Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
August-2017 Volume 38 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2017 Volume 38 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells

Retraction in: /10.3892/or.2025.8875
  • Authors:
    • Xu-Dong Chen
    • Shi-Xiong Tang
    • Jian-Hua Zhang
    • Li-Tao Zhang
    • Yao-Wen Wang
  • View Affiliations / Copyright

    Affiliations: Department of Otolaryngology, First Hospital of Ningbo City, Ningbo City, Zhejiang 315000, P.R. China
  • Pages: 1005-1012
    |
    Published online on: June 27, 2017
       https://doi.org/10.3892/or.2017.5759
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Laryngeal carcinoma is one of the most common malignant tumors in otorhinolaryngology. Moreover, experimental investigation showed that cancerous inhibitor of protein phosphatase 2A (CIP2A) expressed highly in various cancers. Therefore, we investigated whether CIP2A can regulate the proliferation, invasion and migration by RNA interference in Hep-2 cells and AMC-NH-8 cells and further affect the activation of phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway. Overexpression of CIP2A was evaluated in tumor tissue and laryngeal cancer cell lines (Hep-2 and AMC-NH-8 cells) by real-time quantitative polymerase chain reaction (RT-qPCR) and western blot assay. In a follow-up experiment, we confirmed that CIP2A siRNA effectively suppressed the cell proliferation at 48 and 72 h, and arrested cell cycle at G0/G1 in Hep-2 cells and AMC-NH-8 cells. The invasion and migration of cell in siRNA CIP2A group were markedly inhibited. Moreover, the experimental results showed that the expression levels of invasion- and migration-related genes, including E-cadherin, metastasis-associated gene 1 (MTA1) and matrix metalloproteinases-2/9 (MMP-2/9), were regulated by CIP2A siRNA. Phosphorylation levels of PI3K and AKT proteins were reduced by CIP2A siRNA. Importantly, it suggested signaling through PI3K/Akt as a critical mechanism by which CIP2A siRNA may suppress cell proliferation, invasion and migration in laryngeal carcinoma cells.

Introduction

It is well established that laryngeal squamous cell carcinoma (LSCC) is derived from the mucosa epithelial tissues of the larynx. Approximately 5.7–7.6% of the otorhinolaryngeal carcinoma are confined to the larynx, and squamous cell carcinoma is the most common accounting for 96–98% (1). It is well accepted that comprehensive treatment based on surgery is the definitive therapy for laryngeal carcinoma patients. The local recurrent and metastasis of lymph nodes usually take place in LSCC. Therefore, surgical treatment, chemotherapy and radiotherapy cannot thoroughly clear the cancer cells (2). The phonetic function and living quality of patients are severely affected after surgery. Moreover, tumor cells are resistant to chemotherapy drugs and are not sensitive to radiotherapy, which is likely to cause cancer recurrence and metastasize (2–4). Therefore, looking for an efficient molecular targeted therapy to improve the survival rate and life quality of patients with laryngeal cancer is very important for clinical treatment.

CIP2A is a human oncogene (5). A recent study confirmed that CIP2A can promote cell transformation and tumorigenesis via inhibiting protein phosphatase 2A (PP2A) activity towards oncoprotein myelocytomatosis in the oncogene MYC (6). Furthermore, there is a positive feedback of regulatory pathway between CIP2A and MYC, thus, promoting their expression and cell proliferation (7). Proto-oncogene MYC is related to a variety of cell functions such as regulating the cell cycle, cell proliferation and cell growth. Therefore, the abnormal expression of MYC can promote cell transformation and tumorigenesis (8,9). Downregulation of CIP2A can result in the dephosphorylation of the PP2A target MYC serine 62 and the degradation of MYC protein (6). Some studies have showed that CIP2A is highly expressed in lung, ovarian, colon and gastric cancer and plays an important role in the occurrence and development of tumors (7,10–12). The results of our previous experiments have shown that the CIP2A expression in laryngeal cancer tissues is significantly increased compared to the adjacent tissues and benign laryngeal tumor tissues. Therefore, the present study investigated whether CIP2A siRNA can impact the invasion and migration of Hep-2 and AMC-NH-8 cells and the mechanisms involved.

Materials and methods

Patients and tissue samples

A total of 45 samples of laryngeal cancer tissues and benign laryngeal tumor tissues surgically removed in First Hospital of Ningbo City were collected from 2014 to 2016. Adjacent normal tissues were also collected as negative controls. Preoperative clinical and pathological follow-up data were completed by all patients. Ethics approval for the study was provided by the Ethics Committee of the Hospital. Written informed consent was obtained from the study subjects.

Cell culture

Human laryngeal epithelial cells were obtained from the Cell Engineering Research Center of The Fourth Military Medical University (Xi'an, China) and were cultured in RPMI-1640 medium (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS), 10 ng/ml epidermal growth factor, 1% insulin (First Biological and Chemical Medication, Co., Ltd., Shanghai, China), 5 µg/ml hydrocortisone (the Third Pharmaceutical, Co., Beijing, China) and 1% penicillin/streptomycin at 37°C in a humidified atmosphere of 5% CO2. Human laryngeal cancer cells (Hep-2 and AMC-NH-8) were purchased from the SUER Shanghai Bio-Tech, Co., Ltd. (Shanghai, China) and cultured in Dulbeccos modified Eagles medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA) containing 10% FBS and 1% penicillin/streptomycin at 37°C in a humidified atmosphere of 5% CO2.

siRNA transfection

Hep-2 cells and AMC-NH-8 cells were seeded onto 6-well culture plates at a density of 3×105 cells/well, respectively. The CIP2A siRNA or control siRNA, both purchased from Shanghai GenePharma, Co., Ltd., (Shanghai, China), were then transfected into cells at 50–60% confluency by using Lipofectamine™ 2000 (Invitrogen, Shanghai, China) following the manufacturers protocol. After 48 h, the transfected cells were collected and processed for the subsequent experiments. The sequences of siRNA used were: forward, 5-CCGGAATGCCTACGTTAAGCTATACCTCGAGGTAT AGTTAACGTAGGCATTTTTTTG-3 and reverse, 5-AA TTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGG TATAGCTTAACGTAGGCATT-3. The siRNA sequences of the negative siRNA used were: 5-UUCUUCCCGAACG UGUCGUCACGCCUTT-3′.

CCK-8 assay

Cell viability was evaluated by the CCK-8 assay. In brief, following 48-h transfection, Hep-2 cells and AMC-NH-8 cells were seeded at a density of 4×103 cells/well in 96-well plates and incubated for 0, 12, 24, 48 and 72 h. Subsequently, 20 µl CCK-8 was added to each well for another 1-h incubation. The optical density (OD) values were read at 570 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). All experimental concentrations were assessed in triplicate.

Flow cytometry

Flow cytometry was utilized for the analysis of the cell cycle. After 48-h transfection, cells were harvested and then fixed in ice-cold 70% ethanol (at −20°C) overnight. Afterwards, cells were washed with phosphate-buffered saline (PBS) prior re-suspending in DNA staining solution (40 µg/ml propidium iodide, 250 µg/ml RNase in PBS with 2 mM EDTA) for 30 min at 37°C. Cell cycle distribution was analyzed using a flow cytometer (FACSCalibur; BD Biosciences, San Jose, CA, USA).

Cell invasion and migration assay

Invasion and migration activity of Hep-2 cells and AMC-NH-8 cells were measured by a 24-well Transwell chamber coated with or without Matrigel (BD Biosciences) on the upper surface of the membrane with a pore size of 8 µm (Sigma-Aldrich). In brief, the transfected Hep-2 cells and AMC-NH-8 cells (1×104 cells/well) were suspended in culture media (100 µl, serum-free) and then placed in the upper Transwell chamber. The lower chamber was filled with medium containing 10% FBS. After 24-h incubation, the cells that had invaded or migrated through the membrane to the lower surface were fixed, stained and counted visually under a microscope (Olympus).

RT-qPCR analysis

Total RNA was extracted from transfected cells, mock cells and non-transfected cells using TRIzol (Invitrogen). Then, 2 µg of RNA was used for cDNA synthesis with a First Strand cDNA kit (Sigma-Aldrich, Munich, Germany), according to the protocol provided by the manufacturer. PCR amplification was executed in ABI 7300 Thermo Cycler (Applied Biosystems, Foster City, CA, USA), using a SYBR-Green PCR kit (Thermo Fisher Scientific). The PCR cycles were 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec, annealing/extension at 60°C for 45 sec. The primers used for the amplification of the indicated genes were designed using the Primer Express software (Applied Biosystems, Foster City, CA, USA). Primers used were: CIP2A, forward, 5-AAAGCGCGGCGAAAGCTAAA-3 and reverse, 5-GCG TTCGCCTCTGACTTCAC-3 (product: 150); E-cadherin, forward: 5-ACACTGGTGTGTCCCTCTGC-3 and reverse, 5-AAGGCTGCAGTGAGCTGTGA-3 (product: 102); MTA1, forward, 5-CGAGACCGAGTCGCTCAAGT-3 and reverse, 5-CTGCCTGGTACCGGTTTCCT-3 (product: 131); MMP-2, forward, 5-CGCCATGTCCACTGTTGGTG-3 and reverse, 5-TGTGGTCGCACACCACATCT-3 (product: 130); MMP-9, forward, 5-TGATTGACGACGCCTTTGCC-3 and reverse, 5-CCGCGACACCAAACTGGATG-3 (product: 114); GAPDH, forward, 5-CGGGAAACTGTGGCGTGATG-3 and reverse, 5-ATGACCTTGCCCACAGCCTT-3 (product: 87). Relative expression levels were calculated using the 2−ΔΔCT method. All experiments were performed in triplicate.

Western blot analysis

Protein concentrations were determined with a BCA protein assay kit (Thermo Fisher Scientific). An equal amount of proteins was subjected to SDS polyacrylamide gel electrophoresis, followed by electrotransfer to a nitrocellulose membrane. Following blockage with 5% skimmed-milk powder in PBS with 0.1% Tween-20 for 1 h, the membranes were probed with antibodies specific for E-cadherin (cat. no. ab76055; 1:800), MTA1 (cat. no. ab 50263; 1:1,000), MMP-2 (cat. no. ab7033; 1:1,000), MMP-9 (cat. no. ab73734; 1:800) (Abcam, Cambridge, UK) and GAPDH (cat. no. AG019 and AF006; 1:2,000) (Beyotime Institute of Biotechnology, Shanghai, China) overnight at 4°C, and then incubated with goat anti-rabbit secondary antibodies (cat. no. A0201 and A0192; 1:2,500; Beyotime Institute of Biotechnology). The bands were visualized using enhanced chemiluminescence detection kit (Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Statistical analysis

The results are presented as the mean ± SD of three independent experiments and the data were processed with SPSS 13.0 software. Survival analysis was used in the analysis of information on laryngeal cancer patients. Data for multiple comparisons were subjected to one-way ANOVA and Chi-square test. P<0.05 was considered statistically significant.

Results

Upregulation of CIP2A in laryngeal cancer tissues and laryngeal cancer cell lines is associated with poor survival of laryngeal cancer patients

First, 45 laryngeal cancer tissues and their adjacent normal tissues were collected, the CIP2A expression in laryngeal cancer tissues were then detected by RT-qPCR and western blot analysis. Intensive expression of CIP2A was found in laryngeal cancer tissues, compared with adjacent normal tissue (Fig. 1A and B). In addition, a univariate survival analysis suggested that the survival rate of patients with high expressed CIP2A and the survival rate of patients with low expressed CIP2A in 300 days were similar. As time goes on, the survival rate of patients with high expression of CIP2A was decreased (Fig. 1C). We investigated the correlation between CIP2A expression and clinical pathological features of the patients with laryngeal cancer. Examination of the correlation between CIP2A expression and clinical pathological features showed that there was a positive correlation between increased CIP2A and TNM staging (Fig. 1D and Table I). Upon further experiments, we found that CIP2A was highly expressed in laryngeal cancer cell lines including Hep-2 and AMC-NH-8 cells compared to normal by RT-qPCR and western blot analysis (Fig. 1E and F). It showed that CIP2A is obviously expressed in laryngeal cancer tissues and cells.

Figure 1.

CIP2A is obviously expressed in laryngeal cancer tissues, Hep-2 cells and AMC-NH-8 cells. (A and B) Forty-five laryngeal cancer tissues and their adjacent normal tissues were collected, mRNA expression level of CIP2A was detected by RT-qPCR. (C) The survival rate of 45 laryngeal cancer patients showed that higher CIP2A expression indicates significantly shorter survival than in the lower CIP2A expression patients. (D) Linear correlation was applied to analyze the TNM staging and CIP2A expression level. (E and F) The expression levels of CIP2A in Hep-2 cells and AMC-NH-8 cells were detected by RT-qPCR and western blot analysis. GAPDH was also detected as the control of sample loading. Data are expressed as the mean ± SD for three independent experiments. **P<0.01 vs. normal tissue.

Table I.

Relationship between CIP2A and clinical data of laryngeal carcinoma patients.

Table I.

Relationship between CIP2A and clinical data of laryngeal carcinoma patients.

Cancer stagingMale/femaleAge (<59/≥59)CIP2A expression (Lower/higher)
TNM
  I4/23/35/1
  II9/34/87/5
  III17/1015/128/19
P-values0.8850.1330.030a

a P<0.05

b P<0.01, Chi-square test.

Change in cell proliferation and cell cycle on CIP2A siRNA transfection of Hep-2 and AMC-NH-8 cells

As shown in Fig. 2A and B, the interference efficiency was identified by means of RT-qPCR and western blot analysis after CIP2A siRNA transfection of Hep-2 and AMC-NH-8 cells. The CIP2A expressions were blocked using RNA interference. CCK-8 results showed that the cell viability was significantly inhibited after CIP2A siRNA transfection of Hep-2 and AMC-NH-8 cells for more than 24 h (Fig. 2C and D). After CIP2A siRNA transfection of Hep-2 and AMC-NH-8 cells for 48 h, cell cycle distribution was then analyzed using flow cytometry. As shown in Fig. 2E and F, Hep-2 and AMC-NH-8 cells were arrested in G0/G1 phase. It showed that CIP2A interference significantly inhibited cell proliferation and affected cell cycle distribution.

Figure 2.

Changes in CIP2A expression, cell viability, and cell cycle on CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells. (A and B) The expression levels of CIP2A were detected after CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells for 48 h by RT-qPCR and western blot analysis. GAPDH was also detected as the control of sample loading. Data are expressed as the mean ± SD for three independent experiments. *P<0.05, **P<0.01 vs. control; #P<0.05, ##P<0.01 vs. mock. (C and D) Cell viability was detected after CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells for 12, 24, 48 and 72 h by CCK-8 assay, respectively. Data are expressed as the mean ± SD for three independent experiments. *P<0.05, **P<0.01 vs. 12 h; #P<0.05, ##P<0.01 vs. 24 h. (E and F) Cell cycle was detected after CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells for 48 h by flow cytometry. Data are expressed as the mean ± SD for three independent experiments. Data are expressed as the mean ± SD for three independent experiments. *P<0.05, **P<0.01 vs. control; #P<0.05, ##P<0.01 vs. mock.

siRNA-CIP2A suppresses the invasion and migration of Hep-2 and AMC-NH-8 cells

Cell motility is an important factor regulating cancer metastasis, consequently, the effect of siRNA-CIP2A on the migration and invasion abilities of Hep-2 and AMC-NH-8 cells were investigated by Transwell assay. Consistently, as presented in Fig. 3, the migration and invasion abilities of Hep-2 cells in siRNA-CIP2A group were significantly decreased compared to that of control and mock groups (Fig. 3Aa and b). Moreover, Fig. 3Ba and b showed that transfection of siRNA-CIP2A resulted in notably weakened migration and invasion abilities of AMC-NH-8 cells. It showed that CIP2A interference inhibits invasion and migration of Hep-2 and AMC-NH-8 cells.

Figure 3.

Change in the invasion and migration on CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells. (Aa and b) Transwell invasion and migration assay of HepG2 cells upon transfection of CIP2A siRNA or mock for 48 h. The HepG2 cells without treatment and the HepG2 cells with transfection of mock were used as controls. (Ba and b) Transwell invasion and migration assay of AMC-NH-8 cells upon transfection of CIP2A siRNA or mock for 48 h. The AMC-NH-82 cells without treatment and the AMC-NH-8 cells with mock transfection were used as controls. Data are expressed as the mean ± SD for three independent experiments. **P<0.01 vs. control; ##P<0.01 vs. mock. Original magnification, ×20.

siRNA-CIP2A regulates the expression of E-cadherin, MTA1 and MMP-2/9 in Hep-2 cells and AMC-NH-8 cells

To elucidate the potential mechanism involved in CIP2A-induced cell invasion and migration, the E-cadherin, MTA1 and MMP-2/9 expressions were assessed by RT-qPCR and western blot analysis. Fig. 4 revealed that the E-cadherin expression was significantly increased and the expression of MTA1 and MMP-2/9 was significantly decreased in siRNA-CIP2A group compared to that of control group and mock group in Hep-2 and AMC-NH-8 cells. It showed that CIP2A interference regulates the expression levels of migration- and invasion-related genes.

Figure 4.

Changes in the expression levels of E-cadherin, MTA1 and MMP-2/−9 on CIP2A siRNA transfection of Hep-2 cells and AMC-NH-8 cells. (A and B) The expression levels of E-cadherin, MTA1 and MMP-2/−9 mRNA were detected in CIP2A siRNA group of Hep-2 cells and AMC-NH-8 cells by RT-qPCR. (C-E) The expression levels of E-cadherin, MTA1 and MMP-2/−9 protein were detected in CIP2A siRNA group of Hep-2 cells and AMC-NH-8 cells by western blot analysis. GAPDH was also detected as the control of sample loading. Data are expressed as the mean ± SD for three independent experiments. *P<0.05, **P<0.01 vs. control; #P<0.05, ##P<0.01 vs. mock.

siRNA-CIP2A blocks PI3K/AKT signaling in Hep-2 cells and AMC-NH-8 cells

After 48 h of CIP2A siRNA treatment, the phosphorylated protein levels of PI3K and AKT in Hep-2 and AMC-NH-8 cells were analyzed by western blot analysis. As shown in Fig. 5, the relative expression levels of p-PI3K/PI3K and p-AKT/AKT were significantly decreased by CIP2A interference. It showed that CIP2A siRNA inhibits the activation of PI3K/AKT signaling in Hep-2 and AMC-NH-8 cells.

Figure 5.

CIP2A siRNA inhibits the activation of PI3K/AKT signaling pathway in Hep-2 cells and AMC-NH-8 cells. (A) The phosphorylation levels of PI3K protein were detected by western blot analysis in CIP2A siRNA group of Hep-2 cells and AMC-NH-8 cells. (B) The phosphorylation levels of AKT protein were detected by western blot analysis in CIP2A siRNA group of Hep-2 cells and AMC-NH-8 cells. GAPDH was also detected as the control of sample loading. Data are expressed as the mean ± SD for three independent experiments. **P<0.01 vs. control; ##P<0.01 vs. mock.

Discussion

CIP2A (also called KIAA1524 or P90) on chromosome 3q13.3, exerts a significant influence on the occurrence and development of tumors (5–7). CIP2A can result in tumorigenesis whereby stabilizing the structure of MYC protein (7,13). Some researchers showed that MYC promotes cell cycle transfer from G0 to G1 phase and its carcinogenic effect may be cell cycle specific (14). In our results, CIP2A was highly expressed in laryngeal cancer tissues and cells and was associated with poor survival of laryngeal cancer patients. Besides, the high expression of CIP2A was positively associated with TNM staging. CIP2A interference significantly reduced cell viability. Flow cytometric analysis revealed that Hep-2 and AMC-NH-8 cells of siRNA-CIP2A group were arrested in G0/G1 phase (Figs. 1 and 2, and Table I). Therefore, CIP2A can act as an oncogene and is involved in the occurrence and development of tumors such as laryngeal carcinoma. To further clarify the molecular mechanism of its function in the metastatic process of laryngeal carcinoma, we observed the impact of CIP2A expression with invasion ability and migration ability of Hep-2 cells and AMC-NH-8 cells and the expression levels of related proteins.

Tumor metastasis is a key factor influencing the prognosis of laryngeal carcinoma (15). It has been reported that CIP2A is associated with the staging and grading of tumors, metastasis of lymph nodes, the differentiation degree of tissues and the prognosis of patients (16). Our research revealed that the interference of CIP2A significant depressed the invasion and migration of Hep-2 and AMC-NH-8 cells (Fig. 3). The mechanisms which might be involved in the invasion and metastasis of tumors are numerous and need to be further investigated. There are three steps in invasion and metastasis of malignant tumors: adhesion, enzymolysis and movement. Enzymolysis is an essential prerequistite of crossing intercellular substance and the basement membranes of microvessel and lymph vessel in the invasive process (17). Matrix metalloproteinase (MMPs) is the most important hydrolytic enzyme in enzymolysis process. Among the MMPs, MMP-2 and MMP-9, are known as the key enzymes in the degradation of extracellular matrix (ECM) and the basement membrane (BM) (14). MTA1 was the first gene found in the family of metastasis-associated genes, and its overexpression has close relationships with invasion and metastasis (18). E-cadherin can maintain the integrality and polarity of the shape and structure in cell, and its mutation and loss is a pivotal molecular event during the process of cancer development and metastasis (19). Taken together, this evidence confirmed that E-cadherin, MTA1 and MMP-2/9 play important role in the invasive and metastatic process of tumors. Therefore, we detected the expression of E-cadherin, MTA1 and MMP-2/9 by RT-qPCR and western blot assay. E-cadherin expression was increased and expression of MTA1 and MMP-2/9 was decreased in siRNA-CIP2A group, compared with control group and mock group (Fig. 4). It showed that the CIP2A interference significantly regulated the expression levels of invasion- and metastatic-related genes including E-cadherin, MTA1 and MMP-2/9.

Studies have found that bortezomid inhibited PP2A-dependent Akt activity via suppressing the activity of CIP2A, and the CIP2A significantly regulated the phosphorylation level of Akt (20,21). PI3K/Akt signaling pathway is closely correlated with tumor cell growth, proliferation, invasion and migration. PI3K, as a key signaling molecule, plays important roles in the regulation of diverse cellular processes of cancer. In addition, the phosphorylation level of Akt was much higher during the activation of PI3K/Akt pathway (22–25). The activation of PI3K results in a second messenger to be generated that causes the activation of Akt, and then the activation of Akt starts a series of changes, such as decreased cell adhesion ability, change of morphology, the increased cell invasion and migration (26,27). In our results, the phosphorylation levels of PI3K and Akt in siRNA-CIP2A group cells were significantly decreased compared to that of control group and mock (Fig. 5). It showed that siRNA CIP2A suppressed the activation of PI3K/Akt signaling pathway.

Based on the above results, the CIP2A interference can impact the cell viability, abilities of cell invasion and migration, the expression levels of invasion- and metastatic-related genes and the activation levels of invasion- and metastatic-related signaling pathway. Therefore, comprehensively, it suggested that signaling through PI3K/Akt is a critical mechanism by which CIP2A siRNA may suppress cell proliferation, invasion and migration in laryngeal carcinoma cells.

References

1 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Xia CX, Zhu Q, Zhao HX, Yan F, Li SL and Zhang SM: Usefulness of ultrasonography in assessment of laryngeal carcinoma. Br J Radiol. 86:201303432013. View Article : Google Scholar : PubMed/NCBI

3 

Guadagnolo BA, Haddad RI, Posner MR, Weeks L, Wirth LJ, Norris CM, Sullivan CA, Goguen L, Busse PM and Tishler R: Organ preservation and treatment toxicity with induction chemotherapy followed by radiation therapy or chemoradiation for advanced laryngeal cancer. Am J Clin Oncol. 28:371–378. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Licitra L, Bernier J, Grandi C, Locati L, Merlano M, Gatta G and Lefebvre JL: Cancer of the larynx. Crit Rev Oncol Hematol. 47:65–80. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Ventelä S, Côme C, Mäkelä JA, Hobbs RM, Mannermaa L, Kallajoki M, Chan EK, Pandolfi PP, Toppari J and Westermarck J: CIP2A promotes proliferation of spermatogonial progenitor cells and spermatogenesis in mice. PLoS One. 7:e332092012. View Article : Google Scholar : PubMed/NCBI

6 

Junttila MR, Puustinen P, Niemelä M, Ahola R, Arnold H, Böttzauw T, Ala-aho R, Nielsen C, Ivaska J, Taya Y, et al: CIP2A inhibits PP2A in human malignancies. Cell. 130:51–62. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Ma L, Wen ZS, Liu Z, Hu Z, Ma J, Chen XQ, Liu YQ, Pu JX, Xiao WL, Sun HD, et al: Overexpression and small molecule-triggered downregulation of CIP2A in lung cancer. PLoS One. 6:e201592011. View Article : Google Scholar : PubMed/NCBI

8 

Gregory MA, Qi Y and Hann SR: Phosphorylation by glycogen synthase kinase-3 controls c-myc proteolysis and subnuclear localization. J Biol Chem. 278:51606–51612. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Sears R, Nuckolls F, Haura E, Taya Y, Tamai K and Nevins JR: Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev. 14:2501–2514. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Böckelman C, Lassus H, Hemmes A, Leminen A, Westermarck J, Haglund C, Bützow R and Ristimäki A: Prognostic role of CIP2A expression in serous ovarian cancer. Br J Cancer. 105:989–995. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Khanna A, Böckelman C, Hemmes A, Junttila MR, Wiksten JP, Lundin M, Junnila S, Murphy DJ, Evan GI, Haglund C, et al: MYC-dependent regulation and prognostic role of CIP2A in gastric cancer. J Natl Cancer Inst. 101:793–805. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Wang L, Gu F, Ma N, Zhang L, Bian JM and Cao HY: CIP2A expression is associated with altered expression of epithelial-mesenchymal transition markers and predictive of poor prognosis in pancreatic ductal adenocarcinoma. Tumour Biol. 34:2309–2313. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Khanna A, Okkeri J, Bilgen T, Tiirikka T, Vihinen M, Visakorpi T and Westermarck J: ETS1 mediates MEK1/2-dependent overexpression of cancerous inhibitor of protein phosphatase 2A (CIP2A) in human cancer cells. PLoS One. 6:e179792011. View Article : Google Scholar : PubMed/NCBI

14 

Lai WC, Zhou M, Shankavaram U, Peng G and Wahl LM: Differential regulation of lipopolysaccharide-induced monocyte matrix metalloproteinase (MMP)-1 and MMP-9 by p38 and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinases. J Immunol. 170:6244–6249. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Pradier R, González A, Matos E, Loria D, Adan R, Saco P and Califano L: Prognostic factors in laryngeal carcinoma. Experience in 296 male patients. Cancer. 71:2472–2476. 1993. View Article : Google Scholar : PubMed/NCBI

16 

Teng HW, Yang SH, Lin JK, Chen WS, Lin TC, Jiang JK, Yen CC, Li AF, Chen PC, Lan YT, et al: CIP2A is a predictor of poor prognosis in colon cancer. J Gastrointest Surg. 16:1037–1047. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Liotta LA, Steeg PS and Stetler-Stevenson WG: Cancer metastasis and angiogenesis: An imbalance of positive and negative regulation. Cell. 64:327–336. 1991. View Article : Google Scholar : PubMed/NCBI

18 

Pencil SD, Toh Y and Nicolson GL: Candidate metastasis-associated genes of the rat 13762NF mammary adenocarcinoma. Breast Cancer Res Treat. 25:165–174. 1993. View Article : Google Scholar : PubMed/NCBI

19 

Kuphal S and Bosserhoff AK: Influence of the cytoplasmic domain of E-cadherin on endogenous N-cadherin expression in malignant melanoma. Oncogene. 25:248–259. 2006.PubMed/NCBI

20 

Huang CY, Wei CC, Chen KC, Chen HJ, Cheng AL and Chen KF: Bortezomib enhances radiation-induced apoptosis in solid tumors by inhibiting CIP2A. Cancer Lett. 317:9–15. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Tseng LM, Liu CY, Chang KC, Chu PY, Shiau CW and Chen KF: CIP2A is a target of bortezomib in human triple negative breast cancer cells. Breast Cancer Res. 14:R682012. View Article : Google Scholar : PubMed/NCBI

22 

Blanco-Aparicio C, Renner O, Leal JF and Carnero A: PTEN, more than the AKT pathway. Carcinogenesis. 28:1379–1386. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Cantley LC: The phosphoinositide 3-kinase pathway. Science. 296:1655–1657. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Chandrasekher G and Sailaja D: Differential activation of phosphatidylinositol 3-kinase signaling during proliferation and differentiation of lens epithelial cells. Invest Ophthalmol Vis Sci. 44:4400–4411. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Jiang Q, Zhou C, Bi Z and Wan Y: EGF-induced cell migration is mediated by ERK and PI3K/AKT pathways in cultured human lens epithelial cells. J Ocul Pharmacol Ther. 22:93–102. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Tsuji T, Ibaragi S, Shima K, Hu MG, Katsurano M, Sasaki A and Hu GF: Epithelial-mesenchymal transition induced by growth suppressor p12CDK2-AP1 promotes tumor cell local invasion but suppresses distant colony growth. Cancer Res. 68:10377–10386. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Watanabe N, Madaule P, Reid T, Ishizaki T, Watanabe G, Kakizuka A, Saito Y, Nakao K, Jockusch BM and Narumiya S: p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein for Rho small GTPase and is a ligand for profilin. EMBO J. 16:3044–3056. 1997. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen X, Tang S, Zhang J, Zhang L and Wang Y: CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875. Oncol Rep 38: 1005-1012, 2017.
APA
Chen, X., Tang, S., Zhang, J., Zhang, L., & Wang, Y. (2017). CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875. Oncology Reports, 38, 1005-1012. https://doi.org/10.3892/or.2017.5759
MLA
Chen, X., Tang, S., Zhang, J., Zhang, L., Wang, Y."CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875". Oncology Reports 38.2 (2017): 1005-1012.
Chicago
Chen, X., Tang, S., Zhang, J., Zhang, L., Wang, Y."CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875". Oncology Reports 38, no. 2 (2017): 1005-1012. https://doi.org/10.3892/or.2017.5759
Copy and paste a formatted citation
x
Spandidos Publications style
Chen X, Tang S, Zhang J, Zhang L and Wang Y: CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875. Oncol Rep 38: 1005-1012, 2017.
APA
Chen, X., Tang, S., Zhang, J., Zhang, L., & Wang, Y. (2017). CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875. Oncology Reports, 38, 1005-1012. https://doi.org/10.3892/or.2017.5759
MLA
Chen, X., Tang, S., Zhang, J., Zhang, L., Wang, Y."CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875". Oncology Reports 38.2 (2017): 1005-1012.
Chicago
Chen, X., Tang, S., Zhang, J., Zhang, L., Wang, Y."CIP2A, an oncoprotein, is associated with cell proliferation, invasion and migration in laryngeal carcinoma cells Retraction in /10.3892/or.2025.8875". Oncology Reports 38, no. 2 (2017): 1005-1012. https://doi.org/10.3892/or.2017.5759
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team