International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Colon cancer is one of the most common tumors with high cancer-related mortality rate, and millions of new cases yearly diagnosed in the world (1). Colorectal tumor environment mainly comprised endothelial, mesenchymal and immune cells. Abundant evidence indicated that immune cells played a key role in the recognition and abolishing cancer cells. The concept of cancer immune-surveillance has been supported by research showing that immune-deficiencies facilitate easy development of a neoplasm, further studies by animal models with inhibition of specific genes coding for the immune response resulted in a higher susceptibility to develop spontaneous or chemically-induced cancers (2,3). Previous studies showed that the infiltration of TAMs in colorectal cancer predicted a good prognosis (4–8). TAMs have been shown to be highly plastic cells that can display both tumor preventing (M1 macrophages) and tumor promoting functions (M2 macrophages) (9,10). Further studied on the distribution of M1 and M2 macrophage phenotypes in colorectal cancers showed that patients who had high numbers of infiltrating M1 macrophages obtained a significantly better prognosis (11). M1 macrophages stimulated cell-mediated responses via secreting pro-inflammatory cytokines such as IL-1, IL-6, IL-12, IL-23 and TNF-α. Furthermore, the M1 macrophages served as a critical cellular component involved in the inflammatory response and antitumor function (12). Conversely, the M2 macrophages exerted anti-inflammatory and pro-tumorigenic activities through the production of anti-inflammatory cytokines (IL-10 and TGF-β) and high levels of decoys that antagonized IL-1, such as IL1RII and IL-1 receptor antagonist (10,13).
Phospholipase D4 is a member of the family of phospholipid enzymes and mainly expressed in early mouse microglia. But unlike PLD1 and PLD2, PLD4 exhibited no enzymatic activity for transforming phosphatidylcholine into choline and phosphatidic acid (14). After treated with LPS, the expression of the PLD4 in microglia was increased which could promote the function of phagocytosis (15). Recent studies have indicated mutation in PLD4 gene was associated with two autoimmune diseases, named systemic sclerosis (16) and rheumatoid arthritis (17), both had abnormal inflammatory skin lesions symptoms (18). Although PLD4 was involved in microglia phagocytosis, there is little known on its function and the mechanism, thus PLD4 needed to be explored.
In the present study, we analyzed the distribution of PLD4 in colorectal cancer of different grades, clinical and pathological. Notably, the positive rate of PLD4 was associated with clinical staging of colon cancer. We observed that the expression of PLD4 was located in cancer tissue mesenchyme and lymph nodes. Combined with the previous study that PLD4 existed in microglia and promoted the phagocytosis of microglia after LPS stimulation, we hypothesized that TAMs were candidates. Then, the expression of PLD4 in TAMs was examined by using THP-1 as a model of macrophages. Our results demonstrated that the expression of PLD4 was closely associated with M1-type macrophages, and inhibition of its expression in M1 macrophages by siRNA led to a significant decrease in the secretion of pro-inflammatory cytokines IL-1, IL-6 and TNF-α. Either condition medium from PLD4 siRNA-treated M1 or control-M1 cells was co-cultured with colon cancer cells. We observed significant changes in proliferation, cell cycle and apoptosis in colon cells suggesting that this protein was involved in activation of M1 cells in vitro, and promoted an inhibition effect in colon cancer.
The THP-1, HCT116, HT29 and SW620 cell lines were cultured in 5% CO2 at 37°C in RPMI-1640 supplemented with 10% fetal bovine serum (FBS). The cell lines were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).
THP-1 cells were seeded in 6-well plates (5×105 cells/well). For preparation of M1-polarized THP-1 macrophages, 50 ng/ml phorbol myristate acetate (PMA; Sigma-Aldrich, St. Louis, MO, USA) was added to THP-1 cells for 48 h, followed by 20 ng/ml interferon-γ (IFN-γ; Peprotech, Rocky Hill, NJ, USA) and 100 ng/ml lipopolysaccharide (LPS; Sigma-Aldrich) for the following 40 h. For preparation of M2-polarized THP-1 macrophages, 50 ng/ml PMA was added to THP-1 cells for 48 h, followed by 20 ng/ml interleukin-4 (IL-4; Peprotech) for the following 40 h. The M1 cells were transfected by 20 nM siRNA against PLD4 or control siRNA (Invitrogen, Carlsbad, CA, USA) for 24 h with the PrimaPort siRNA transfection reagent (Invitrogen). Cell supernatants of macrophages under different conditions were collected for further research.
M1 type macrophage cell markers were analyzed in flow cytometry (BD FACSCalibur flow cytometer) by using phycoerythrin (PE)-conjugated monoclonal antibody against CD86 (eBioscience) allophycocyanin (APC)-CD16 (eBioscience). Matched isotope controls were included in all experiments. Data were analyzed with the CellQuest Pro software (Tree Star, Inc., Ashland, OR, USA) after gating the macrophages population in the FSC/SSC window.
The continuous paraffin sections (5 µm) were boiled in citrate buffer (pH 6.0) for 10 min in a microwave oven for heat-induced antigen retrieval. The sections were incubated for 1 h in 0.01 M phosphate-buffered saline (PBS) that contained 10% goat serum (PBS-TGS), then overnight at 4°C with primary antibodies (PLD4: LifeSpan BioScience, Inc., Seattle, WA, USA; CD68: ZSGB-BIO, Beijing, China) diluted in PBS-TGS. Continuous paraffin sections from one carcinoma lymph node were used to immunostain primary antibodies PLD4 and CD68 in order to analysis the distribution of the PLD4. After washing with PBS three times, the sections were incubated with biotinylated secondary antibodies for 2 h at room temperature (RT). They were incubated with the ABC reagent (1:50; ZSGB-BIO) for 30 min at RT, and immunoreactions were visualized using DAB kit (ZSGB-BIO) 10 min at RT. Images were captured by light microscopy.
Primary colon carcinoma tissues and their matched adjacent normal intestinal tissues were obtained from 12 colon cancer patients who underwent gastrointestinal cancer resection without preoperative treatment at the Department of Chengdu Military General Hospital and the First Affiliated Hospital of Chengdu Medical College. Signed informed consents were obtained from all patients. The study was approved by the Medical Ethics Committee of Chengdu Medical College.
Cells were scraped and centrifuged at 400 × g for 5 min. The cell pellets were washed twice with ice-cold PBS and resuspended in ice-cold RIPA buffer [50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1 mM Na3VO4, 1 mM NaF] supplemented with protease inhibitors. The protein content of the lysates was measured by the BCA protein assay kit. We loaded 45 µg of proteins on SDS-PAGE and the separated proteins were transferred onto PVDF membranes. Blots were blocked for 2 h at room temperature in TBS containing 0.1% Tween-20 (TBS-T), 5% non-fat dry milk. After blocking, the membranes were probed overnight at 4°C with the primary antibody diluted in TBS-T containing 5% non-fat dry milk. The membranes were washed four times for 20 min with TBS-T and probed with horseradish peroxidase-conjugated secondary antibody (mouse anti-, rabbit anti-; ZSGB-BIO) used at a 1:10,000 dilutions in TBS-T for 1 h. After four washes for 20 min in TBS-T, the membranes were developed using chemiluminescent substrate and exposed to BD ECL Hyperfilm. The following primary antibodies were used in this study: rabbit anti-PLD4 antibody (LifeSpan BioScience; dilution of 1:500), and mouse anti-β-GAPDH (ZSGB-BIO; dilution of 1:1,000).
To determine the macrophage activation levels among the different induced conditions in vitro, the amount of IL-1, IL-8, IL-6, tumor necrosis factor-α (TNF-α) in the culture medium was measured by human instant ELISA kit (Elabscience Biotechnology, Co., Ltd., Wuhan, China), according to the manufacturers instructions.
Total RNA was extracted from M1 cells grown in 6-well culture plates (5×105 cells/well) by TRIzol Plus RNA purification kit (Invitrogen). Isolated total RNA was then reverse transcribed with Takara RNA LA PCR™ kit (AMV; Promega, Madison, WI, USA) ver.1.1. To detect the expression of PLD4, stem-loop reverse transcription PCR (RT-PCR) was performed using a qRT-PCR detection kit (Takara Bio, Shiga, Japan) according to the manufacturers instructions. PLD4 and control glyceraldehyde-3-phoshate dehydrogenase (GAPDH) cDNAs (for RT-PCR) and β-actin (for qRT-PCR) were amplified by the following specific primer sets. PLD4-R, CAGGGAAATGTTCCTGCCCA and PLD4-F, CGTCCACGTGGCTTCATACT; GAPDH-R, CCCCACTTG ATTTTGGAGGGA and GAPDH-F, AGGGCTGCTTTTAA CTCTGGT; β-actin-R, GCCCACATAGGAATCCTTCTGAC and β-actin-F, AGGCACCAGGGCGTGAT.
The commercially available double-stranded siRNA oligonucleotide against PLD4 gene was purchased from Invitrogen. The M1 cells were transfected by 20 nM siRNA against PLD4 or control siRNA (Invitrogen) for 24 h with the PrimaPort siRNA transfection reagent (Invitrogen), according to the manufacturers protocol. The efficiency of siRNA to knock down the PLD4 was determined by western blot analysis and qRT-PCR.
HT-29, HCT116 and SW620 colon cells were plated at 104 cells/well in a 96-well plate that contained 100 µl RPMI-1640 supplement with 10% FBS for 24 h (19). Then, the culture medium was replaced by PLD4-siRNA (20 nM) group, control-group cell supernatant of M1 macrophages for another 24 h. For cell proliferation assay, the cells were quantified using a Cell Counting kit-8 (CCK-8; Nanjing KeyGen Biotech, Co., Ltd., Nanjing, China). After 0.5, 1, 2 and 4 h of incubation with the reagent, each time-point absorbance at 450 nm was determined using a microplate reader. The measured absorbance at 0 h after adding supernatant was used as a standard value. For the cell cycle assay, cells were fixed at 4°C overnight with 70% ice-cold ethanol, washed again with PBS and incubated with 100 µl RNaseA (Nanjing KeyGen Biotech) at 37°C for 30 min. Staining was with 400 µl propidium iodide (Nanjing KeyGen Biotech) for 15 min at 4°C. The DNA content of cells was analyzed with a FACSCalibur flow cytometer (BD Biosciences) using the CellQuest software. Treated cells were harvested, washed with phosphate-buffered saline (PBS) and then centrifuged at 400 × g for 4 min. The cell pellets were then suspended in 400 µl of Annexin V-FITC/PI apoptosis detection kit (Nanjing KeyGen Biotech) at room temperature for 15 min in the dark. Annexin V-FITC binding was analyzed by flow cytometry (Ex=488 nm; Em=530 nm) FL1 channel for detecting Annexin V-FITC staining and FL3 channel for detecting PI staining. Annexin V-positive, PI-negative cells were scored as early apoptotic, and double-stained cells were considered as late apoptotic.
The data were presented as the mean ± SE. Students t-test (two-tailed) or a one-way analysis of variance was employed to analyze the in vitro and in vivo data. Chi-square test was used to analyze the relationship between the PLD4 expression and the clinical or pathological factors.
Immunohistochemical analysis revealed that the main expression of PLD4 was located in the colon cancer mesenchymal and lymph nodes compared with normal tissues. In addition, immunohistochemistry showed strong PLD4 signals in the cytoplasm consistent with the results of previous studies (Fig. 1). Notably, PLD4 expression was associated with clinical staging of colon cancer, not pathological stage (Table I). Moreover, we observed that the earlier the clinical stage, the higher positive rate of PLD4 (0.71 vs. 0.17). At the same time, we observed the relation between CD68-positive macrophages and PLD4-positive cells in continuous paraffin sections from a carcinoma lymph node, and concluded that PLD4 could exist partly in macrophages in colon cancers (Fig. 2). Then we confirmed the expression of the PLD4 in 12 human surgical specimens by western blot analysis (tumor tissues obtained without any chemotherapy). Though colon carcinoma tissues and their matched adjacent normal intestinal epithelia both exhibited the expression of PLD4 band at 48 kDa (Fig. 3A), we found that the tissues of tumor showed higher expression of PLD4 compared with normal (Fig. 3B). The PLD4 may be related to the tumor prognosis. These results suggested that phospholipase D4 was present in differential macrophages in colon cancer.
Table I.The Chi-square test results indicating that the expression of the PLD4 is related to the clinical stage (P<0.05). |
The above results suggested phospholipase D4 was presented in differential macrophages in colon cancers. Combined with the previous study that PLD4 existed in microglia and could enhance microglia phagocytosis after LPS stimulated, we hypothesized that M1 type TAMs were candidates in PLD4. In order to examine the expression of PLD4-positive cells, using THP-1 cells induced into tumor-associated macrophages as described (Fig. 4A). By flow cytometric analysis, the M1 macrophages showed higher levels of MHCII cell marker CD86 and CD16 compared to macrophages (20) (Fig. 4B). The expression of IL-1, IL-6, IL-8 and TNF-α among macrophages, M1 and M2 cells was detected by ELISA (Fig. 4C). The expression of PLD4 in TAMs was confirmed by western blot analysis and RT-PCR (Fig. 4D and E). Western blot analysis of LPS plus IFN-γ induced M1 and IL-4 induced M2 cell homogenates exhibited mainly M1 cells existed in PLD4-related bands of 48 kDa (Fig. 4D), and the expression of PLD4 mRNA in M1 cells was confirmed by RT-PCR at bands of 300 bp (Fig. 4E). The result showed all pro-inflammation factors in M1 cells were upregulated compared the other macrophages. M1 tumor-associated macrophages expressed PLD4.
After M1 macrophages were seeded in 6-well plates with siRNA (20 nM) or vehicle for 24 h, decreased expression of PLD4 was confirmed by western blot analysis and qRT-PCR. A marked decrease in PLD4 bands was found in siRNA-treated cells compared with control (Fig. 5A). The relative PLD4 mRNA level both in PLD4-siRNA-treated cells and NG-siRNA treatment for 24 h was detected by qRT-PCR (Fig. 5B). A decrease of PLD4 mRNA in PLD4-siRNA-treated cells compared with control. At the same time, the cell pro-inflammation factor levels of TNF-α, IL-1 and IL-6 in the culture medium were detected by ELISA. The siRNA interference showed temporarily reduced release of IL-1, IL-6 and TNF-α in M1 cells (Fig. 5C). These results indicated that immunoreactivity of the M1 cells were inhibited.
We co-cultured HT-29, HCT116, SW620 colon cancer cells with the condition medium (CM) from siRNA-interfered and untreated M1 cells for 24 h. Marked changes in tumor proliferation were observed by CCK-8 kit when HT-29, HCT116 and SW620 cells were co-cultured with two types of M1 cells and controls for 24 h (Fig. 6A). Using the well-described Annexin V binding assay coupled to a flow cytometric analysis allowed the distinction to be made between early (Annexin V-positive/PI-negative cells) and late (Annexin V-positive/PI-positive cells) apoptosis to determine when cell death occurred. An obvious increase in the number of apoptotic cells was noted in M1 group cells compared with control and PLD4-siRNA group (Fig. 6B and C). At the same time, we examined the cell cycle phase changes in three types of colon cancer cells after culturing with different types of macrophages for 24 h. The CM from M1 induced accumulation of S-phase cells in HT-29 (P<0.05), but in PLD4-siRNA treatment and control groups, there were no significant changes observed, compared with PLD4-siRNA and control groups, the percentage of G0/G1 cells in SW-620 were increased visibly (P<0.05) (Fig. 6D). However, no significant change was observed in HCT116 from each group (Fig. 6D). The three tumor cell types cultured with the inhibition of PLD4 in M1 cells showed more proliferation, shorter cell cycle and less apoptosis compared to the normal actived M1 macrophages.
In colon cancer specimens, Forssell et al (5) suggested that TAMs prevented tumor development because patients with a high infiltration of TAMs had a better prognosis and survival rate. De-Nardo et al (21) noted that the leukocyte composition of established tumors, in which immunosuppressive M2-like TAMs likely predominated over M1 macrophages. Prada et al (22) and Wang et al (23) suggested that incipient tumors, which may be more immunogenic than established lesions, contained higher proportions of M1-like TAMs, which could initiate adaptive immune responses. In the present study, we analyzed the expression of PLD4 in 109 colon cancer specimens during different clinical and pathological grades by IHC. PLD4 mainly expressed in cytoplasmic region based on the immunohistochemical analysis. In addition, the results from Table I suggested that the earlier the clinical stage, the higher positive rate of PLD4. Western blot analysis in 12 human surgical tissues without any chemotherapy at early clinical stage, confirmed a surprise outcome that all of the detected samples expressed PLD4, but the tissues of tumor showed higher expression of PLD4 compared with normal. A study by Steidl et al (24) showed that tumor-associated macrophages could affect the prognosis of lymphoma in patients. Thus, we selected continuous paraffin sections from a carcinoma lymph node to analysis the relation between CD68-positive macrophages and PLD4-positive cells and showed that PLD4 existed partly in macrophages in colon cancers by immunohistochemistry (Fig. 2). The AJCC 2009 statistics showed that only in relatively early stages can surgical resection be conducted on patients with colon cancer (25). Moreover, we found that HCT116 and HT29 colon cancer cells did not express PLD4 (data not shown). Thus, we considered that the expression of PLD4 could be associated with the patient prognosis and existed in macrophages, but not in tumor cells. Since previous studies showed that PLD4 was present in microglia cells after treatment with LPS, it was attractively to speculate that M1 polarization TAMs in colon cancer may express PLD4, because the M1 macrophages were induced by LPS plus IFN-γ. Macrophages were a key component of the tumor-infiltrating immune cells and they could considerably affect tumor progression (21,26–28).
Considering these findings, in vitro, we induced THP-1 cells differentiated into M1 macrophages by adding phorbol myristate acetate (PMA) to THP-1 cells for 48 h, subsequently adding IFN-γ and LPS for the following 48 h. In addition, M1 cells were characterized by the expression of CD86, CD16 through flow cytometric analysis. The production of pro-inflammatory factors IL-1, IL-6, IL-8 and TNF-α were detected by ELISA. In M1 macrophages, a higher production of IL-1, IL-6, IL-8, TNF-α which exerted a function of antitumor effect (9,12) compared with other types of macrophages was observed. Based on these results, we suggested that the M1 macrophages were active and played an important role in antitumor progress. Subsequently, cells were harvested for western blot analysis and RT-PCR analysis. Western blot analysis (45 µg proteins, 10% SDS-PAGE) using PLD4 antibody revealed that PLD4-positive bands were located in the 48 kDa. The expression of PLD4 mRNA was confirmed by RT-PCR. Thus, PLD4 existed in M1 macrophages originated from THP-1 cells.
Furthermore, phospholipase D4 is a member of the family of phospholipid enzymes (14), and is mainly expressed in spleen and early microglia (15). Recent studies showed two autoimmune diseases, sclerosis and rheumatoid arthritis, were related to PLD4 mutation (16,17). Although PLD4 seemed to have some immunological functions, little was known about its function in cells. PLD4 might be transported extracellularly into the nucleus. We used siRNA interference to show partial inhibition of the PLD4, and showed a significant decrease in IL-1, IL-6 and TNF-α levels. It is known that the function of macrophages largely depends on the level of cytokine. When high levels of Th1 cytokines, such as tumor necrosis factor (TNF), IL-1 and interferon (IFNs) were present, the pro-inflammatory M1 macrophages could be established and had an antitumor effect (29). PLD4 might play an important role in regulating activation of M1 macrophages at least in stimulating macrophages increasing the release of pro-inflammatory cytokines.
To the best of our knowledge, activated M1 macrophages exerted an important role in antitumor effects. Then, we co-cultured HCT116, SW620 and HT29 colon cells with cell supernatant of M1 and si-PLD4 M1 macrophages for 24 h. We found that colon cancer cells showed reduced proliferation, marked increased of apoptosis and cell cycle in M1 macrophages compared with si-PLD4 M1 cells. These results demonstrated that THP-1-differentiated M1 macrophages induced by LPS could release a high level of TNF-α, IL-1, IL-6, and all were secreted into cell supernatant leading to death occurring in colon adenocarcinoma cells. Thus, PLD4 could possess a function to send signals in activation process of the M1 macrophages.
The nuclear factor-κB (NF-κB) and the signaling transducer and activator of transcription (STAT) pathways are known to play pivotal roles in the transcriptional profile of macrophages. Among the transcriptional factors, STAT1 and canonical NF-κB (p50/p65 heterodimer) were essential for the M1 tumoricidal functions and triggered the expression of pro-inflammatory cytokines (30). LPS is a well-known activator of the NF-κB pathway and was important in the establishment of the M1 phenotype of macrophages. The detoxified derivative of LPS had also shown promise as an adjuvant of anticancer vaccines. A number of 79 clinical trials of this drug are ongoing (31). M1-type macrophages are capable of inducing lysis in various types of cancer cells, but the mechanism of action need further exploration. It has been previously identified that more unknown proteins together with protease which could activate macrophages might be responsible for this action (32). PLD4 possibly belonged to these ‘an unknown protein’ and used unknown pathways to activate the macrophages. The manner of PLD4 impacted on macrophage activation still needed further study.
To conclude, the role of TAMs in tumor environment was complex since their behavior was modulated by the tumor microenvironment and various factors were involved in cross-talk that exist between TAMs and cancer cells. Indeed activated macrophages would be crucial to determine the prognosis in colon cancer. This study emphasized that PLD4 was involved in this signal network. Our findings highlighted a new pattern of tumor-associated macrophage activation in which PLD4 could play an important role in activation signal delivery. PLD4 existing in the M1 type polarization may be useful in understanding the reason high TAM density is associated with a good prognosis in colon cancer.
|
Jemal A, Center MM, DeSantis C and Ward EM: Global patterns of cancer incidence and mortality rates and trends. Cancer Epidemiol Biomarkers Prev. 19:1893–1907. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Dunn GP, Old LJ and Schreiber RD: The immunobiology of cancer immunosurveillance and immunoediting. Immunity. 21:137–148. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Smyth MJ, Dunn GP and Schreiber RD: Cancer immunosurveillance and immunoediting: The roles of immunity in suppressing tumor development and shaping tumor immunogenicity. Adv Immunol. 90:1–50. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Algars A, Irjala H, Vaittinen S, Huhtinen H, Sundström J, Salmi M, Ristamäki R and Jalkanen S: Type and location of tumor-infiltrating macrophages and lymphatic vessels predict survival of colorectal cancer patients. Int J Cancer. 131:864–873. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Forssell J, Oberg A, Henriksson ML, Stenling R, Jung A and Palmqvist R: High macrophage infiltration along the tumor front correlates with improved survival in colon cancer. Clin Cancer Res. 13:1472–1479. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Lackner C, Jukic Z, Tsybrovskyy O, Jatzko G, Wette V, Hoefler G, Klimpfinger M, Denk H and Zatloukal K: Prognostic relevance of tumour-associated macrophages and von Willebrand factor-positive microvessels in colorectal cancer. Virchows Arch. 445:160–167. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Nagorsen D, Voigt S, Berg E, Stein H, Thiel E and Loddenkemper C: Tumor-infiltrating macrophages and dendritic cells in human colorectal cancer: Relation to local regulatory T cells, systemic T-cell response against tumor-associated antigens and survival. J Transl Med. 5:622007. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou Q, Peng RQ, Wu XJ, Xia Q, Hou JH, Ding Y, Zhou QM, Zhang X, Pang ZZ, Wan DS, et al: The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer. J Transl Med. 8:132010. View Article : Google Scholar : PubMed/NCBI | |
|
Biswas SK and Mantovani A: Macrophage plasticity and interaction with lymphocyte subsets: Cancer as a paradigm. Nat Immunol. 11:889–896. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A and Locati M: The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25:677–686. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Edin S, Wikberg ML, Dahlin AM, Rutegård J, Öberg Å, Oldenborg PA and Palmqvist R: The distribution of macrophages with a M1 or M2 phenotype in relation to prognosis and the molecular characteristics of colorectal cancer. PLoS One. 7:e470452012. View Article : Google Scholar : PubMed/NCBI | |
|
Chanmee T, Ontong P, Konno K and Itano N: Tumor-associated macrophages as major players in the tumor microenvironment. Cancers (Basel). 6:1670–1690. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Allavena P, Sica A, Solinas G, Porta C and Mantovani A: The inflammatory micro-environment in tumor progression: The role of tumor-associated macrophages. Crit Rev Oncol Hematol. 66:1–9. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Yoshikawa F, Banno Y, Otani Y, Yamaguchi Y, Nagakura-Takagi Y, Morita N, Sato Y, Saruta C, Nishibe H, Sadakata T, et al: Phospholipase D family member 4, a transmembrane glycoprotein with no phospholipase D activity, expression in spleen and early postnatal microglia. PLoS One. 5:e139322010. View Article : Google Scholar : PubMed/NCBI | |
|
Otani Y, Yamaguchi Y, Sato Y, Furuichi T, Ikenaka K, Kitani H and Baba H: PLD4 is involved in phagocytosis of microglia: Expression and localization changes of PLD4 are correlated with activation state of microglia. PLoS One. 6:e275442011. View Article : Google Scholar : PubMed/NCBI | |
|
Terao C, Ohmura K, Kawaguchi Y, Nishimoto T, Kawasaki A, Takehara K, Furukawa H, Kochi Y, Ota Y, Ikari K, et al: PLD4 as a novel susceptibility gene for systemic sclerosis in a Japanese population. Arthritis Rheum. 65:472–480. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Okada Y, Terao C, Ikari K, Kochi Y, Ohmura K, Suzuki A, Kawaguchi T, Stahl EA, Kurreeman FAS, Nishida N, et al: Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. Nat Genet. 44:511–516. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Krieg T and Takehara K: Skin disease: A cardinal feature of systemic sclerosis. Rheumatology (Oxford). 48:(Suppl 3). iii14–iii18. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Sugihara H, Ishimoto T, Watanabe M, Sawayama H, Iwatsuki M, Baba Y, Komohara Y, Takeya M and Baba H: Identification of miR-30e* regulation of Bmi1 expression mediated by tumor-associated macrophages in gastrointestinal cancer. PLoS One. 8:e818392013. View Article : Google Scholar : PubMed/NCBI | |
|
De Palma M and Lewis CE: Macrophage regulation of tumor responses to anticancer therapies. Cancer Cell. 23:277–286. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
DeNardo DG, Brennan DJ, Rexhepaj E, Ruffell B, Shiao SL, Madden SF, Gallagher WM, Wadhwani N, Keil SD, Junaid SA, et al: Leukocyte complexity predicts breast cancer survival and functionally regulates response to chemotherapy. Cancer Discov. 1:54–67. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Prada CE, Jousma E, Rizvi TA, Wu J, Dunn RS, Mayes DA, Cancelas JA, Dombi E, Kim MO, West BL, et al: Neurofibroma-associated macrophages play roles in tumor growth and response to pharmacological inhibition. Acta Neuropathol. 125:159–168. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Wang B, Li Q, Qin L, Zhao S, Wang J and Chen X: Transition of tumor-associated macrophages from MHC class II(hi) to MHC class II(low) mediates tumor progression in mice. BMC Immunol. 12:432011. View Article : Google Scholar : PubMed/NCBI | |
|
Steidl C, Lee T, Shah SP, Farinha P, Han G, Nayar T, Delaney A, Jones SJ, Iqbal J, Weisenburger DD, et al: Tumor-associated macrophages and survival in classic Hodgkins Lymphoma. N Engl J Med. 362:875–885. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Hari DM, Leung AM, Lee JH, Sim MS, Vuong B, Chiu CG and Bilchik AJ: AJCC Cancer Staging Manual 7th edition criteria for colon cancer: do the complex modifications improve prognostic assessment? J Am Coll Surg. 217:181–190. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Mantovani A, Biswas SK, Galdiero MR, Sica A and Locati M: Macrophage plasticity and polarization in tissue repair and remodelling. J Pathol. 229:176–185. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Nucera S, Biziato D and De Palma M: The interplay between macrophages and angiogenesis in development, tissue injury and regeneration. Int J Dev Biol. 55:495–503. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Pollard JW: Trophic macrophages in development and disease. Nat Rev Immunol. 9:259–270. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Tang X, Mo C, Wang Y, Wei D and Xiao H: Anti-tumour strategies aiming to target tumour-associated macrophages. Immunology. 138:93–104. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Sica A and Bronte V: Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest. 117:1155–1166. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Shime H, Matsumoto M, Oshiumi H, Tanaka S, Nakane A, Iwakura Y, Tahara H, Inoue N and Seya T: Toll-like receptor 3 signaling converts tumor-supporting myeloid cells to tumoricidal effectors. Proc Natl Acad Sci USA. 109:2066–2071. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Pan XQ: The mechanism of the anticancer function of M1 macrophages and their use in the clinic. Chin J Cancer. 31:557–563. 2012.PubMed/NCBI |