International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Pancreatic neoplasms are highly malignant tumors and a major cause of cancer-related mortality worldwide (1). The majority of pancreatic carcinomas are pancreatic ductal adenocarcinomas (PDACs). In recent years, the 5-year survival rate of PDAC patients has not significantly improved, and remains at ~6% (2). The prognosis of PDAC is extremely poor, which is mostly ascribed to the fast growth, high migration, invasiveness and recurrence rates (3). To improve the efficiency of pancreatic cancer treatment, researchers must aim to understand the mechanisms underlying the migration, invasion and apoptosis of PDAC.
Ubiquitin specific peptidase 9, X-linked (USP9X), a deubiquitination enzyme, is a multifunctional post-translational modifier that regulates many aspects of cell physiology (4,5), such as DNA repair, and regulation of cell cycle and several signaling pathways. USP9X expression constantly changes in tumor progression (6,7). Abnormal USP9X expression has been confirmed in several neoplasms, including lymphoma (8), colorectal cancer (9) and hepatocellular carcinoma (10). However, whether USP9X acts as a proto-oncogene or tumor-suppressor gene in pancreatic cancer cells is still controversial. Cox et al reported that USP9X possesses growth promotor functions in several established pancreatic cell lines (11), while Pérez-Mancera et al states that USP9X acts as a tumor-suppressor gene at the early stage of PDAC formation in mice (12). Thus, the concrete mechanism remains unclear as to how USP9X regulates PDAC development. In the present study, we discussed the effect of USP9X on epithelial-mesenchymal transition (EMT) in PANC-1 cells, aiming to understand its effect on cell migration and invasion. In terms of apoptosis, we observed the effect of USP9X downregulation on survivin expression.
EMT is a bio-process in which epithelial cells are transformed via specific procedures into a mesenchymal phenotype, and it is the molecular basis underlying the occurrence, invasion and metastasis of tumors (13). EMT plays an important role in the metastasis and invasion of neoplasms (14). It has been confirmed that EMT can be promoted by Snail and Twist genes, which induce the migration and invasion of tumor cells (15,16). However, the specific connection between USP9X and EMT in PDAC and the effect of USP9X on PDAC remain poorly understood.
Survivin, which is highly inhibitory against cell apoptosis, was first identified at Altieri Laboratory of Yale University in 1997 by screening a human genomic library using effector cell protease receptor-1 (17). The bio-functions of survivin mainly involve the regulation of the cell cycle and stress response, mitosis promotion, cell and vascular proliferation, apoptosis inhibition and cancer cell autophagy regulation (18). However, high survivin expression has been detected in several tumors (19). Liu et al found that survivin is degraded by the ubiquitin proteasome pathway (20). Yet, the relationship between survivin and USP9X in pancreatic cancer is also unknown.
In the present study, we demonstrated that USP9X acts as a tumor metastasis supporter in PANC-1 cells, and downregulation of USP9X expression inhibited the migration and invasion of PANC-1 cells, while high expression of USP9X inhibited the apoptosis of PANC-1 cells. Therefore, USP9X functioned as an oncogene in PANC-1 cells and is closely related with the expression of Snail, Twist and survivin.
Tumor and paired adjacent non-tumor tissues for immunohistochemical (IHC) analysis were obtained from 55 patients with malignant pancreatic tumors, who underwent surgical resection at The Affiliated Hospital of Xuzhou Medical University between 2009 and 2012 (Table I). None of the patients received chemotherapy or radiotherapy before surgery. Written informed consent was received from all patients or relevant family members. The present study was approved by the Ethics Committee of The Affiliated Hospital of Xuzhou Medical University.
PANC-1, a human pancreatic cancer cell line, was provided by Professor Changqing Su (Shanghai Oriental Hepatic Hospital of China). The cells were first cultured in Dulbecco's modified Eagles medium (DMEM) containing 10% fetal bovine serum (FBS) (both from HyClone, Shanghai, China), 100 µg/ml streptomycin and 100 U/ml penicillin. Then, the cells were routinely incubated in a humidified atmosphere at 37°C in 5% CO2. The medium was refreshed every two days. Cell digestion and passage were conducted using 0.25% trypsin.
Paraffin-embedded specimens were stained according to the kit manual. The primary antibody was anti-USP9X [1:1,000; Cell Signaling Technology (CST), Beverly, MA, USA]. In the IHC analysis, the staining intensity was rated as follows: 0, 1, 2 and 3 points: negative, weak, moderate and strong intensity, respectively (21). The percentage of positively-stained cells was rated as follows: 0, 1, 2, 3 and 4 points: 0, 1–10, 11–50, 51–80 and >80%, respectively. Then, the total score of immunoreactivity for each case was determined by multiplying the two sub-scores above. The average score from all five random fields at a magnification of ×400 was used as the histological score. Tumors were categorized by the histological score into a negative group (≤4) and a positive group (>4). The results were analyzed using Chi-square test.
USP9X-treated cells were plated into 6-well plates (3.0×105 cells/well), for 24 h of adherence, and then transfected with shRNA (GenePharma, Shanghai, China; shRNA group) using SiLenFect (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The sequence of shRNA was: GCTGCT AGGTTCCTCTTTCAAGAGAAGTAAAGAGGAACCTAG CAGCTT. In the vector group, the cells were transfected with NC-shRNA in the same way following the manufacturer's instructions. After 24 h, the media were refreshed. After 48 h, the cells were harvested for subsequent experiments.
For the wound-healing assays, PANC-1 cells transfected according to the above-mentioned method were seeded in 6-well plates at a density of 2×106/well. After 24 h, the monolayers were scratched with a sterile pipette tip, followed by addition of serum-free medium. The sizes of the wounds were photographed at 0, 12, and 24 h separately. Each experiment was performed in triplicate.
The cultured PANC-1 cells were lysed by a modified radio-immunoprecipitation assay (RIPA) buffer (Shanghai, China) containing 0.5 M pheylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete Mini; Mannheim, Germany). Then, the homogenates were lysed on ice for 30 min. The lysates were centrifuged at 4°C for 15 min and the supernatants were extracted. Total proteins were quantified with a bicinchoninic acid (BCA) protein assay kit (Pierce, Thermo Fisher Scientific, Inc., Waltham, MA, USA). For western blotting, protein samples (50 µg) were loaded onto 8 or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and were then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). Then, the membranes were blocked with 5% non-fat milk at room temperature for 1 h, and incubated with primary antibodies overnight at 4°C, including anti-USP9X (1:1,000; CST), anti-survivin (1:200; Bioworld Technology, Nanjing, China), anti-Twist (1:1,000), anti-Snail (1:1,000), anti-N-cadherin (1:1,000), anti-vimentin (1:1,500), anti-E-cadherin (1:1,500) (all from ABclonal Inc., Cambridge, MA, USA) and anti-β-actin (1:1,000; Bioworld Technology). One day later, the membranes were washed with Tris-buffered saline and 0.05% Tween-20 (TBST), and then incubated with anti-rabbit or anti-mouse secondary antibody at room temperature for 1 h. The intensities of the protein bands were assessed using ImageJ [National Institutes of Health (NIH), Bethesda, MD, USA].
The migration and invasion abilities of PANC-1 cells were assessed by cell migration and Matrigel invasion assays, respectively. After 24 h of transfection, the cells were suspended with serum-free medium and counted. In the assays, we furnished the invasion/migration chambers with 6.5-mm diameter tissue culture inserts and 8.0-µm pore size polycarbonate membranes (Transwell; Corning, Corning, NY, USA USA). For invasion assays, Matrigel (1:6; BD Biosciences, Bedford, MA, USA) was blended with serum-free DMEM, and 50 µl of the mixture was added into the chamber. The chambers were set into 24-well tissue culture plates, and then put in a sterile ultra-clean bench overnight. On the next day, after the Matrigel was solidified, 5.0×104 PANC-1 cells were added to the upper chamber. The total volume was 200 µl, with adequate addition of the serum-free medium. For the migration assays, the operation method was the same as the invasion assays, except for the addition of Matrigel. In both trials, the lower chamber was filled with 600 µl of 20% FBS. After 24 h of incubation at 37°C with 5% CO2, 90% paraformaldehyde was used to fix the cells invading the lower surfaces of the polycarbonate membranes. Then, the cells were stained with crystal violet and counted under a microscope. The cells were washed with phosphate-buffered saline (PBS) two times. Then, the water on the surfaces was gently wiped off and five views were taken for each insert.
Cell apoptosis was detected by flow cytometry via a double staining method using an Annexin V-fluorescein isothiocyanate (FITC)-conjugated propidium iodide (PI) apoptosis kit (KeyGen Biotech. Co, Ltd., Nanjing, China). We performed the apoptosis assay after 48 h of transfection. PANC-1 cells were inoculated in 6-well plates at a density of 3×105 cells/well. When the cells covered ~50% of the 6-well plates, the 6-well plates were divided into a normal control (NC group), a negative control (vector group) and a shRNA-transfected group (shRNA group; transfected similarly as the above method). After 48 h, the cells in the three groups were digested with 0.25% trypsin without ethylenediamine tetraacetic acid (EDTA; Invitrogen, Carlsbad, CA, USA). Then, the cells were washed with PBS for two times, (each 5 min) and centrifuged at a speed of 5,000 rpm for 5 min. Next, the cells were resuspended in 500 µl of binding buffer and stained with 5 µl Annexin V-FITC and 5 µl of PI, for 15 to 20 min of reaction in a darkroom. Finally, the three groups of cells were stained, counted and analyzed using a flow cytometer (FACSCalibur; BD Biosciences).
Cells which were transfected for 48 h were plated in 96-well plates with 5×103 cells/well. Six repetitive wells were prepared for each group. Control wells were created adding the same volume of culture medium. After 6, 24, 48, 72 and 96 h of incubation, the cells were then treated with 10 µl Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan) for another 2 h in an incubator at 37°C. An automated microplate reader (Sunrise, Tecan, Switzerland) was applied to assess the OD values for each well at 450 nm.
Data are expressed as mean ± standard deviation (SD). Differences between groups were examined by Student's t-test or one-way analysis of variance (ANOVA). P<0.05 and P<0.01 were considered to indicate statistically significant results. All statistical analyses were performed using SPSS (version 13.0; SPSS, Inc., Chicago, IL, USA) and GraphPad Prism (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA).
IHC analysis revealed that USP9X expression was upregulated in 32 of 55 tumor tissues compared to the adjacent non-tumor tissues (Fig. 1A-C and Table I). Moreover, high expression of USP9X was markedly associated with stage, grade and lymph node metastasis (all P<0.05) (Table I). The results imply that USP9X is positively correlated with the degree of tumor malignancy and may be closely related with pathophysiological progression of PDAC.
First, we confirmed the alteration of the expression of USP9X. Thus, four shRNA sequences (purchased from GenePharma Co.) directed against USP9X were evaluated. As a control, an empty plasmid vector was transduced into PANC-1 cells. After 48 h, the USP9X expression in PANC-1 cells was detected via western blotting. After filtration, we chose one group of plasmids with the best effect. The USP9X expression was significantly downregulated (P<0.01) (Fig. 2A and B).
The functional effects of USP9X on pancreatic cancer cell migration and invasion abilities were examined via Transwell and wound healing assays. The suppression of USP9X expression significantly inhibited cell migration (Fig. 3A) and invasion ability (Fig. 3B). Next, we monitored the wound healing assays and similar results were found. The migration ability of the PANC-1 cells was significantly decreased when USP9X was suppressed (Fig. 3C).
To explore the effects of USP9X on the EMT of PANC-1 cells, we examined the expression levels of mesenchymal cell markers (N-cadherin and vimentin) and epithelial cell marker (E-cadherin) by western blotting. The results showed that the downregulation of USP9X expression significantly reduced the expression of N-cadherin and vimentin compared with these levels in the control groups (P<0.05; Fig. 4A and B). In contrast, the E-cadherin expression was increased (P<0.05; Fig. 4A and B).
To further confirm the effect of USP9X on the EMT of PANC-1 cells, we determined the expression levels of Snail and Twist, two upstream target proteins of N-cadherin, vimentin and E-cadherin by western blotting. The results revealed that expression of both proteins was significantly decreased (P<0.05; Fig. 4C and D), suggesting that USP9X may be involved in regulating the migration and invasion of PANC-1 cells. As Snail and Twist were activated in pancreatic cancer cells, USP9X may be highly associated with disease progression by regulating the expression of downstream target proteins, including N-cadherin, vimentin and E-cadherin.
The effect of USP9X on cell apoptosis was detected using flow cytometry. After the given plasmid was transfected into PANC-1 cells for 48 h, shRNA-USP9X effectively inhibited USP9X expression compared with that noted in the control groups (Fig. 1). Then, the cells were stained with Annexin V-FITC/PI for assaying cell apoptosis. The apoptotic rate of PANC-1 cells increased after inhibition of USP9X expression in comparison with the uninduced counterparts (Fig. 5A and B), indicating that depletion of USP9X induced the apoptosis of PANC-1 cells. To confirm the effects of USP9X on the protein expression of survivin in PANC-1 cells, we measured survivin by western blotting. The results indicated that survivin expression in PANC-1 cells was markedly reduced compared with that noted in the control groups (P<0.05, Fig. 5C and D).
As revealed by the CCK-8 assay, depletion of USP9X in PANC-1 cells resulted in decreased cell viability compared to the cell viability of another two groups of cells (P<0.05; Fig. 6).
Pancreatic neoplasms are highly malignant tumors, and the prognosis of patients with PDAC is extremely poor, which is mostly ascribed to the high migration, invasiveness and high recurrence rate (22). Due to the broad range of its targets, the roles of USP9X are various and rely on different environments (8,9,12,23,24). Abnormal expression of USP9X in several types of cancers has been reported (8,11,23,24). Particularly, whether PDAC USP9X acts as a proto-oncogene or tumor-suppressor gene remains controversial (11), and the concrete effects of USP9X on migration, invasion and apoptosis of PDAC are still poorly understood.
Our experimental data support the role of USP9X as a growth promoter in tumor genesis and progression. As shown in Fig. 1A and B, the USP9X expression in human pancreatic cancer tissues was markedly increased compared with that noted in the adjacent non-tumor tissues. We believe that USP9X is positively correlated with the degree of tumor malignancy and may be closely related with pathophysiological progression of PDAC (Table I). Notably, downregulation of USP9X expression reduced the invasion and migration abilities of the PANC-1 cells (Fig. 3A-C). Depletion of USP9X reversed the EMT of PANC-1 cells, which is reflected in the changes of N-cadherin, vimentin and E-cadherin expression. Moreover, cell apoptosis was increased after the downregulation of USP9X (Fig. 5A and B). The survivin expression was positively correlated with the USP9X level. Furthermore, inhibition of USP9X expression effectively decreased the viability of the PANC-1 cells (Fig. 6).
Notably, Cox et al demonstrated that USP9X acted principally as an oncogene in five tested PDAC cell lines (11). However, Pérez-Mancera et al found that USP9X acted as a tumor-suppressor in a mouse model of pancreatic malignant tumors in which the USP9X expression was interfered at the early stage of tumor development by Sleeping Beauty transposon (12). In the present study, we believe that USP9X may be an oncogene in PANC-1 cells. Our results are similar to those of Cox et al. We suggest that downregulation of USP9X can inhibit the migration and invasion of pancreatic cancer PANC-1 cells and lead to a decrease in cell viability. The apoptosis rate of the PANC-1 cells was increased with the decrease in USP9X expression. The migratory ability of PANC-1 cells was weakened after downregulation of the expression of USP9X (Fig. 3A). We also found that our results differed from those of Perez-Mancera et al. The difference may be due to the pathological type of pancreatic cancer, the location of the pancreatic tumor or the difference in race. However, the specific reasons remain unclear and further research is needed.
Furthermore, we studied the specific proteins related to the migration and invasion functions of USP9X. We found that cell migration and invasion abilities were suppressed (Fig. 3A-C). Moreover, it is very possible that USP9X may affect the migration and invasion of PANC-1 cells by EMT. EMT is the process in which epithelial cells are transformed by specific procedures into a mesenchymal phenotype. Epithelial cells undergoing EMT lose polarity and some properties such as their connection to the basement membrane, which is an important process of tumor invasion and metastasis (3). It has also been confirmed that EMT is the molecular basis underlying the occurrence, invasion and metastasis of many tumors (25,26). Furthermore, we examined the expression levels of N-cadherin, vimentin and E-cadherin in PANC-1 cells by western blotting. However, the E-cadherin expression was significantly upregulated, while the expression of N-cadherin and vimentin was downregulated in PANC-1 cells. This finding is consistent with other studies (27–29). We also tested Snail and Twist, which are the upstream target proteins of N-cadherin, vimentin and E-cadherin. Twist belongs to the bHLH transcription factor family and plays an important role in tumor metastasis (15). Snail, a zinc finger transcription factor is combined with the promoter of the gene expression related to cell adhesion, and opens to regulate the transcription process (16). We found that the expression levels of both proteins were significantly downregulated (Fig. 4C and D). These results are consistent with previous research (13,14,30). We conclude that USP9X is highly linked with disease formation and progression by activating EMT.
Moreover, we studied PANC-1 cell apoptosis after the expression of USP9X was silenced. The apoptotic rate of PANC-1 cells increased after the inhibition of USP9X expression compared with the uninduced groups (Fig. 5A and B). As reported, survivin is degraded by the ubiquitin proteasome pathway (20). Theoretically, downregulated expression of survivin can cause cell apoptosis. Thus, we detected the expression of survivin, which is the strongest apoptosis inhibitor (15). Survivin may inhibit apoptosis mainly by the following two ways: one way by directly inhibiting the activities of caspase-3 and −7, the end effectors of apoptosis protein, and another way by interacting with CDK-2 and CDK-4 and blocking the apoptotic signal transduction pathway (31). In PDAC, survivin is involved in many biological processes, such as gene transcription regulation, cell differentiation, tumor formation and metastasis (32,33). We also found that the survivin expression in PANC-1 cells was markedly reduced after the inhibition of USP9X. The change in survivin expression was positively proportional to USP9X, but the concrete mechanism between them is still unclear and needs further study.
Taken together, USP9X participates in a variety of biological processes in pancreatic cancer cells. In the present study, we first demonstrated that USP9X activated the EMT pathway and altered cell migration and invasion abilities. We then explored the close relationship between USP9X and survivin in pancreatic cancer. Future studies are needed to reveal the specific mechanisms between Snail/Twist and USP9X, and between survivin and USP9X. Our findings may provide a novel strategy for the treatment of pancreatic cancer. Early inhibition of USP9X may delay the invasion and metastasis of PDAC, which makes it possible to improve the clinical outcomes of PDAC patients. However, our findings are not fully consistent with previous experts, thus deeper investigation is required to elucidate the significant role of USP9X in PDAC.
|
Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Hidalgo M: Pancreatic cancer. N Engl J Med. 362:1605–1617. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Bonnomet A, Brysse A, Tachsidis A, Waltham M, Thompson EW, Polette M and Gilles C: Epithelial-to-mesenchymal transitions and circulating tumor cells. J Mammary Gland Biol Neoplasia. 15:261–273. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kapuria V, Peterson LF, Fang D, Bornmann WG, Talpaz M and Donato NJ: Deubiquitinase inhibition by small-molecule WP1130 triggers aggresome formation and tumor cell apoptosis. Cancer Res. 70:9265–9276. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kerscher O, Felberbaum R and Hochstrasser M: Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu Rev Cell Dev Biol. 22:159–180. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Hussain S, Zhang Y and Galardy PJ: DUBs and cancer: The role of deubiquitinating enzymes as oncogenes, non-oncogenes and tumor suppressors. Cell Cycle. 8:1688–1697. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Reyes-Turcu FE, Ventii KH and Wilkinson KD: Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes. Annu Rev Biochem. 78:363–397. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Schwickart M, Huang X, Lill JR, Liu J, Ferrando R, French DM, Maecker H, O'Rourke K, Bazan F, Eastham-Anderson J, et al: Deubiquitinase USP9X stabilizes MCL1 and promotes tumour cell survival. Nature. 463:103–107. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Harris DR, Mims A and Bunz F: Genetic disruption of USP9X sensitizes colorectal cancer cells to 5-fluorouracil. Cancer Biol Ther. 13:1319–1324. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Liu H, Chen W, Liang C, Chen BW, Zhi X, Zhang S, Zheng X, Bai X and Liang T: WP1130 increases doxorubicin sensitivity in hepatocellular carcinoma cells through usp9×-dependent p53 degradation. Cancer Lett. 361:218–225. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Cox JL, Wilder PJ, Wuebben EL, Ouellette MM, Hollingsworth MA and Rizzino A: Context-dependent function of the deubiquitinating enzyme USP9X in pancreatic ductal adenocarcinoma. Cancer Biol Ther. 15:1042–1052. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Pérez-Mancera PA, Rust AG, van der Weyden L, Kristiansen G, Li A, Sarver AL, Silverstein KA, Grützmann R, Aust D, Rümmele P, et al: Australian Pancreatic Cancer Genome Initiative: The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma. Nature. 486:266–270. 2012.PubMed/NCBI | |
|
De Craene B and Berx G: Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer. 13:97–110. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yang J and Weinberg RA: Epithelial-mesenchymal transition: At the crossroads of development and tumor metastasis. Dev Cell. 14:818–829. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Khan MA, Chen HC, Zhang D and Fu J: Twist: A molecular target in cancer therapeutics. Tumour Biol. 34:2497–2506. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Smith BN and Odero-Marah VA: The role of Snail in prostate cancer. Cell Adhes Migr. 6:433–441. 2012. View Article : Google Scholar | |
|
Ambrosini G, Adida C and Altieri DC: A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 3:917–921. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Roca H, Varsos ZS, Mizutani K and Pienta KJ: CCL2, survivin and autophagy: New links with implications in human cancer. Autophagy. 4:969–971. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Farnebo L, Tiefenböck K, Ansell A, Thunell LK, Garvin S and Roberg K: Strong expression of survivin is associated with positive response to radiotherapy and improved overall survival in head and neck squamous cell carcinoma patients. Int J Cancer. 133:1994–2003. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Liu YB, Gao X, Deeb D, Brigolin C, Zhang Y, Shaw J, Pindolia K and Gautam SC: Ubiquitin-proteasomal degradation of antiapoptotic survivin facilitates induction of apoptosis in prostate cancer cells by pristimerin. Int J Oncol. 45:1735–1741. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Peng J, Hu Q, Liu W, He X, Cui L, Chen X, Yang M, Liu H, Wei W, Liu S, et al: USP9X expression correlates with tumor progression and poor prognosis in esophageal squamous cell carcinoma. Diagn Pathol. 8:177–185. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Ahmad R: Cheema, Eileen M. O'Reilly. Management of metastatic pancreatic adenocarcinoma. Surg Clin North Am. 7:1391–1414. 2016. | |
|
Murtaza M, Jolly LA, Gecz J and Wood SA: La FAM fatale: USP9X in development and disease. Cell Mol Life Sci. 72:2075–2089. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wang Y, Liu Y, Yang B, Cao H, Yang CX, Ouyang W, Zhang SM, Yang GF, Zhou FX, Zhou YF, et al: Elevated expression of USP9X correlates with poor prognosis in human non-small cell lung cancer. J Thorac Dis. 7:672–679. 2015.PubMed/NCBI | |
|
Vermeulen L, Todaro M, de Sousa Mello F, Sprick MR, Kemper K, Alea Perez M, Richel DJ, Stassi G and Medema JP: Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci USA. 105:13427–13432. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Findlay VJ, Wang C, Watson DK and Camp ER: Epithelial-to-mesenchymal transition and the cancer stem cell phenotype: Insights from cancer biology with therapeutic implications for colorectal cancer. Cancer Gene Ther. 21:181–187. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
von Burstin J, Eser S, Paul MC, Seidler B, Brandl M, Messer M, von Werder A, Schmidt A, Mages J, Pagel P, et al: E-cadherin regulates metastasis of pancreatic cancer in vivo and is suppressed by a SNAIL/HDAC1/HDAC2 repressor complex. Gastroentemlogy. 137:361–371. 2009. View Article : Google Scholar | |
|
Lang SH, Hyde C, Reid IN, Hitchcock IS, Hart CA, Bryden AA, Villette JM, Stower MJ and Maitland NJ: Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and metastatic prostate carcinoma. Prostate. 52:253–263. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Lee MY, Chou CY, Tang MJ and Shen MR: Epithelial-mesenchymal transition in cervical cancer: Correlation with tumor progression, epidermal growth factor receptor overexpression, and snail up-regulation. Clin Cancer Res. 14:4743–4750. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Francí C, Takkunen M, Dave N, Alameda F, Gómez S, Rodríguez R, Escrivà M, Montserrat-Sentís B, Baró T, Garrido M, et al: Expression of Snail protein in tumor-stroma interface. Oncogene. 25:5134–5144. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Xu JH, Wang AX, Huang HZ, Wang JG, Pan CB and Zhang B: Survivin shRNA induces caspase-3-dependent apoptosis and enhances cisplatin sensitivity in squamous cell carcinoma of the tongue. Oncol Res. 18:377–385. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Lopes RB, Gangeswaran R, McNeish IA, Wang Y and Lemoine NR: Expression of the IAP protein family is dysregulated in pancreatic cancer cells and is important for resistance to chemotherapy. Int J Cancer. 120:2344–2352. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Jhala N, Jhala D, Vickers SM, Eltoum I, Batra SK, Manne U, Eloubeidi M, Jones JJ and Grizzle WE: Biomarkers in diagnosis of pancreatic carcinoma in fine-needle aspirates. Am J Clin Pathol. 126:572–579. 2006. View Article : Google Scholar : PubMed/NCBI |