2 in p53 induced apoptosis in lung cancer. Mol Cell Biochem. 309:117–123. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li P, Ying J, Chang Q, Zhu W, Yang G, Xu T, Yi H, Pan R, Zhang E, Zeng X, Zeng X, et al: Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells. Oncol Rep 36: 3536-3544, 2016.
APA
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T. ... Li, S. (2016). Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells. Oncology Reports, 36, 3536-3544. https://doi.org/10.3892/or.2016.5162
MLA
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T., Yi, H., Pan, R., Zhang, E., Zeng, X., Yan, C., Bao, Q., Li, S."Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells". Oncology Reports 36.6 (2016): 3536-3544.
Chicago
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T., Yi, H., Pan, R., Zhang, E., Zeng, X., Yan, C., Bao, Q., Li, S."Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells". Oncology Reports 36, no. 6 (2016): 3536-3544. https://doi.org/10.3892/or.2016.5162
Copy and paste a formatted citation
x
Spandidos Publications style
Li P, Ying J, Chang Q, Zhu W, Yang G, Xu T, Yi H, Pan R, Zhang E, Zeng X, Zeng X, et al: Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells. Oncol Rep 36: 3536-3544, 2016.
APA
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T. ... Li, S. (2016). Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells. Oncology Reports, 36, 3536-3544. https://doi.org/10.3892/or.2016.5162
MLA
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T., Yi, H., Pan, R., Zhang, E., Zeng, X., Yan, C., Bao, Q., Li, S."Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells". Oncology Reports 36.6 (2016): 3536-3544.
Chicago
Li, P., Ying, J., Chang, Q., Zhu, W., Yang, G., Xu, T., Yi, H., Pan, R., Zhang, E., Zeng, X., Yan, C., Bao, Q., Li, S."Effects of phycoerythrin from Gracilaria lemaneiformis in proliferation and apoptosis of SW480 cells". Oncology Reports 36, no. 6 (2016): 3536-3544. https://doi.org/10.3892/or.2016.5162
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team