Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April-2018 Volume 39 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 39 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target

  • Authors:
    • Satoshi Owada
    • Hitoshi Endo
    • Yukari Shida
    • Chisa Okada
    • Kanako Ito
    • Takahiro Nezu
    • Masayuki Tatemichi
  • View Affiliations / Copyright

    Affiliations: Center for Molecular Prevention and Environmental Medicine, Department of Preventive Medicine, Tokai University School of Medicine, Isehara, Kanagawa 259‑1193, Japan, Support Center for Medical Research and Education, Tokai University, Isehara, Kanagawa 259‑1193, Japan
  • Pages: 1805-1812
    |
    Published online on: February 23, 2018
       https://doi.org/10.3892/or.2018.6279
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hepatocellular carcinoma has extremely poor prognosis. In cancerous liver tissues, aberrant proliferation of cancer cells leads to the creation of an area where an immature vascular network is formed. Since oxygen is supplied to cancer tissues through the bloodstream, a part of the tumor is exposed to hypoxic conditions. As hypoxia is known to severely reduce the effectiveness of existing anticancer agents, novel valid therapeutic targets must be identified for the treatment of hepatocellular carcinoma. Generally, autophagy has been reported to play an important role in the adaptation of cancer cells to hypoxia. However, the exact role and significance of this process vary depending on the cancer type, requiring detailed analysis in individual primary tumors and cell lines. In the present study, we examined autophagy induced by cobalt chloride, a hypoxia‑mimicking agent, in hepatocellular carcinoma cells with the aim to evaluate the validity of this process as a potential therapeutic target. We observed that treatment with cobalt chloride induced autophagy, including the intracellular quality control mechanism, in an AMPK‑dependent manner. Furthermore, treatment with autophagy inhibitors (bafilomycin and LY294002) resulted in significant, highly‑selective cytotoxicity and apoptosis activation under hypoxia‑mimicking conditions. The knockdown of AMPK also revealed significant cytotoxicity in hypoxia‑mimicking conditions. These results clearly demonstrated that autophagy, especially mitophagy, was induced by the AMPK pathway when hepatocellular carcinoma cells were subjected to hypoxic conditions and played an important role in the adaptation of these cells to such conditions. Thus, autophagy may constitute an attractive therapeutic target for the treatment of hepatocellular carcinoma.

Introduction

Hepatocellular carcinoma is known to be highly malignant and has a poor prognosis, constituting the most common cause of cancer-related deaths worldwide after lung cancer (1). Standard therapies for liver cancer treatment include the administration of gemcitabine and sorafenib (2). However, these have high rates of unfavorable treatment outcomes (3).

Almost all tumors, including hepatocellular carcinomas, contain an heterogeneous vascular network due to angiogenic imbalance and the aberrant proliferation of cancer cells (4–7). Since oxygen is supplied through the bloodstream, anoxic (<0.5% O2), hypoxic (0.5–1.5% O2) and normoxic (>1.5% O2) regions are supposed to intermingle in tumor tissues (8–10). Many studies have reported that hypoxic environments dramatically reduce the effectiveness of existing anticancer agents (11–14). Therefore, there is an urgent need for the discovery of novel targets that would lead to the development of pharmaceutical agents able to exert their anticancer activity in a hypoxic environment.

Induction of the stabilization of hypoxia-inducible factor 1 (HIF-1) is crucial for the adaptation of cancer cells to hypoxic conditions (15), as the stabilized protein is a transcription factor that regulates the expression of various genes in order to shift energy production from oxidative phosphorylation in mitochondria to glycolysis and/or to facilitate angiogenesis (16). It was recently reported that HIF-1-dependent activation of autophagy occurs under hypoxic conditions (17). Autophagy is an intracellular cleaning mechanism in which cellular components are digested by lysosomal enzymes after being isolated from the cytoplasm by a bilayer membrane. Autophagy is induced not only by hypoxia, but also by other types of intense cellular stress including nutrient deprivation, growth factor withdrawal and treatment with anticancer agents (18–20). Hypoxia constitutes a severe metabolic stress and the induction of autophagy is likely to contribute to adaptation by allowing damaged organelles and proteins to be properly processed, which is a crucial part of the intracellular quality control system.

However, the significance and roles of autophagy under hypoxic conditions are subject of extreme controversy, as they appear to vary among cancers and/or cell types. Some studies reveal that autophagy contributes to cell survival, whereas others indicate that it negatively affects this outcome (21–23). For that reason, it is necessary to thoroughly analyze the significance of autophagy under hypoxic conditions in individual primary tumors. The present study aimed to clarify the influence of autophagy induced by cobalt chloride, a hypoxia-mimicking agent, on the survival of hepatocellular carcinoma cells, as well as the potential usefulness of this process as a therapeutic target. The results of the present study revealed that autophagy under such conditions was dependent on the AMPK pathway and suppressed apoptosis, whereas blockage of this pathway may constitute an attractive therapeutic target as it reduces the ability of cancer cells to adapt to hypoxia.

Materials and methods

Reagents

The materials for the present study were obtained from the following sources: LY294002 was obtained from Calbiochem (Merck KGaA, Darmstadt, Germany). Dulbecco's modified Eagle's medium (DMEM), dimethyl sulfoxide, cobalt chloride, bafilomycin A1, MitoTEMPO and a proteinase inhibitor cocktail were purchased from Sigma-Aldrich (St. Louis, MO, USA). MitoTracker Green FM and MitoSOX Red were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Anti-LC3 antibody (1:1,000; rabbit polyclonal; cat no. PM036) was purchased from MBL (Medical and Biological Laboratories Co., Ltd., Nagoya, Japan). The antibodies against phospho-p70 S6 kinase (Thr389) (1:1,000; rabbit monoclonal; cat. no. 9234), p70 S6 kinase (1:1,000; rabbit polyclonal; cat. no. 9202), phospho-Akt (Ser473) (1:1,000; rabbit monoclonal; cat. no. 4058), AKT (1:1,000; rabbit polyclonal; cat. no. 9272), phospho-AMPKα (Thr172) (1:1,000; rabbit monoclonal; cat. no. 2535) and AMPKα (1:1,000; rabbit polyclonal; cat. no. 2532), as well as Alexa Flour 555-(1:1,000; cat. no. 4409) or Alexa Flour 488-conjugated secondary antibodies (1:1,000; cat. no. 4412) were obtained from Cell Signaling Technology (Danvers, MA, USA). Anti-HIF-1α antibody (1:1,000; rabbit polyclonal; cat. no. GTX127309) was purchased from GeneTex (Irvine, CA, USA), anti-actin antibody (1:10,000; mouse monoclonal; cat. no. 013-24553) was obtained from Wako Pure Chemical Industries (Osaka, Japan). The anti-LAMP1 (1:500; mouse monoclonal; cat. no. sc-20011) and anti-Tom20 (1:500; mouse monoclonal; cat. no. sc-17764) antibodies were obtained from Santa Cruz Biotechnology (Dallas, TX, USA).

Cell lines and culture conditions

The human hepatocellular carcinoma cell lines Huh7 and HepG2 were purchased from the Japanese Collection of Research Bioresources Cell Bank (JCRB Cell Bank, Osaka, Japan). Both cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 50 U/ml penicillin, 50 µg/ml streptomycin and non-essential amino acids (Gibco BRL; Thermo Fisher Scientific, Paisley, UK). The cells were cultured at 37°C, under 5% CO2-95% air.

Cytotoxicity assay

Cytotoxicity assays were performed using the Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Kumamoto, Japan). In brief, HepG2 or Huh7 cells were seeded in 96-well plates (1×104 cells/well) and incubated for 24 h. The medium was then changed to DMEM with or without 300 µM cobalt chloride, followed by addition of serial dilutions of autophagy inhibitors. After another 24 h, the cells were washed with phosphate-buffered saline (PBS) and 100 µl of DMEM containing 10% WST-8 solution was added to each well and each plate was incubated for another 3 h. Subsequently, the absorbance at 460 nm was assessed and cell viability values were expressed as percentages, with the cell numbers in the corresponding control cultures (absence of autophagy inhibitors under each culture condition) set as 100%.

Western blot analysis

Protein extraction and western blot analysis were performed as previously described (24). The antibody dilutions were used according to the manufacturer's instructions.

Immunostaining analysis

Cells grown on 4-well glass chamber slides (Sigma-Aldrich) were treated with 300 µM cobalt chloride (CoCl2) for 24 h. After incubation, the slides were washed with PBS, fixed with PBS containing 4% formaldehyde and 0.1% Triton X-100 for 30 min at 25°C, blocked with 3% bovine serum albumin in PBS for 1 h and incubated first with the indicated primary antibody for 1 h at 25°C and then, with the corresponding secondary antibody at 25°C for another 1 h. DNA was counterstained with SlowFade mounting medium containing DAPI (4′,6-diamidino-2-phenylindole dihydrochloride) that was obtained from Cell Signaling Technology. Images of optical sections with 0.7 µm thickness were captured using a Zeiss LSM 700 confocal laser scanning microscope (Carl Zeiss Microscopy, GmbH, Oberkochen, Germany) under a 63× lens objective (numerical aperture, 1.2 W). The Alexa Fluor 488 dye was excited by a 488-nm laser and the resulting fluorescence emission was detected through a filter that transmitted wavelengths ranging from 420 to 550 nm. The Alexa Fluor 555 dye was excited by a 555-nm laser and the resulting fluorescence emission was detected through a filter that transmitted wavelengths over 560 nm. The number of puncta was counted using ImageJ v1.51n software (NIH, Bethesda, MD, USA). DAPI was used for nuclear counterstaining and its 405-nm-excited fluorescence emission was detected through a filter that transmitted wavelengths over 420 nm.

Plasmids and stable transfection

The HepG2 cells were transfected with MISSION® short hairpin targeting human AMPKa·1 (sh-AMPKCCGGCCATCCTGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCAGGATGGTTTTT)-containing plasmids (Sigma-Aldrich) using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific) for 48 h. The cells were then transferred into medium containing 1.5 µg/ml puromycin (Sigma-Aldrich) for 3 weeks for single-cell clone selection to obtain a stable-expression cell line.

Statistical analysis

Bars or symbols in the graphs represent the means ± standard deviation (SD) generated from at least three independent experiments. Significant differences were determined by one-way analysis of variance (ANOVA), two-way ANOVA or t-tests. A P-value of <0.05 was considered to indicate a statistically significant difference.

Results

Autophagy is induced by cobalt chloride treatment

In order to confirm the induction of autophagy in a hypoxic environment, we treated the Huh7 and HepG2 cells with a hypoxia-mimicking agent, cobalt chloride (25,26). This resulted in a significant accumulation of HIF-1α, which is a hypoxia marker, as well as an increase in the band of LC3-II, which is a modified form of LC3 that can be found in autophagosomes and autolysosomes (Fig. 1A). Both changes indicated the induction of autophagy under hypoxia-mimicking conditions. HepG2 cells were also subjected to double immunostaining for LC3 and LAMP1, a lysosomal marker. As displayed in Fig. 1B-D, cobalt chloride treatment resulted in an increase in LC3 puncta, confirming autophagy induction. Furthermore, the observed colocalization of LC3 and LAMP1 indicated the fusion of autophagosomes and lysosomes. These results strongly indicated that autophagy was induced in hepatocellular carcinoma cells under hypoxic conditions.

Figure 1.

Treatment with cobalt chloride induces the progressive activation of autophagy in hepatocellular carcinoma cells. (A) Huh7 and HepG2 cells were treated with 300 µM cobalt chloride (CoCl2) for 24 h and the expression levels of LC3, HIF-1α and actin were determined by western blot analysis. (B) HepG2 cells were immunostained with anti-LC3 (green) and anti-LAMP-1 (lysosome marker, red). Insets indicate magnified images of the boxed area. Bar, 10 µm. Arrows indicate colocalization between LC3 and LAMP-1. (C) Punctate dots of LC3 in each cell were counted (*P<0.05) and (D) colocalization between LC3 and lysosomes in each cell was assessed using ImageJ software (*P<0.05).

Autophagy induced by cobalt chloride is dependent on the AMPK/mTOR pathway

Subsequently, we investigated in detail the signaling pathway mediating the induction of autophagy by cobalt chloride treatment. The activity of mTOR, a regulator of autophagy, was examined using the phosphorylation status of p70S6K, which is a direct target of mTOR (27), as an indicator. Cobalt chloride treatment led to a significant attenuation of p70S6K phosphorylation, strongly indicative of lower mTOR activity in both cell lines (Fig. 2A). Previous studies have revealed that the phosphorylation of mTOR is positively regulated by AKT (28) and negatively regulated by AMPK (29). Thus, the lower mTOR activity that we observed, may be attributed to a reduction of the AKT activity (e.g., through decreased phosphorylation) and/or an increase in the AMPK activity (e.g., through increased phosphorylation), based on which pathways are involved. However, as demonstrated in Fig. 2B, the phosphorylation of both AKT and AMPK was increased (Fig. 2B). Thus, we concluded that the induction of autophagy by cobalt chloride treatment is likely to be independent of the AKT pathway and dependent on the AMPK/mTOR pathway. This result was consistent with a previous study that examined the mechanism of hypoxia-induced autophagy in human dental pulp cells (30).

Figure 2.

Autophagy induced by cobalt chloride is dependent on the AMPK/mTOR pathway. Huh7 and HepG2 cells were treated with 300 µM cobalt chloride (CoCl2) and harvested at the indicated incubation times. (A) Western blot analysis was used to determine the expression levels of phospho-P70S6K, P70S6K, HIF-1α and actin, as well as (B) those of phospho-AKT, AKT, phospho-AMPK and AMPK.

Autophagy inhibition results in selective cytotoxicity under hypoxia-mimicking conditions

Both hepatocellular carcinoma cell lines were treated with bafilomycin A1, an autophagy inhibitor (31,32). In both cell lines, the inhibitor displayed modest toxicity under normal culture conditions, whereas it dramatically reduced cell survival when added to cells in hypoxia-mimicking conditions (Fig. 3A). High toxicity was also observed when the Huh7 cells were treated with LY294002, a different autophagy inhibitor (33), under hypoxia-mimicking conditions (Fig. 3B). As aforementioned, AMPK probably mediates the induction of autophagy by cobalt chloride treatment. Thus, we attempted to examine the role of this kinase in the adaptation of cells to this condition. As displayed in Fig. 3C, the knockdown of AMPK was extremely toxic under hypoxia-mimicking conditions in HepG2 cells. These results strongly indicated that the proper functioning of autophagy is essential for the adaptation to hypoxia-mimicking conditions and that the AMPK pathway plays a critical role in the process of adaptation as it mediates cobalt chloride-induced autophagy.

Figure 3.

Significant cytotoxicity caused by autophagy inhibition under hypoxia-mimicking conditions. (A) The CCK-8 assay was used to assess the viability of Huh7 and HepG2 cells treated for 24 h with bafilomycin A1 under either ordinary culture conditions or in the presence of 300 µM cobalt chloride (CoCl2) (*P<0.05), (B) Huh7 cells treated for 24 h with various concentrations of LY294002 (*P<0.05). (C) Relative cell viability following AMPK knockdown (sh-AMPK) in HepG2 cells treated for 24 h under the indicated conditions (*P<0.05).

Cobalt chloride-induced autophagy suppresses apoptosis

It has been reported that autophagy supports cell survival through the suppression of apoptosis (34). Thus, we examined whether apoptosis would be induced in the Huh7 cells when adaptation to hypoxia-mimicking conditions was blocked by autophagy inhibitors. Notably, inhibiting autophagy under hypoxia-mimicking conditions resulted in a large increase in PARP cleavage (Fig. 4A), which is an apoptosis indicator, whereas co-treatment with z-VAD-FMK, an apoptosis inhibitor, strongly attenuated this effect (Fig. 4B). These results indicated that hepatocellular carcinoma cells adapted to hypoxia using autophagy to suppress apoptosis.

Figure 4.

Autophagy induced by cobalt chloride suppresses apoptosis. (A) The expression levels of PARP and actin in Huh7 cells treated with bafilomycin A1 or LY294002 with/without 300 µM cobalt chloride (CoCl2) for 24 h were determined by western blot analysis. (B) The CCK-8 assay was used to assess the viability of Huh7 cells treated with bafilomycin or LY294002 with/without Z-VAD-FMK in the presence of 300 µM cobalt chloride (*P<0.05).

Mitophagy is a critical adaptive response to hypoxia-mimicking conditions

It has been reported that cells use autophagy to destroy mitochondria in order to maintain the intracellular redox status, which allows them to evade apoptosis (17). This ‘mitochondria-selective’ type of autophagy is termed mitophagy. We examined whether mitophagy is induced during adaptation to hypoxia-mimicking conditions by immunostaining HepG2 cells for LC3 and Tom20, a known mitochondrial marker. The distribution of most of the LC3 puncta corresponded to one of the Tom20 puncta under hypoxia-mimicking conditions, strongly indicating that mitophagy had been induced (Fig. 5A and B). In addition, treatment with MitoTEMPO, a mitochondria-selective antioxidant reagent (35), significantly reduced cytotoxicity and mitochondrial reactive oxygen species (ROS) resulting from the inhibition of autophagy during hypoxia-mimicking conditions (Fig. 5C and D). These results indicated mitophagy as the type of autophagy mainly used by hepatocellular carcinoma cells to adapt to hypoxia conditions and avoid apoptosis.

Figure 5.

Mitophagy is essential to adaptation to hypoxia-mimicking conditions. (A) HepG2 cells were treated with 300 µM cobalt chloride (CoCl2) for 24 h and immunostained with anti-LC3 (green) and anti-Tom20 (mitochondrial marker, Red). Insets indicate magnified images of the boxed area. Bar, 10 µm. Arrows indicate colocalization between LC3 and Tom20. (B) Colocalization between LC3 and Tom20 in each cell was assessed using ImageJ software (*P<0.05). (C) The CCK-8 assay was used to assess the viability of Huh7 cells treated for 24 h with bafilomycin with/without MitoTEMPO in the presence of 300 µM cobalt chloride (*P<0.05). (D) In addition, Huh7 cells were stained with MitoTracker Green FM (100 nM) and MitoSOX Red mitochondrial superoxide probes (2.5 mM). Insets indicate magnified images of the boxed area. Bar, 10 µm.

Discussion

In the present study, we used hepatocellular carcinoma cells to examine the importance of autophagy on their ability to adapt to hypoxia-mimicking conditions, which were achieved using cobalt chloride treatment. We found that cobalt chloride induces autophagy through the AMPK pathway and that this process allows cells to evade apoptosis and adapt to the hypoxia-mimicking environment. Furthermore, autophagy inhibitors exhibited significant cytotoxicity under hypoxia-mimicking conditions. Since cobalt chloride induces stabilization of HIF-1 and is known as a hypoxia-mimicking agent, further investigation of the effects of exposure to other hypoxia-mimicking agents and to a hypoxic environment is necessary to gain a more precise understanding of the significance of autophagy in the process of adaptation to hypoxic environments.

It is known that AMPK can be activated by two distinct mechanisms (36). The first, which is considered the classical activation mechanism, is sensing the intracellular ATP/AMP ratio. Notably, the intracellular ATP level has been reported to decrease under hypoxic conditions (37). Thus, the activation of AMPK in the present hypoxia-mimicking cell culture system may be attributed, at least partly, to this mechanism. The second AMPK activation mechanism is stimulation by ROS (36). It has recently been revealed that, beyond their ability to damage DNA and proteins, ROS also play an important role as mediator molecules controlling cellular signaling when their levels are low (38,39). More important with respect to our findings, is that hypoxia is known to cause an intracellular accumulation of ROS, which are produced both in mitochondria and by the activity of NOX4 and contribute to cell proliferation, survival and motility (40,41). These data indicate that the phagocytosis-inducing activation of the AMPK pathway in our hypoxia-mimicking cell culture system may be attributed to either of the two known AMPK activation mechanisms. Further studies are required to determine the extent of the contribution of each mechanism. In addition, it is important to note that the AKT phosphorylation was enhanced by the treatment with cobalt chloride in the present study. The activation of AKT is involved in cell survival and proliferation. In turn, LY294002, an autophagy inhibitor used in this study, is known to be the pan-PI3K inhibitor. Therefore, it was difficult to clearly distinguish whether the high level of cytotoxicity induced by LY294002, during cobalt-chloride treatment, was due to the inhibition of autophagy or the blockade of the survival signal of AKT. It is necessary to elucidate the detailed role of AKT in hypoxic adaptation in the future.

It has been reported that autophagy induced in a hypoxic environment negatively affects survival in glioma and breast cancer cell lines, as autophagic cell death is triggered under these conditions (21). To our knowledge, the present study is the first to report an anti-apoptotic, pro-survival effect for cobalt chloride-induced autophagy in hepatocellular carcinoma cell lines, indicating that autophagy may constitute a potential therapeutic target for this type of cancer. Furthermore, our results indicated that mitophagy is a critical system that allows cells to adapt to hypoxia through the regulation of intracellular ROS levels. This is both rational, since mitochondria serve as major loci of ROS production and consistent with previous data that support a mitophagy-mediated apoptosis avoidance mechanism (17). Thus, it is likely that cells avert excessive ROS accumulation by properly processing mitochondria damaged by hypoxic stress via mitophagy.

Notably, the present study indicated that the cytotoxicity of autophagy inhibitors was selective to hypoxia-mimicking conditions, as their effect on cell survival under normoxic culture conditions was limited. Since the reduced form of glutathione, which determines the cellular antioxidant capacity, decreases in a hypoxic environment (42), the selective character of the cytotoxicity displayed by autophagy inhibitors may be attributed to excess ROS being produced due to mitophagy failure to overwhelm the antioxidant capacity of the cell, mostly when this capacity is already compromised, such as under hypoxia-mimicking conditions. Under normoxic conditions, conversely, the small number of damaged mitochondria and the intact glutathione-based anti-oxidant defense maintains cytotoxicity at relatively low levels despite autophagy failure. Future studies focusing on the intracellular redox status may be required in order to elucidate the underlying molecular mechanism of these processes.

Considering the microenvironments that can be found inside a tumor, the dependence of cancer tissues on the bloodstream to obtain oxygen and nutrients causes parts of the tumor to be exposed not only to hypoxia, but also to a lack of nutrients. Identifying valid therapeutic targets in these microenvironments requires determining in what way cancer cells adapt to both types of stress and, importantly, discovering mechanisms that may be shared among the two adaptation processes. Since autophagy in hepatocellular carcinoma cells is induced even in a nutrient-poor environment, supporting cell survival (Endo et al unpublished data), it may represent such a common mechanism. Consistent with the importance of autophagy in tumor microenvironment, an analysis using human surgical specimens indicated that cancerous tissues had a higher autophagic activity than non-cancerous tissues (43). Therefore, autophagy may be viewed as a potential therapeutic target not only in the context of the hypoxic stress response, but also in the whole cancer microenvironment.

In the present study, we revealed that autophagy induced by cobalt chloride treatment did not trigger autophagic cell death in hepatocellular carcinoma cells but rather contributed significantly to cell survival. Additionally, we demonstrated that autophagy may constitute a very attractive target for developing novel therapeutic strategies for the treatment of hepatocellular carcinoma.

Acknowledgements

We wish to thank Makiko Sato and Akiko Sakuyama from the Department of Preventive Medicine, Tokai University School of Medicine, for their excellent secretarial support and Kazuhiro Yoshida from the Support Center for Medical Research and Education, Tokai University, for providing excellent technical support. We would also like to thank Editage (www.editage.jp) for English language editing. The present study was supported in part by the 2016 Research and Study Project of Tokai University Educational System General Research Organization (SO), the 2016 Tokai University School of Medicine Research Aid (SO), the 2017 Research and Study Program of Tokai University Educational System General Research Organization (SO), the 2017 Tokai University School of Medicine Research Aid (HE) and a Grant-in-Aid for Scientific Research (nos. 23701113 and 26870600 to HE) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Competing interests

The authors declare that they have no competing interests.

References

1 

Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, de Oliveira AC, Santoro A, Raoul JL, Forner A, et al: Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 359:378–390. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Wörns M and Galle PR: HCC therapies-lessons learned. Nat Rev Gastroenterol Hepatol. 11:447–452. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Brown JM and Giaccia AJ: The unique physiology of solid tumors: Opportunities (and problems) for cancer therapy. Cancer Res. 58:1408–1416. 1998.PubMed/NCBI

5 

Jain RK: Molecular regulation of vessel maturation. Nat Med. 9:685–693. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Less JR, Skalak TC, Sevick EM and Jain RK: Microvascular architecture in a mammary carcinoma: Branching patterns and vessel dimensions. Cancer Res. 51:265–273. 1991.PubMed/NCBI

7 

Thomlinson RH and Gray LH: The histological structure of some human lung cancers and the possible implications for radiotherapy. Br J Cancer. 9:539–549. 1955. View Article : Google Scholar : PubMed/NCBI

8 

Helmlinger G, Yuan F, Dellian M and Jain RK: Interstitial pH and pO2 gradients in solid tumors in vivo: High-resolution measurements reveal a lack of correlation. Nat Med. 3:177–182. 1997. View Article : Google Scholar : PubMed/NCBI

9 

Vaupel P, Höckel M and Mayer A: Detection and characterization of tumor hypoxia using pO2 histography. Antioxid Redox Signal. 9:1221–1235. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Heindryckx F, Mertens K, Charette N, Vandeghinste B, Casteleyn C, Van Steenkiste C, Slaets D, Libbrecht L, Staelens S, Starkel P, et al: Kinetics of angiogenic changes in a new mouse model for hepatocellular carcinoma. Mol Cancer. 9:2192010. View Article : Google Scholar : PubMed/NCBI

11 

Liu L, Ning X, Sun L, Zhang H, Shi Y, Guo C, Han S, Liu J, Sun S, Han Z, et al: Hypoxia-inducible factor-1 alpha contributes to hypoxia-induced chemoresistance in gastric cancer. Cancer Sci. 99:121–128. 2008.PubMed/NCBI

12 

Song J, Qu Z, Guo X, Zhao Q, Zhao X, Gao L, Sun K, Shen F, Wu M and Wei L: Hypoxia-induced autophagy contributes to the chemoresistance of hepatocellular carcinoma cells. Autophagy. 5:1131–1144. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Sullivan R, Paré GC, Frederiksen LJ, Semenza GL and Graham CH: Hypoxia-induced resistance to anticancer drugs is associated with decreased senescence and requires hypoxia-inducible factor-1 activity. Mol Cancer Ther. 7:1961–1973. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Yokoi K and Fidler IJ: Hypoxia increases resistance of human pancreatic cancer cells to apoptosis induced by gemcitabine. Clin Cancer Res. 10:2299–2306. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Semenza GL: Hypoxia-inducible factor 1: Master regulator of O2 homeostasis. Curr Opin Genet Dev. 8:588–594. 1998. View Article : Google Scholar : PubMed/NCBI

16 

Semenza GL: HIF-1 and tumor progression: Pathophysiology and therapeutics. Trends Mol Med. 8:S62–S67. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Zhang H, Bosch-Marce M, Shimoda LA, Tan YS, Baek JH, Wesley JB, Gonzalez FJ and Semenza GL: Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to hypoxia. J Biol Chem. 283:10892–10903. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Mizushima N, Yamamoto A, Matsui M, Yoshimori T and Ohsumi Y: In vivo analysis of autophagy in response to nutrient starvation using transgenic mice expressing a fluorescent autophagosome marker. Mol Biol Cell. 15:1101–1111. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Lum JJ, Bauer DE, Kong M, Harris MH, Li C, Lindsten T and Thompson CB: Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell. 120:237–248. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Bursch W, Ellinger A, Kienzl H, Török L, Pandey S, Sikorska M, Walker R and Hermann RS: Active cell death induced by the anti-estrogens tamoxifen and ICI 164 384 in human mammary carcinoma cells (MCF-7) in culture: The role of autophagy. Carcinogenesis. 17:1595–1607. 1996. View Article : Google Scholar : PubMed/NCBI

21 

Azad MB, Chen Y, Henson ES, Cizeau J, McMillan-Ward E, Israels SJ and Gibson SB: Hypoxia induces autophagic cell death in apoptosis-competent cells through a mechanism involving BNIP3. Autophagy. 4:195–204. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Tasdemir E, Maiuri MC, Galluzzi L, Vitale I, Djavaheri-Mergny M, D'Amelio M, Criollo A, Morselli E, Zhu C, Harper F, et al: Regulation of autophagy by cytoplasmic p53. Nat Cell Biol. 10:676–687. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Zhang R, Zhu F, Ren J, Huang L, Liu P and Wu G: Beclin1/PI3K-mediated autophagy prevents hypoxia-induced apoptosis in EAhy926 cell line. Cancer Biother Radiopharm. 26:335–343. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Endo H, Niioka M, Kobayashi N, Tanaka M and Watanabe T: Butyrate-producing probiotics reduce nonalcoholic fatty liver disease progression in rats: New insight into the probiotics for the gut-liver axis. PLoS One. 8:e633882013. View Article : Google Scholar : PubMed/NCBI

25 

Fan RH, Chen PS, Zhao D and Zhang WD: Hypoxia induced by CoCl2 influencing the expression and the activity of matrix metalloproteinase-2 in rat hepatic stellate cells. Zhonghua Gan Zang Bing Za Zhi. 15:654–657. 2007.(In Chinese). PubMed/NCBI

26 

Karovic O, Tonazzini I, Rebola N, Edström E, Lövdahl C, Fredholm BB and Daré E: Toxic effects of cobalt in primary cultures of mouse astrocytes. Similarities with hypoxia and role of HIF-1alpha. Biochem Pharmacol. 73:694–708. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Blommaart EF, Luiken JJ, Blommaart PJ, van Woerkom GM and Meijer AJ: Phosphorylation of ribosomal protein S6 is inhibitory for autophagy in isolated rat hepatocytes. J Biol Chem. 270:2320–2326. 1995. View Article : Google Scholar : PubMed/NCBI

28 

Hahn-Windgassen A, Nogueira V, Chen CC, Skeen JE, Sonenberg N and Hay N: Akt activates the mammalian target of rapamycin by regulating cellular ATP level and AMPK activity. J Biol Chem. 280:32081–32089. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Inoki K, Zhu T and Guan K: TSC2 mediates cellular energy response to control cell growth and survival. Cell. 115:577–590. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Zhou Q, Liu H, Sun Q, Zhang L, Lin H, Yuan G, Zhang L and Chen Z: Adenosine monophosphate-activated protein kinase/mammalian target of rapamycin-dependent autophagy protects human dental pulp cells against hypoxia. J Endod. 39:768–773. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Bowman EJ, Siebers A and Altendorf K: Bafilomycins: A class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc Natl Acad Sci USA. 85:pp. 7972–7976. 1988; View Article : Google Scholar : PubMed/NCBI

32 

Yoshimori T, Yamamoto A, Moriyama Y, Futai M and Tashiro Y: Bafilomycin A1, a specific inhibitor of vacuolar-type H(+)-ATPase, inhibits acidification and protein degradation in lysosomes of cultured cells. J Biol Chem. 266:17707–17712. 1991.PubMed/NCBI

33 

Blommaart EF, Krause U, Schellens JP, Vreeling-Sindelárová H and Meijer AJ: The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit autophagy in isolated rat hepatocytes. Eur J Biochem. 243:240–246. 1997. View Article : Google Scholar : PubMed/NCBI

34 

Kim SE, Park HJ, Jeong HK, Kim MJ, Kim M, Bae ON and Baek SH: Autophagy sustains the survival of human pancreatic cancer PANC-1 cells under extreme nutrient deprivation conditions. Biochem Biophys Res Commun. 463:205–210. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Murphy MP and Smith RA: Targeting antioxidants to mitochondria by conjugation to lipophilic cations. Annu Rev Pharmacol Toxicol. 47:629–656. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Hardie DG, Ross FA and Hawley SA: AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biology. 13:251–262. 2012. View Article : Google Scholar

37 

Heerlein K, Schulze A, Hotz L, Bärtsch P and Mairbäurl H: Hypoxia decreases cellular ATP demand and inhibits mitochondrial respiration of a549 cells. Am J Respir Cell Mol Biol. 32:44–51. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Owada S, Shimoda Y, Tsuchihara K and Esumi H: Critical role of H2O2 generated by NOX4 during cellular response under glucose deprivation. PLoS One. 8:e566282013. View Article : Google Scholar : PubMed/NCBI

39 

Nogueira V and Hay N: Molecular pathways: Reactive oxygen species homeostasis in cancer cells and implications for cancer therapy. Clin Cancer Res. 19:4309–4314. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Chandel NS, McClintock DS, Feliciano CE, Wood TM, Melendez JA, Rodriguez AM and Schumacker PT: Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-1alpha during hypoxia: A mechanism of O2 sensing. J Biol Chem. 275:25130–25138. 2000. View Article : Google Scholar : PubMed/NCBI

41 

Diebold I, Petry A, Hess J and Görlach A: The NADPH oxidase subunit NOX4 is a new target gene of the hypoxia-inducible factor-1. Mol Biol Cell. 21:2087–2096. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Mansfield KD, Simon MC and Keith B: Hypoxic reduction in cellular glutathione levels requires mitochondrial reactive oxygen species. J Appl Physiol (1985). 97:1358–1366. 2004. View Article : Google Scholar : PubMed/NCBI

43 

Hirayama A, Kami K, Sugimoto M, Sugawara M, Toki N, Onozuka H, Kinoshita T, Saito N, Ochiai A, Tomita M, et al: Quantitative metabolome profiling of colon and stomach cancer microenvironment by capillary electrophoresis time-of-flight mass spectrometry. Cancer Res. 69:4918–4925. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Owada S, Endo H, Shida Y, Okada C, Ito K, Nezu T and Tatemichi M: Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target. Oncol Rep 39: 1805-1812, 2018.
APA
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., & Tatemichi, M. (2018). Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target. Oncology Reports, 39, 1805-1812. https://doi.org/10.3892/or.2018.6279
MLA
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., Tatemichi, M."Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target". Oncology Reports 39.4 (2018): 1805-1812.
Chicago
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., Tatemichi, M."Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target". Oncology Reports 39, no. 4 (2018): 1805-1812. https://doi.org/10.3892/or.2018.6279
Copy and paste a formatted citation
x
Spandidos Publications style
Owada S, Endo H, Shida Y, Okada C, Ito K, Nezu T and Tatemichi M: Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target. Oncol Rep 39: 1805-1812, 2018.
APA
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., & Tatemichi, M. (2018). Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target. Oncology Reports, 39, 1805-1812. https://doi.org/10.3892/or.2018.6279
MLA
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., Tatemichi, M."Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target". Oncology Reports 39.4 (2018): 1805-1812.
Chicago
Owada, S., Endo, H., Shida, Y., Okada, C., Ito, K., Nezu, T., Tatemichi, M."Autophagy‑mediated adaptation of hepatocellular carcinoma cells to hypoxia‑mimicking conditions constitutes an attractive therapeutic target". Oncology Reports 39, no. 4 (2018): 1805-1812. https://doi.org/10.3892/or.2018.6279
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team