Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April-2017 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing

  • Authors:
    • Qiaozhen Yang
    • Bin Guo
    • Hongying Sun
    • Jie Zhang
    • Shangfeng Liu
    • Saiyin Hexige
    • Xuedi Yu
    • Xiaxia Wang
  • View Affiliations / Copyright

    Affiliations: Department of Stomatology, Huashan Hospital, Fudan University, Shanghai 200040, P.R. China, State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, P.R. China
  • Pages: 2355-2365
    |
    Published online on: March 2, 2017
       https://doi.org/10.3892/or.2017.5487
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Oral lichen planus (OLP) is a chronic inflammatory disease that may transform to oral squamous cell carcinoma (OSCC), while its carcinogenesis mechanisms are not entirely clear. This study was designed to identify the important genes involved in the malignant transformation of OLP to OSCC. After RNA-sequencing, the differently expressed genes (DEGs) in OLP vs. normal and OSCC vs. normal groups, respectively, were identified by limma package in R language, and then clustering analysis were conducted by Pheatmap package in R language. Weighed gene co-expression network analysis (WGCNA) was performed for the DEGs to screen disease-associated modules. Using Cytoscape software, co-expression networks were constructed for the genes involved in the modules. Enrichment analysis was conducted for the genes involved in the co-expression networks using GOstat package in R language. Finally, quantitative real-time PCR (qRT-PCR) experiments were conducted to validate the key genes. There were, respectively, 223 and 548 DEGs in OLP vs. normal and OSCC vs. normal groups. WGCNA identified the blue modules for the DEGs in the two groups as disease-associated modules. Moreover, 19 common DEGs (including upregulated BCL9L, PER2 and TSPAN33, and downregulated GMPS and HES1) associated with both OLP and OSCC were identified. In the co-expression networks, BCL9L, HES1, PER2 and TSPAN33 might function in OLP via interactions (such as BCL9L-TSPAN33 and HES1-PER2). qRT-PCR analysis showed that BCL9L, PER2 and TSPAN33 were significantly upregulated, and GMP and HES1 were downregulated. These findings indicated that BCL9L, GMPS, HES1, PER2 and TSPAN33 affected the transformation of OLP to OSCC.

Introduction

Oral lichen planus (OLP) is a common chronic inflammatory disease of the oral mucosa, which is classified into oral potential malignant disorders (OPMDs) by World Health Organization (WHO) (1). OPMD is the general name of diseases occurring in oral mucosa and with cancerous potential (2). The incidence of OLP is 0.1–4% (3), and its canceration rate is close to 1% (4). The carcinogenesis mechanisms of OLP have been explored by many studies, but it is still not clear. Oral squamous cell carcinoma (OSCC) occurs in the mucosa of the oropharynx and oral cavity (5). In the United States, OSCC ranks 14th among cancers in women and 8th among cancers in men (6). OSCC is reported to take up >90% of all oral cancers (7), and its incidence is increasing especially among white women (8). Previous studies report that OLP may transform to OSCC, though the incidence is low and the carcinogenesis mechanisms are not known (9,10). Thus, investigating the mechanisms of malignant transformation of OLP to OSCC is important for further decreasing the incidence.

In recent years, malignant transformation of OLP has been widely studied. The matrix metalloproteinase-tissue inhibitor of matrix metalloproteinase (MMP-TIMP) imbalance may affect cancerization of OLP, additionally, MMP-9, MMP-2, and membrane-type 1 MMP (MT1-MMP) may serve as promising prognostic markers for malignant transformation of OLP (11,12). The expression levels of ATP-binding cassette, G2 subfamily (ABCG2) and podoplanin are significantly related to malignant potential of OLP, suggesting that ABCG2 and podoplanin may be used for assessing the risk of malignant transformation in OLP patients (13). Rhodus et al demonstrated that the abnormal expression levels of nuclear factor κB (NF-κB)-dependent cytokines (such as interleukin-1α, IL-1α; and tumor necrosis factor-α, TNF-α) in general, unstimulated saliva may reflect the malignant potential of OLP (14,15). Overexpression of cyclin-dependent kinase 4 (cdk4) and p16 indicate the cell arrest and hyperproliferative state of epithelial cells in OLP, and offer evidence for the malignant transformation risk of OLP (16). However, the malignant transformation of OLP has not been comprehensively investigated.

RNA-sequencing is a powerful tool for expression profiling, genome annotation, and transcript discovery, which has been widely utilized in biology fields involving development, gene regulation and disease (17). In this study, the high-throughput sequencing data of OLP, OSCC and normal oral mucosa were obtained by RNA-sequencing technique. Followed by the differently expressed genes (DEGs) in OLP vs. normal and OSCC vs. normal comparison groups were identified. Subsequently, weighted gene co-expression network analysis (WGCNA) was conducted for the DEGs to screen disease-associated modules. Moreover, co-expression networks were constructed for the genes involved in the disease-associated modules. In addition, functional enrichment analysis was conducted for the genes involved in the co-expression networks. Finally, the identified key genes were further confirmed.

Materials and methods

Sample source

A total of 3 OLP samples, 3 OSCC samples, and 3 normal samples were isolated from buccal mucosa of patients from Huashan Hospital. The isolated samples were washed by phosphate buffer and then stored at −80°C for following experiments. The patients had not received immune stimulants (including corticosteroids) within 3 months, and were without systemic diseases such as diabetes and immunodeficiency. Based on the diagnostic criteria of World Trade Organization (WTO), the patients were diagnosed by tissue biopsy. All patients gave their informed consent, and this study was approved by the ethics review committee of Huashan Hospital of Fudan University.

RNA extraction and library construction

Total RNA of the samples were extracted by the TRIzol total RNA extraction kit (Invitrogen, Shanghai, China) according to the manufacturer's manual. Subsequently, the integrity and purity of RNA were detected by 2% Agarose Gel Electrophoresis and spectrophotometer (Merinton, Beijing, China), respectively. The cDNA library was prepared using NEBNext® Ultra™ RNA Library Prep kit for Illumina® (New England Biolabs, Ipswich, MA, USA). Firstly, the isolated mRNAs were fractured into short fragments (~200 nt) through heating. Secondly, the first- and second-strand of cDNA were synthesized and then modified. Followed by PCR amplification. The cDNA library was sequenced on Illumina Hiseq 2500 v4 100PE (Illumina Inc., San Diego, CA, USA) to obtained the raw data.

Sequence alignment and DEG screening

Reads with adaptor sequences, and with >50% low quality bases and/or with >10% unknown nucleotides were defined as low quality sequences. Using NGSQC Toolkit (http://www.nipgr.res.in/ngsqctoolkit.html) (18), the raw data were pre-processed by filtering out the low quality sequences. Afterwards, the high quality sequences were aligned to human genome (version hg19) using tophat2 software (http://ccb.jhu.edu/software/tophat/index.shtml) (19), with default parameters. Furthermore, the DEGs in OLP vs. normal and OSCC vs. normal comparison groups, respectively, were screened by the limma package (http://www.bioconductor.org/packages/release/bioc/html/limma.html) (20,21) in R language. The thresholds for screening DEGs were |log2fold change (FC)| >0.5 and P-value <0.05.

Euclidean distance, which can be calculated by the Pythagorean formula, refers to the true distance between two points (22). The expression values of the DEGs in each sample were extracted. By the Pheatmap package (http://cran.r-project.org/web/packages/pheatmap/index.html) (23) in R language, bidirectional hierarchical clustering analysis (24,25) were performed to cluster gene expression values and samples based on the Euclidean distance (22). After that, genes with close expression were clustered together, and genes with sample specificity can be identified.

Screening disease-associated module using WGCNA

WGCNA is a typical systems biology method for constructing gene co-expression network, which is based on high-throughput gene expression data (26,27). Firstly, the Pearson's correlation matrices were calculated for each gene pair, and the correlation coefficient Smn|cor(m,n)| was defined for m and n gene pairs. Secondly, the Pearson's correlation matrices were converted into adjacent matrices by an adjacent function amn power (Smn, β). Then, the weighting coefficient β was determined based on the principle of scale-free network. The weighting coefficient β, which was the correlation coefficient between log2 k and log2 p(k) (k represented the number of connected nodes, and p stood for appearing probability of nodes) should be no less than 0.9. Subsequently, the adjacent matrices were transformed into topology matrices using Ω = Wmn = (lmn + amn) / (min{km, kn} + 1 - amn). The lmn represented the total area of correlation coefficients of the nodes linked with both gene m and gene n. The km indicated the sum of correlation coefficients of the nodes linked with gene m. Wmn was equal to 0, when gene m did not connect with gene n, and no genes linked with both gene m and gene n. The dissimilarity degree of a node, which was the basis for constructing the network, was defined as dmn = 1 - Wmn. WGCNA for the DEGs was conducted as described previously (26,27), and gene modules were identified by hybrid dynamic shear tree (28,29). Besides, T-test was applied to calculate the significant P-value of each gene between different groups, and the mediated P-value (lgP) was defined as the gene significance (GS) of each gene. The module significance (MS) was considered as the mean GS of the genes included in the module. Among the identified modules, the one with the highest MS value was selected as disease-associated module.

Construction of co-expression network for genes involved in the disease-associated module

The correlation coefficients of genes involved in the OLP-associated module and OSCC-associated module separately were extracted from the modules. Then, the co-expression networks were visualized by Cytoscape software (http://www.cytoscape.org/) (30). Besides, the genes associated with both OLP and OSCC were identified by comparing the genes involved in OLP-associated module and OSCC-associated module. Moreover, the genes associated with both OLP and OSCC were mapped to the co-expression networks.

Functional enrichment analysis

GOstats (available at: http://bioconductor.org) is usually utilized to perform functional enrichment analysis and test gene ontology (GO) terms for genes in a specific gene list (31). GO can be used to analyze the biological process, molecular function and cellular component involved gene products (32). Using the GOstat package (31) in R language, GO enrichment analysis was conducted for the disease-associated genes involved in the co-expression network. The terms with P-value <0.05 were taken as statistically significant.

qRT-PCR analysis

After the primer sequences for qRT-PCR amplification were designed using Primer Premier 6.0 software (Premier Software Inc., Cherry Hill, NJ, USA) (Table I), they were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). The expression of critical genes in OLP, OSCC and normal samples were measured by SYBR Green master mix kit (Applied Biosystems, Foster City, CA), respectively. The 20 µl reaction system was composed of the following reagents: 10 µl SYBR Premix Ex Taq (2X), 1 µl forward primer (10 µM), and 1 µl reverse primer (10 µM), and 8 µl cDNA template (being diluted by ddH2O to keep a certain concentration). Then, the mixture reacted under the following conditions: 50°C for 3 min; 95°C for 3 min; 95°C for 10 sec and 60°C for 30 sec for 40 cycles; melt curve 60–95°C: increment 0.5°C for 10 sec plate read. All samples had three repeats, with GAPDH as the reference gene.

Table I.

The primers used for quantitative real-time PCR (qRT-PCR) experiments.

Table I.

The primers used for quantitative real-time PCR (qRT-PCR) experiments.

Primer namePrimer sequence (5′-3′)
BCL9LF: CACAATGCCATCAAGACCATC
R: AGTTCAGGTGCATCTGGCTG
GMPSF: CATAGACCGAAGAGTGAGGGAAC
R: GAACAGGCTTGCCAATAGTGAATA
HES1F: CAGCGAGTGCATGAACGAGGTGA
R: AGGTGCCGCTGTTGCTGGTGTAGA
PER2F: TCCAGATACCTTTAGCCTGATGA
R: TTTGTGTGTGTCCACTTTCGA
TSPAN33F: GGCAAGCCTCATAAACGAAC
R: CCTTCTGCCCATCTGGAGTT
GAPDHF: TGACAACTTTGGTATCGTGGAAGG
R: AGGCAGGGATGATGTTCTGGAGAG
Statistical analysis

Using the 2−∆∆Ct method (33), the gene expression values were calculated. All results are presented as mean ± SEM (standard error of mean). SPSS 22.0 (SPSS Inc., Chicago, IL, USA) and Graphpad prism 5 (Graphpad Software, San Diego, CA, USA) software was used also for statistic analysis and drawing pictures, with the P<0.05 as the screening criteria for significant difference.

Results

DEG screening and bidirectional hierarchical clustering

The raw data were preprocessed, and the quality control results and the comparison results of the raw RNA-sequencing data, respectively, are shown in Table IIA and Table IIB. Followed by a total of 223 (including 74 up- and 149 down-regulated genes) and 548 (including 80 up- and 468 down-regulated genes) DEGs separately were identified in OLP vs. normal and OSCC vs. normal comparison groups. Subsequently, the expression values of the DEGs in each sample were extracted and bidirectional hierarchical clustering analysis was carried out. The dendrogram of clustering analysis showed that the DEGs could separate the OLP or OSCC samples from normal samples completely, indicating that the expression differences of the DEGs were significant (Fig. 1).

Figure 1.

The dendrogram of clustering analysis for the differentially expressed genes in OLP vs. normal (A) and OSCC vs. normal (B) comparison groups. Red and blue indicate higher and lower expression values, respectively.

Table II.

The quality control results and the comparison results of the raw RNA-sequencing data.

Table II.

The quality control results and the comparison results of the raw RNA-sequencing data.

A, Quality control results
SampleRaw readsRaw basesTrim reads Trim basesAverage lengthTrim reads (%)Trim bases (%)
OLP87356096882296569677746400 733157031494.301090650.8899939850.830964391
OSCC79835924806342832466754732 608796147491.198950120.836149050.755009064
Normal1002173701012195437081959072 749471832491.444645980.817813040.740441821

B, Comparison results

SampleTotal readsTotal mappedMapped ratio (%)Multiple mappedUnique mappedReads mapping to positive-senseReads mapping to antisense strandReads proper pair

OLP777464006367405581.90297937160694684302072153048746952761594
OSCC667547324829214572.30306874645223399225354312268796838605610
Normal819590725352985565.30349234250037513248738372516367642128686

[i] OLP, oral lichen planus; OSCC, oral squamous cell carcinoma.

Screening disease-associated module using WGCNA

Based on hybrid dynamic shear tree, modules for the DEGs in the two comparison groups were identified and exhibited by different colors (Fig. 2). According to the MS value of modules, the blue modules for the DEGs in OLP vs. normal (MS=0.88) and in OSCC vs. normal (MS=0.90) comparison groups were selected as disease-associated modules for they had the highest MS values (Fig. 3).

Figure 2.

Modules identified for the differentially expressed genes in OLP vs. normal (A) and OSCC vs. normal (B) comparison groups. Horizontal ordinate represents modules in different colors. Vertical ordinate is the height of clustering tree.

Figure 3.

Identification of OLP- (A) and OSCC-associated (B) modules based on the MS values. Horizontal ordinate represents modules in different colors. Vertical ordinate is the overall correlation coefficient between genes in each module and disease state.

Construction of co-expression network for genes involved in the disease-associated module

There were 49 and 123 DEGs, respectively, in the blue modules for the DEGs in OLP vs. normal and in OSCC vs. normal comparison groups. The correlation coefficients of genes involved in the blue modules were extracted, and the co-expression networks were visualized. Through comparing the genes involved in the blue modules, a total of 19 common DEGs (including 4 upregulated genes and 15 downregulated genes) associated with both OLP and OSCC were identified and mapped to the co-expression networks (Table III), including upregulated B-cell CLL/lymphoma 9-like (BCL9L), period circadian clock 2 (PER2) and tetraspanin 33 (TSPAN33), as well as downregulated guanine monphosphate synthase (GMPS) and Hes family bHLH transcription factor 1 (HES1). The co-expression network for OLP vs. normal comparison group had 138 interactions and 41 nodes, and that for OSCC vs. normal comparison group had 757 interactions and 85 nodes (Fig. 4). Especially, BCL9L, HES1, PER2 and TSPAN33 might be involved in OLP through interactions in the co-expression networks for OLP vs. normal (such as BCL9L-TSPAN33) and OSCC vs. normal comparison groups (such as BCL9L-PER2, and HES1-PER2).

Figure 4.

The co-expression networks for the differentially expressed genes (DEGs) in the blue modules. (A) The co-expression network for the DEGs in the blue module for OLP vs. normal comparison group. (B) The co-expression networks for the DEGs in the blue modules for OSCC vs. normal comparison groups. Red and green nodes represent upregulated and downregulated genes, respectively. Diamond nodes stood for the common DEGs between the OLP vs. normal and OSCC vs. normal comparison groups. Solid lines and dotted lines indicate positive correlations and negative correlations, respectively.

Table III.

The common differentially expressed genes (DEGs) between OLP vs. normal and OSCC vs. normal comparison groups.

Table III.

The common differentially expressed genes (DEGs) between OLP vs. normal and OSCC vs. normal comparison groups.

OLPSCC


GenelogFCP-valuelogFCP-value
BCL9L0.8662680.0271030.878620.011379
C21orf62−0.870820.034486−0.875370.025741
CHGA−0.874690.030446−0.890570.009506
DPY19L2P4−0.847250.003033−0.874980.006929
FAM228B−0.899340.048295−0.916740.025529
GMPS−0.873380.001723−0.864930.008399
HES1−0.882830.010514−0.870280.004662
OIP5-AS10.8807890.0003740.8818470.000254
PER20.8828850.0118760.8866160.004227
SMC6−0.88370.016755−0.886470.048216
SNX29P1−0.923430.019689−0.947560.01687
SPATC1L−0.868160.020417−0.873730.015081
TERF2−0.876860.038943−0.89640.012173
TMEM121−0.906550.045068−0.871880.033126
TSPAN330.8431680.0051860.8354430.046788
ZNF347−0.89330.0388−0.895620.023093
ZNF439−0.91030.019051−0.905910.014761
ZNF669−0.870.018227−0.867370.01926
ZNF70−0.861380.007926−0.87250.00475
Functional enrichment analysis

GO enrichment analysis was performed for the DEGs involved in the co-expression networks for OLP vs. normal and OSCC vs. normal comparison groups, respectively. In total, 7 and 6 GO terms, respectively, were enriched for the DEGs involved in the co-expression networks for OLP vs. normal and OSCC vs. normal comparison groups (Fig. 5 and Table IV). Importantly, the functions enriched for the DEGs involved in the two co-expression networks both included transcription, regulation of transcription, regulation of transcription, DNA-dependent, and regulation of RNA metabolic process.

Figure 5.

The functional terms enriched for the differentially expressed genes involved in the co-expression networks for OLP vs. normal (A) and OSCC vs. normal (B) comparison groups. The height of the column indicates the number of genes involved in the term. The color of the column represents the -lg(P-value) value.

Table IV.

The gene ontology (GO) terms enriched for the differentially expressed genes (DEGs) involved in the co-expression networks for OLP vs. normal and OSCC vs. normal comparison groups.

Table IV.

The gene ontology (GO) terms enriched for the differentially expressed genes (DEGs) involved in the co-expression networks for OLP vs. normal and OSCC vs. normal comparison groups.

A, The functions enriched for the DEGs involved in the co-expression network for OLP vs. normal comparison group
DescriptionP-valueGene no.Gene symbol
GO:0045449~regulation of transcription1.78E-0312ZNF169, ATRX, HES1, ZNF439, ZNF283, CDKN1B, GTF2F1, PER2, BCL9L, ZNF669, ZNF70, SLC30A9
GO:0006350~transcription5.32E-0310ZNF169, HES1, ZNF439, ZNF283, GTF2F1, PER2, BCL9L, ZNF669, ZNF70, SLC30A9
GO:0006355~regulation of transcription, DNA-dependent6.78E-03  9ZNF169, ATRX, HES1, ZNF439, ZNF283, CDKN1B, PER2, ZNF669, ZNF70
GO:0051252~regulation of RNA metabolic process7.76E-03  9ZNF169, ATRX, HES1, ZNF439, ZNF283, CDKN1B, PER2, ZNF669, ZNF70
GO:0008270~zinc ion binding1.65E-02  9ZNF169, ATRX, SMAP2, ZNF439, ZNF283, ZNF669, MBNL2, ZNF70, SLC30A9
GO:0003677~DNA binding1.74E-02  9ZNF169, ATRX, HES1, ZNF439, ZNF283, GTF2F1, ZNF669, ZNF70, SLC30A9
GO:0046914~transition metal ion binding4.68E-02  9ZNF169, ATRX, SMAP2, ZNF439, ZNF283, ZNF669, MBNL2, ZNF70, SLC30A9

B, The functions enriched for the DEGs involved in the co-expression network for OSCC vs. normal comparison group

DescriptionP-valueGene no.Gene symbol

GO:0006350~transcription3.41E-0623POU6F1, ZNF430, ZNF264, ZNF818P, SAP18, ZNF669, MED13, ZNF221, ZNF347, ZNF175, ZBTB25, HES1, ZNF439, NOTCH1, ZNF324, MLX, PER2, LEO1, BCL9L, SETD8, ZFPM1, NFIC, ZNF70
GO:0045449~regulation of transcription9.08E-0625POU6F1, ZNF430, ZNF264, ZNF818P, SAP18, ZNF669, MED13, ZNF221, ZNF347, ZNF175, ZBTB25, HES1, ZNF439, NOTCH1, RNF141, ZNF324, MLX, PER2, LEO1, BCL9L, SETD8, ZFPM1, NFIC, ZNF70, TERF2
GO:0006355~regulation of transcription, DNA-dependent2.16E-0418POU6F1, ZNF430, ZNF264, SAP18, ZNF669, MED13, ZNF221, ZNF347, ZNF175, HES1, NOTCH1, ZNF439, RNF141, ZNF324, MLX, PER2, NFIC, ZNF70
GO:0051252~regulation of RNA metabolic process2.83E-0418POU6F1, ZNF430, ZNF264, SAP18, ZNF669, MED13, ZNF221, ZNF347, ZNF175, HES1, NOTCH1, ZNF439, RNF141, ZNF324, MLX, PER2, NFIC, ZNF70
GO:0010605~negative regulation of macromolecule metabolic process2.15E-02  8HES1, PSMB3, MLX, GMNN, SETD8, CDC16, NFIC, TERF2
GO:0051172~negative regulation of nitrogen compound metabolic process4.83E-02  6HES1, MLX, GMNN, SETD8, NFIC,TERF2
qRT-PCR analysis

Through qRT-PCR experiments, the expression levels of BCL9L, GMPS, HES1, PER2 and TSPAN33 in OLP, OSCC and normal samples were detected. Compared with normal samples, BCL9L (P<0.05, Fig. 6A), PER2 (P<0.05, Fig. 6B) and TSPAN33 (P<0.05, Fig. 6C) were significantly upregulated in both OLP and OSCC samples. GMPS (P<0.05, Fig. 6D) in both OLP and OSCC samples, and HES1 (P<0.05, Fig. 6E) in OSCC samples were significantly downregulated relative to normal samples.

Figure 6.

The expression levels of BCL9L (A), PER2 (B), TSPAN33 (C), GMPS (D) and HES1 (E) in OLP, OSCC and normal samples. *P<0.05; **P<0.01.

Discussion

In OLP subepithelial infiltrate, cytokine networks and inflammatory cells may contribute to squamous tumorigenesis through affecting cell survival, proliferation, differentiation, growth and movement (34). Conway et al analyzed the transcriptomes of matched OSCC, oral dysplasia and normal oral mucosa samples, finding that IL36G and adherens junction components play potential roles in malignant transformation, and lincRNA RP11-351J23.1 acts in de-differentiation of OSCCs (35). Jakhesara et al investigated the aberrant transcriptional events in buccal mucosal cancer (BMC) through high throughput RNA-Seq analysis, and obtain 588 DEGs and 747 dysregulated isoforms that may be used for therapeutic intervention and biomarker evaluation (36). Tang et al compared the gene expression changes between a late stage and an early stage of tongue carcinogenesis, and reveal ALDH1A3, PTGS2 and KRT1 transcripts, as well as pathways of ‘degradation of basement membrane and ECM pathways’ and ‘cell cycle progression’ may function in early diagnosis and prevention of human tongue squamous cell carcinomas (37). Somoza-Martín et al analyzed the gene expression profile of OSCC, and identified 322 upregulated genes and 104 downregulated genes in tumoral tissue (38). However, these findings were different from our results. In this study, total 223 (including 74 up- and 149 down-regulated genes) and 548 (including 80 up- and 468 down-regulated genes) DEGs, respectively, were identified in OLP vs. normal and OSCC vs. normal comparison groups. The dendrogram of clustering analysis showed that the DEGs completely separated the OLP or OSCC samples from normal samples. Besides, the blue modules for the DEGs in OLP vs. normal and in OSCC vs. normal comparison groups were disease-associated modules. Moreover, total 19 common DEGs (including BCL9L, GMPS, HES1, PER2 and TSPAN33) associated with both OLP and OSCC were identified. It was clear that some novel genes might function in the malignant transformation of OLP.

BCL6, which mediates B cell differentiation and inflammation, is implicated in malignant transformation via inhibiting differentiation and promoting proliferation (39). Previous study declares that BCL2 suppresses the apoptosis of immune process-associated lymphocytes and the upregulated BCL2-associated X protein (Bax) has correlation with the apoptosis of epithelial cells in patients with OLP (40). The expression alterations of BCL2, Bax, proliferating cell nuclear antigen (PCNA) and p53 proteins are observed in OLP and epithelial dysplasia, indicating the malignant potential in both lesions (41,42). As a nuclear Wnt pathway component, BCL9 is important for tumor progression and may be used for therapeutic intervention in several Wnt signaling-associated malignancies (43). These indicated that BCL9L might be associated with the malignant potential of OLP.

Cyclic guanosine monophosphate (cGMP) plays a critical role in cell differentiation, proliferation and apoptosis, and functions in inflammation, angiogenesis and synaptic plasticity (44). Through the nitric oxide/cGMP/protein kinase G/KATP intracellular signaling pathway, inflammatory hypernociception can be inhibited by the peripheral activation of A1 adenosine receptors (A1Rs) (45). The Notch and Toll-like receptor (TLR) signaling pathways have been demonstrated to cooperately activate the expression of Notch target genes (such as Hairy/E(spl)-related with YRPW motif, HEY; and HES1) and promote the production of TLR-triggered cytokines (such as IL-6, IL-12 and TNF-α) (46). Several studies have suggested that the Notch signaling is related to inflammatory disorders (47,48). HES1 may be implicated in OSCC progression and cancer stem-like cell (CSC) phenotype in vivo, in addition, the Notch-HES1 pathway activated by inflammatory cytokine exposure may promote the phenotype in OSCC (49). Therefore, GMPS and HES1 might be involved in squamous tumorigenesis in OLP.

The mRNA and protein expression of PER1 was significantly decreased in OSCC, which may be essential in the occurrence, development and invasion of OSCC (50). The tumor suppressor gene PER1 acts in the development and progression of OSCC, and may be used as a molecular target for the treatment of the disease (51). Previous study reported that PER2 is important for regulating natural killer (NK) cell function, which shows the direct link between innate immune responses and the circadian clock system (52). Using de novo mouse cancer models, Hemler et al found that select tetraspanin proteins play important roles in tumor initiation, metastasis and promotion (53). TSPAN33 shows a restricted expression pattern in activated B cells, and may serve as a therapeutic target or diagnostic biomarker for B cell lymphomas or autoimmune diseases (54). The above suggest that PER2 and TSPAN33 might function in the malignant transformation of OLP to OSCC. In the co-expression networks, BCL9L, HES1, PER2 and TSPAN33 had interactions (such as BCL9L-TSPAN33, BCL9L-PER2, and HES1-PER2), indicating that PER2 and TSPAN33 might also function in OLP via interacting with other genes. qRT-PCR analysis showed that BCL9L, PER2 and TSPAN33 were significantly upregulated in both OLP and OSCC samples. Whereas, GMP in both OLP and OSCC samples, and HES1 in OSCC samples were significantly downregulated. The results of qRT-PCR were consistent with those of bioinformatics analysis, confirming the roles of BCL9L, GMPS, HES1, PER2 and TSPAN33 in the malignant transformation of OLP to OSCC.

In conclusion, 223 and 548 DEGs, respective, were identified in OLP vs. normal and OSCC vs. normal comparison groups through bioinformatics analysis. Furthermore, BCL9L, GMPS, HES1, PER2 and TSPAN33 acted in the malignant transformation of OLP to OSCC. However, these findings need to be further confirmed.

Acknowledgements

The present study was supported by the Medical Guiding Project, Science and Technology Commission of Shanghai Municipality, China (grant no. 134119a8700), the National Natural Science Foundation of China (grant no. 81470736), and The Shanghai Natural Science Foundation (grant no. 13ZR1405300).

References

1 

van der Waal I: Potentially malignant disorders of the oral and oropharyngeal mucosa; terminology, classification and present concepts of management. Oral Oncol. 45:317–323. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Warnakulasuriya S, Johnson NW and van der Waal I: Nomenclature and classification of potentially malignant disorders of the oral mucosa. J Oral Pathol Med. 36:575–580. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Shen Z-Y, Liu W, Feng J-Q, Zhou H-W and Zhou Z-T: Squamous cell carcinoma development in previously diagnosed oral lichen planus: De novo or transformation? Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 112:592–596. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Au J, Patel D and Campbell JH: Oral lichen planus. Oral Maxillofac Surg Clin North Am. 25:93–100, vii. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Gillison ML: Current topics in the epidemiology of oral cavity and oropharyngeal cancers. Head Neck. 29:779–792. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Edwards BK, Brown ML, Wingo PA, Howe HL, Ward E, Ries LA, Schrag D, Jamison PM, Jemal A, Wu XC, et al: Annual report to the nation on the status of cancer, 1975–2002, featuring population-based trends in cancer treatment. J Natl Cancer Inst. 97:1407–1427. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Choi S and Myers JN: Molecular pathogenesis of oral squamous cell carcinoma: Implications for therapy. J Dent Res. 87:14–32. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Patel SC, Carpenter WR, Tyree S, Couch ME, Weissler M, Hackman T, Hayes DN, Shores C and Chera BS: Increasing incidence of oral tongue squamous cell carcinoma in young white women, age 18 to 44 years. J Clin Oncol. 29:1488–1494. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Mollaoglu N: Oral lichen planus: A review. Br J Oral Maxillofac Surg. 38:370–377. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Mignogna MD, Lo Russo L, Fedele S, Ruoppo E, Califano L and Lo Muzio L: Clinical behaviour of malignant transforming oral lichen planus. Eur J Surg Oncol. 28:838–843. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Chen Y, Zhang W, Geng N, Tian K and Windsor Jack L: MMPs, TIMP-2, and TGF-β1 in the cancerization of oral lichen planus. Head Neck. 30:1237–1245. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Mazzarella N, Femiano F, Gombos F, De Rosa A and Giuliano M: Matrix metalloproteinase gene expression in oral lichen planus: Erosive vs. reticular forms. J Eur Acad Dermatol Venereol. 20:953–957. 2006.PubMed/NCBI

13 

Shi P, Liu W, Zhou Z-T, He Q-B and Jiang W-W: Podoplanin and ABCG2: Malignant transformation risk markers for oral lichen planus. Cancer Epidemiol Biomarkers Prev. 19:844–849. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Rhodus NL, Cheng B, Myers S, Miller L, Ho V and Ondrey F: The feasibility of monitoring NF-kappaB associated cytokines: TNF-α, IL-1α, IL-6, and IL-8 in whole saliva for the malignant transformation of oral lichen planus. Mol Carcinog. 44:77–82. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Zhang Y, Lin M, Zhang S, Wang Z, Jiang L, Shen J, Bai J, Gao F, Zhou M and Chen Q: NF-kappaB-dependent cytokines in saliva and serum from patients with oral lichen planus: A study in an ethnic Chinese population. Cytokine. 41:144–149. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Poomsawat S, Buajeeb W, Khovidhunkit SO and Punyasingh J: Overexpression of cdk4 and p16 in oral lichen planus supports the concept of premalignancy. J Oral Pathol Med. 40:294–299. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Anders S, McCarthy DJ, Chen Y, Okoniewski M, Smyth GK, Huber W and Robinson MD: Count-based differential expression analysis of RNA sequencing data using R and Bioconductor. Nat Protoc. 8:1765–1786. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Patel RK and Jain M: NGS QC Toolkit: A toolkit for quality control of next generation sequencing data. PLoS One. 7:e306192012. View Article : Google Scholar : PubMed/NCBI

19 

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R and Salzberg SL: TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14:R362013. View Article : Google Scholar : PubMed/NCBI

20 

Smyth GK: Limma: linear models for microarray data. Bioinformatics and Computational Biology Solutions Using R and Bioconductor. Springer, Verlag New York Inc.; NY: pp. 397–420. 2005, View Article : Google Scholar

21 

Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W and Smyth GK: limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 43:e472015. View Article : Google Scholar : PubMed/NCBI

22 

Deza MM and Deza E: Encyclopedia of distances. Springer; 2009, doi: 10.1007/978-3-642-00234–2. View Article : Google Scholar

23 

Kolde R and Kolde MR: Package ‘pheatmap’. 2015.http://cran.r-project.org/web/packages/pheatmap/index.html

24 

Szekely GJ and Rizzo ML: Hierarchical clustering via joint between-within distances: Extending Ward's minimum variance method. J Classif. 22:151–183. 2005. View Article : Google Scholar

25 

Press W, Teukolsky S, Vetterling W and Flannery B: Section 16.4. Hierarchical clustering by phylogenetic trees. Numerical Recipes: The Art of Scientific Computing. Cambridge University Press; New York: pp. 868–881. 2007

26 

Oldham MC, Konopka G, Iwamoto K, Langfelder P, Kato T, Horvath S and Geschwind DH: Functional organization of the transcriptome in human brain. Nat Neurosci. 11:1271–1282. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Liao Q, Liu C, Yuan X, Kang S, Miao R, Xiao H, Zhao G, Luo H, Bu D, Zhao H, et al: Large-scale prediction of long non-coding RNA functions in a coding-non-coding gene co-expression network. Nucleic Acids Res. 39:3864–3878. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Langfelder P, Zhang B and Horvath S: Defining clusters from a hierarchical cluster tree: The Dynamic Tree Cut package for R. Bioinformatics. 24:719–720. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Dong J and Horvath S: Understanding network concepts in modules. BMC Syst Biol. 1:242007. View Article : Google Scholar : PubMed/NCBI

30 

Smoot ME, Ono K, Ruscheinski J, Wang P-L and Ideker T: Cytoscape 2.8: New features for data integration and network visualization. Bioinformatics. 27:431–432. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Falcon S and Gentleman R: Using GOstats to test gene lists for GO term association. Bioinformatics. 23:257–258. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Tweedie S, Ashburner M, Falls K, Leyland P, McQuilton P, Marygold S, Millburn G, Osumi-Sutherland D, Schroeder A, Seal R, et al: FlyBase Consortium: FlyBase: Enhancing Drosophila gene ontology annotations. Nucleic Acids Res. 37:D555–D559. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Arocho A, Chen B, Ladanyi M and Pan Q: Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR-ABL P210 transcripts. Diagn Mol Pathol. 15:56–61. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Mignogna MD, Fedele S, Lo Russo L, Lo Muzio L and Bucci E: Immune activation and chronic inflammation as the cause of malignancy in oral lichen planus: Is there any evidence? Oral Oncol. 40:120–130. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Conway C, Graham JL, Chengot P, Daly C, Chalkley R, Ross L, Droop A, Rabbitts P and Stead LF: Elucidating drivers of oral epithelial dysplasia formation and malignant transformation to cancer using RNAseq. Oncotarget. 6:40186–40201. 2015.PubMed/NCBI

36 

Jakhesara SJ, Koringa PG, Bhatt VD, Shah TM, Vangipuram S, Shah S and Joshi CG: RNA-Seq reveals differentially expressed isoforms and novel splice variants in buccal mucosal cancer. Gene. 516:24–32. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Tang X-H, Urvalek AM, Osei-Sarfo K, Zhang T, Scognamiglio T and Gudas LJ: Gene expression profiling signatures for the diagnosis and prevention of oral cavity carcinogenesis-genome-wide analysis using RNA-seq technology. Oncotarget. 6:24424–24435. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Somoza-Martín JM, García-García A, Barros-Angueira F, Otero-Rey E, Torres-Español M, Gándara-Vila P, Reboiras-López MD, Blanco-Carrión A and Gándara-Rey JM: Gene expression profile in oral squamous cell carcinoma: A pilot study. J Oral Maxillofac Surg. 63:786–792. 2005. View Article : Google Scholar : PubMed/NCBI

39 

Shaffer AL, Yu X, He Y, Boldrick J, Chan EP and Staudt LM: BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity. 13:199–212. 2000. View Article : Google Scholar : PubMed/NCBI

40 

Fan Y, Zhan Z, Peng T, Song XL and Feng ZQ: The expression of apoptosis-associated proteins Bcl-2, Bax in oral leukoplakia and lichen planus. Shanghai Kou Qiang Yi Xue. 13:497–501. 2004.(In Chinese). PubMed/NCBI

41 

Hadzi-Mihailovic M, Raybaud H, Monteil R, Cakic S, Djuric M and Jankovic L: Bcl-2 expression and its possible influence on malignant transformation of oral lichen planus. J BUON. 15:362–368. 2009.

42 

Sousa FA, Paradella TC, Carvalho YR and Rosa LE: Immunohistochemical expression of PCNA, p53, bax and bcl-2 in oral lichen planus and epithelial dysplasia. J Oral Sci. 51:117–121. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Mani M, Carrasco DE, Zhang Y, Takada K, Gatt ME, Dutta-Simmons J, Ikeda H, Diaz-Griffero F, Pena-Cruz V, Bertagnolli M, et al: BCL9 promotes tumor progression by conferring enhanced proliferative, metastatic, and angiogenic properties to cancer cells. Cancer Res. 69:7577–7586. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Pilz RB and Broderick KE: Role of cyclic GMP in gene regulation. Front Biosci. 10:1239–1268. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Lima FO, Souza GR, Verri WA Jr, Parada CA, Ferreira SH, Cunha FQ and Cunha TM: Direct blockade of inflammatory hypernociception by peripheral A1 adenosine receptors: Involvement of the NO/cGMP/PKG/KATP signaling pathway. Pain. 151:506–515. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Hu X, Chung AY, Wu I, Foldi J, Chen J, Ji JD, Tateya T, Kang YJ, Han J, Gessler M, et al: Integrated regulation of Toll-like receptor responses by Notch and interferon-γ pathways. Immunity. 29:691–703. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Okamoto M, Takeda K, Joetham A, Ohnishi H, Matsuda H, Swasey CH, Swanson BJ, Yasutomo K, Dakhama A and Gelfand EW: Essential role of Notch signaling in effector memory CD8+ T cell-mediated airway hyperresponsiveness and inflammation. J Exp Med. 205:1087–1097. 2008. View Article : Google Scholar : PubMed/NCBI

48 

Niranjan T, Bielesz B, Gruenwald A, Ponda MP, Kopp JB, Thomas DB and Susztak K: The Notch pathway in podocytes plays a role in the development of glomerular disease. Nat Med. 14:290–298. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Lee SH, Hong HS, Liu ZX, Kim RH, Kang MK, Park NH and Shin KH: TNFα enhances cancer stem cell-like phenotype via Notch-Hes1 activation in oral squamous cell carcinoma cells. Biochem Biophys Res Commun. 424:58–64. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Chen R, Yang K, Zhao N-B, Zhao D, Chen D, Zhao CR and Tang H: Abnormal expression of PER1 circadian-clock gene in oral squamous cell carcinoma. Onco Targets Ther. 5:403–407. 2012.PubMed/NCBI

51 

Fu X-J, Li H-X, Yang K, Chen D and Tang H: The important tumor suppressor role of PER1 in regulating the cyclin-CDK-CKI network in SCC15 human oral squamous cell carcinoma cells. Onco Targets Ther. 9:2237–2245. 2016.PubMed/NCBI

52 

Liu J, Malkani G, Shi X, Meyer M, Cunningham-Runddles S, Ma X and Sun ZS: The circadian clock Period 2 gene regulates gamma interferon production of NK cells in host response to lipopolysaccharide-induced endotoxic shock. Infect Immun. 74:4750–4756. 2006. View Article : Google Scholar : PubMed/NCBI

53 

Hemler ME: Tetraspanin proteins promote multiple cancer stages. Nat Rev Cancer. 14:49–60. 2014. View Article : Google Scholar : PubMed/NCBI

54 

Luu VP, Hevezi P, Vences-Catalan F, Maravillas-Montero JL, White CA, Casali P, Llorente L, Jakez-Ocampo J, Lima G, Vilches-Cisneros N, et al: TSPAN33 is a novel marker of activated and malignant B cells. Clin Immunol. 149:388–399. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang Q, Guo B, Sun H, Zhang J, Liu S, Hexige S, Yu X and Wang X: Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing. Oncol Rep 37: 2355-2365, 2017.
APA
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S. ... Wang, X. (2017). Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing. Oncology Reports, 37, 2355-2365. https://doi.org/10.3892/or.2017.5487
MLA
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S., Yu, X., Wang, X."Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing". Oncology Reports 37.4 (2017): 2355-2365.
Chicago
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S., Yu, X., Wang, X."Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing". Oncology Reports 37, no. 4 (2017): 2355-2365. https://doi.org/10.3892/or.2017.5487
Copy and paste a formatted citation
x
Spandidos Publications style
Yang Q, Guo B, Sun H, Zhang J, Liu S, Hexige S, Yu X and Wang X: Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing. Oncol Rep 37: 2355-2365, 2017.
APA
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S. ... Wang, X. (2017). Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing. Oncology Reports, 37, 2355-2365. https://doi.org/10.3892/or.2017.5487
MLA
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S., Yu, X., Wang, X."Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing". Oncology Reports 37.4 (2017): 2355-2365.
Chicago
Yang, Q., Guo, B., Sun, H., Zhang, J., Liu, S., Hexige, S., Yu, X., Wang, X."Identification of the key genes implicated in the transformation of OLP to OSCC using RNA-sequencing". Oncology Reports 37, no. 4 (2017): 2355-2365. https://doi.org/10.3892/or.2017.5487
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team