Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
August-2018 Volume 40 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2018 Volume 40 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells

  • Authors:
    • Xingxing Zhang
    • Wen Feng
    • Jin Zhang
    • Lu Ge
    • Youli Zhang
    • Xiaomeng Jiang
    • Wanxin Peng
    • Dawei Wang
    • Aihua Gong
    • Min Xu
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212000, P.R. China, Department of Gastroenterology, Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212000, P.R. China, Department of General Surgery, Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212000, P.R. China, Department of Cell Biology, School of Medicine, Jiangsu University, Department of Gastroenterology, Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212000,
  • Pages: 1093-1102
    |
    Published online on: May 24, 2018
       https://doi.org/10.3892/or.2018.6462
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Recent studies have revealed that overexpression of long non‑coding RNA (lncRNA) PVT1 is correlated with several types of cancer. However, its role in pancreatic cancer development remains to be clarified. In the present study, we found that PVT1 promoted the growth and the epithelial‑mesenchymal transition (EMT) of pancreatic cancer cells. We first determined that PVT1 was upregulated in pancreatic cancer tissues compared with adjacent normal tissues. Knockdown of PVT1 inhibited viability, adhesion, migration and invasion. Furthermore, PVT1 knockdown reduced the expression of mesenchymal markers including Snail, Slug, β‑catenin, N‑cadherin and vimentin, while it increased epithelial marker expression of E‑cadherin. Finally, knockdown of PVT1 inhibited the TGF‑β/Smad signaling, including p‑Smad2/3 and TGF‑β1 but enhanced the expression of Smad4. In contrast, overexpression of PVT1 reversed the process. These findings revealed that PVT1 acts as an oncogene in pancreatic cancer, possibly through the regulation of EMT via the TGF‑β/Smad pathway and PVT1 may serve as a potential target for diagnostics and therapeutics in pancreatic cancer.

Introduction

Pancreatic cancer is one of the major human cancers with extremely poor prognosis compared with other leading cancers (1). In the USA, the mortality rate of pancreatic cancer is ranked fourth among all malignancies, and the overall 5-year survival rate of patients with pancreatic cancer is less than 5% (2,3). It is estimated that by the year 2030, pancreatic cancer may become the second leading cause of cancer-related deaths in the USA (4). The primary reason for this poor prognosis is a failure to diagnose the disease at an early stage (5). Furthermore, apart from surgery, chemotherapy and radiation therapy, there are no effective therapies for the treatment of pancreatic cancer (6). Hence, novel biomarkers and therapeutic strategies are urgently required.

Previous studies have suggested that epithelial-mesenchymal transition (EMT) contributes to early-stage dissemination of cancer cells and is pivotal for invasion and metastasis of pancreatic cancer (7). EMT results in the loss of E-cadherin expression and the acquisition of mesenchymal markers including fibronectin or vimentin (8). Long non-coding RNAs (lncRNAs) are RNA molecules (>200 nucleotides in length) lacking coding capacity (9). Increasing evidence suggests that lncRNAs play important role in diverse cellular biological processes. Plasmacytoma variant translocation 1 (PVT1) is an oncogenic lncRNA (10) and was initially found in the translocations occurring in variant Burkitt's lymphoma and murine plasmacytoma (11). PVT1 is a downstream target of the well-known Myc oncogene (12). Recent studies have indicated that PVT1 can regulate a series of human tumors, such as breast and ovarian (13,14), prostate (15), lung (16) and gastric cancer (17). In ovarian and breast cancer, the PVT1 gene was revealed to be overexpressed and to contribute independently to ovarian and breast cancer pathogenesis and inhibit apoptosis (13). Yang et al revealed that the expression level of PVT1 was significantly upregulated in non-small cell lung carcinoma (NSCLC) tissues and cell lines (16). Using a genome-wide screening strategy, PVT1 was identified as a regulator of gemcitabine sensitivity in pancreatic cancer cells, and upregulation of PVT1 was negatively associated with gemcitabine sensitivity (18). Finally, PVT1 may serve as an independent prognostic factor for poor overall survival rate in patients with pancreatic ductal adenocarcinoma (PDAC) (19). However, the role of PVT1 in pancreatic cancer cells remains to be clarified.

In the present study, we found that PVT1 had a significantly higher expression in tumor tissues than that in adjacent normal tissues, and was critical for cell viability, the ability of adhesion, migration and invasion in pancreatic cancer cells. Moreover, it was demonstrated that PVT1 promoted EMT in pancreatic cancer cells possibly via TGF-β/Smad signaling. All these findings demonstrated for the first time that PVT1 may be a facilitator in pancreatic cancer progression.

Materials and methods

Tissue samples

Human tumor tissue samples and adjacent normal controls were obtained by surgical resection from nine patients with pancreatic cancer, at the Department of General Surgery, Changhai Hospital of Shanghai, Second Military Medical University. All samples were snap-frozen and stored in liquid nitrogen (−176°C). Signed informed consent was obtained from all patients, and the study was approved by the Ethics Committee of the hospital.

Cell cultures

The human pancreatic cancer cell lines (PANC1, PaTu8988 and SW1990) were kindly provided by the Second Military Medical University of Shanghai. The cell lines were cultured with DMEM (Hyclone Laboratories; GE Healthcare Life Sciences, Shanghai, China) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a humidified 5% CO2 incubator at 37°C.

Quantitative RT-PCR

Total RNA was extracted from tissues and cultured cells with Trizol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. RNA concentration and integrity were determined by spectrophotometry. Reverse transcription was performed using the PrimeScrip™ RT reagent kit (Takara Bio, Inc., Otsu, Japan). Quantitative RT-PCR was carried out using the SYBR® Premix Dimmer Eraser kit (Takara Bio, Inc.). GAPDH was used as an internal control. The primer pair used for the amplification was as follows: PVT1 forward, 5′-TGAGAACTGTCCTTACGTGACC-3′ and reverse, 5′-AGAGCACCAAGACTGGCTCT-3′; GAPDH forward, 5′-TTGGTATCGTGGAAGGACTCA-3′ and reverse, 5′-TGTCATCATATTTGGCAGGTT-3′. PCR reactions were performed on the ABI7300 system (Applied Biosystems; Thermo Fisher Scientific, Inc., Sunnyvale, CA, USA). The relative expression fold change of mRNAs was calculated using the 2−ΔΔCt method.

PVT1-siRNA and plasmid construction

The specific sequences of small interfering RNAs for PVT1 were: siPVT1-1 sense, GCUUGGAGGCUGAGGAGUUTT and antisense, AACUCCUCAGCCUCCAAGCTT; siPVT1-2 sense, CCCAACAGGAGGACAGCUUTT and antisense, AAGCUGUCCUCCUGUUGGGTT. They were synthesized by GE Healthcare Dharmacon (Lafayette, CO, USA). A non-specific siRNA sequence was used as a negative control. For ectopic expression, we amplified the entire PVT1 sequence with RT-PCR using the following primers: Forward, TGCTCTAGACTCAAGATGGCTGTGCCTGTCAGCT and reverse, CCGGAATTCAGTAGAAAAAGAATTTAATAGACACG, and then cloned it into pCD513B-1 (SBI Pharmaceuticals, Co., Ltd., Tikyo, Japan) at XbaI and EcoRI sites. All PCR products were confirmed by DNA sequencing.

Cell transfection

Cells in logarithmic growth phase were diluted and seeded at 2.5×105 cells/well into 6-well plates. The siRNAs or plasmid were transfected into pancreatic cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The cells were incubated in a humidified chamber for 48 h before use in the following assays.

Cell viability assay

A cell viability assay was performed using a CCK-8 kit (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) following the manufacturer's protocol. Cells were seeded in 96-well plates at a density of 5,000 cells/well and cultured with medium containing 10% FBS for 10, 24, 48 and 72 h. After the cells were washed twice with cold PBS, 10 µl CCK-8 and 100 µl serum-free medium were added into each well and the plates were incubated for a further 45 min at 37°C. The absorbance was assessed at a wavelength of 450 nm using Wellscan MK-3 ELISA (Labsystems Dragon, Helsinki, Finland).

Western blotting

Protein was extracted from transfected cells with RIPA lysis buffer at 4°C for 10 min. Equal amounts of protein were loaded and separated by 10% SDS-PAGE and transferred to PVDF membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat dried milk in TBST for 1 h at room temperature and then incubated with primary antibodies at 4°C overnight. After washing with TBST, the membranes were further incubated for 1 h at room temperature with corresponding horseradish peroxidase-conjugated secondary antibody in an appropriate dilution (goat anti-mouse; 1:5,000; cat. no. A0216; and goat anti-rabbit; 1:10,000; cat. no. A0208) and then washed three times with the same buffer. The immunoreactive protein bands were visualized using an ECL kit (Pierce; Thermo Fisher Scientific, Inc.). The antibodies used were: rabbit anti-TGF-β (cat. no. 3712; Cell Signaling Technology, Inc., Danvers, MA, USA), rabbit anti-MMP2 (cat. no. YT2798) and rabbit anti-MMP9 (cat. no. YT1892; both from ImmunoWay Biotechnology Co., Plano, TX, USA), an EMT antibody sampler kit (cat. no. 9782), a Smad2/3 antibody sampler kit (cat. no. 12747), mouse anti-β-Tubulin (cat. no. 4466), and rabbit anti-β-actin (cat. no. 4970; all from Cell Signaling Technology, Inc.) and all above antibodies diluted with 1:1,000. β-actin and β-tubulin were used as internal controls. Signals were visualized using an enhanced chemiluminescence system.

Transwell migration and invasion assay

Briefly, migration assays were conducted using 8.0-µm culture insert chambers (EMD Millipore). Invasion assays were performed using the Corning® Matrigel® Invasion Chamber (Corning Inc., Corning, NY, USA). FBS-containing medium (10%) was placed in the bottom chamber to act as a chemoattractant. Then, 5×104 cells in a 100-µl volume of serum-free medium were placed in the upper chamber. Invasive cells on the lower surface of the membrane were those that had invaded the Matrigel or had migrated through the polycarbonate membrane. After incubation at 37°C for 24 h, the cells were fixed in paraformaldehyde solution and stained with crystal violet. The top surface was gently scrubbed with a cotton bud and the remaining cells at the bottom surface were counted under a microscope (Olympus GX41; Olympus Corp. Tokyo, Japan) in five randomly selected fields at a magnification of ×20.

Wound healing assay

Transfected cells were grown to 95% confluence. A wound was scratched in the monolayer with a 200-µl pipette tip. Suspended cells and debris were washed with PBS three times, then the cells were incubated in medium containing 2% FBS at 37°C. At 0 and 24 h the wound image was captured using an OLYMPUS inverted microscope at a magnification of ×100, respectively, to evaluate the cell migratory potential.

Adhesion assay

Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was diluted in serum-free media to a concentration of 0.04 µg/µl, and then 50 µl of this Matrigel was transferred into 96-well plates. Transfected cells (4×104) in a 100-µl volume of serum-free medium were plated onto the Matrigel-precoated 96-well plates in triplicate. After incubation at 37°C for 4 h, the medium was then carefully removed, and the plate was washed with PBS to remove the non-adherent cells. The Matrigel-precoated plate without cells served as the negative control. After washing, adherent cells were assessed with a CCK-8 kit (Dojindo Molecular Technologies, Inc.) following the manufacturer's protocol. The relative optical density (OD) value was determined at 490 nm using Wellscan MK-3 ELISA. The OD values reflected the proportion of cells in the Matrigel-coated 96-well plate.

Statistical analysis

All the presented data and results were confirmed in at least three independent experiments and were expressed as the mean ± SD. Statistical comparisons were performed using Student's t-test and one-way ANOVA. The data was analyzed using GraphPad Prism 7 (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of PVT1 is profiled in human pancreatic cancer tissues and cell lines

To confirm the role of PVT1 in pancreatic cancer, we first examined its expression profile in 9 pairs of matched human pancreatic tumors and adjacent normal tissues by qRT-PCR. The results indicated that the expression level of PVT1 in tumor tissues was significantly higher than that in adjacent normal tissues (Fig. 1A). In addition, it was revealed that PaTu8988 cells expressed the highest level of PVT1, whereas SW1990 cells expressed the lowest level of PVT1 among the 3 cell lines (Fig. 1B). Since PaTu8988 and BxPc-3 cells expressed a high level of PVT1, these two cell lines were selected to investigate the effect of specific depletion of PVT1 (Fig. 1C and D), and SW1990 was selected to study the effect of overexpression of PVT1 assays (Fig. 1E).

Figure 1.

Detection of PVT1 expression in human pancreatic cancer tissues and cell lines. (A) The expression of PVT1 in 9 pairs of matched human pancreatic cancer tissues, as detected by qRT-PCR. (B) The mRNA expression of PVT1 in three human pancreatic cancer cell lines, SW1990, BxPc-3 and PaTu8988. (C and D) Identification of siRNA-mediated PVT1 knockdown in PaTu8988 and BxPc-3 cells by real-time-PCR analysis. GAPDH was used for normalization. (E) The mRNA level of PVT1 was detected in SW1990 cells transfected with pCD513B-1 and pCD513B-1-PVT1. Data are the mean ± SD from three independent experiments. *P<0.05, **P<0.01, ***P<0.001.

PVT1 promotes cell viability and the ability of adhesion in pancreatic cancer cells

To determine the role of PVT1 in pancreatic cancer cells, we utilized a CCK-8 assay to estimate cell viability. We found that PVT1 knockdown induced lower viability of PaTu8988 and BxPc-3 cells at 10, 24, 48 and 72 h after transfection (Fig. 2A and B). In contrast, PVT1 overexpression enhanced cell viability at 10, 24, 48 and 72 h in SW1990 cells (Fig. 2C). In addition, we found that PVT1 knockdown suppressed the ability of adhesion in PaTu8988 and BxPc-3 cells (Fig. 2D and E) while PVT1 overexpression enhanced the ability in SW1990 cells (Fig. 2F). Collectively, these results revealed that PVT1 may promote viability of pancreatic cancer cells and tumor cell adhererence to the extracellular matrix (ECM).

Figure 2.

PVT1 promotes the viability and adhesion abilities of pancreatic cancer cells. (A and B) Cell viability was detected by the CCK-8 assay in PaTu8988 and BxPc-3 cells transfected with siPVT1-NC, siPVT1-1, siPVT1-2, respectively. (C) Cell viability was detected by the CCK-8 assay in SW1990 cells transfected with pCD513B-1 and pCD513B-1-PVT1. An adhesion assay was used to analyze the cell adhesion ability of (D) PaTu8988, (E) BxPc-3 and (F) SW1990 cells. Data are expressed as the mean ± SD from three independent experiments. *P<0.05, **P<0.01. The data were obtained from at least three independent experiments.

PVT1 enhances the migration ability of pancreatic cancer cells

Next, we examined the ability of migration by wound healing assays in pancreatic cancer cells. The migration rate was 0.292±0.053, 0.125±0.012 and 0.143±0.005 (P<0.01) in siPVT1-NC, siPVT1-1 and siPVT1-2 PaTu8988 cells (Fig. 3A and D), and 0.291±0.002, 0.224±0.025 and 0.245±0.034 (P<0.05) in siPVT1-NC, siPVT1-1 and siPVT1-2 BxPc-3 cells, respectively (Fig. 3B and E), while 0.185±0.015 and 0.664±0.011 in pCD513B-1 and pCD513B-1-PVT1 (P<0.01) SW1990 cells (Fig. 3C and F). These results indicated that knockdown of PVT1 significantly decreased the migration ability of PaTu8988 and BxPc-3 cells. To confirm the aforementioned results, we conducted Transwell assays to examine migration ability. The number of migrated cells was 58±12, 16±10 and 18±9 (P<0.01) in siPVT1-NC, siPVT1-1 and siPVT1-2 PaTu8988 cells, and 57±6, 20±8 and 18±9 (P<0.01) in siPVT1-NC, siPVT1-1 and siPVT1-2 BxPc-3 cells, respectively (Fig. 3G, I and J). Furthermore, the number of migrated cells was 20±10 and 127±12 (P<0.01) in pCD513B-1 and pCD513B-1-PVT1 SW1990 cells (Fig. 3H and K). All these data revealed that PVT1 promotes the ability of migration in pancreatic cancer cells.

Figure 3.

PVT1 promotes the ability of pancreatic cancer cell migration. A wound healing assay was used to evaluate the cell migration ability of (A) PaTu8988- and (B) BxPc-3 -transfected cells with siPVT1-NC, siPVT1-1, siPVT1-2 and (C) SW1990-transfected cells with pCD513B-1 and pCD513B-1-PVT1. Representative images of migrated cells are presented (×100). (D-F) The rate of migration was analyzed. *P<0.05, **P<0.01. (G) Effects of PVT1 knockdown on the migration of BxPc-3 and PaTu8988 cells was further examined by Transwell assay. (H) The migration of SW1990-transfected cells with pCD513B-1 and pCD513B-1-PVT1 was assessed by Transwell assay. Representative images of migrated cells are presented (magnification, ×100). (I-K) The number of migrated cells was counted and analyzed. **P<0.01. The data were obtained from at least three independent experiments.

PVT1 promotes the invasion ability of pancreatic cancer cells

Subsequently, we examined the ability of invasion using BD Matrigel invasion assays in pancreatic cancer cells. PaTu8988 and BxPc-3 cells were transfected with siPVT1-NC, siPVT1-1 and siPVT1-2 plasmids, and SW1990 cells with pCD513B-1 and pCD513B-1-PVT1 for 72 h. The number of invasive cells was 82±5, 24±9 and 20±5 in siPVT1-NC, siPVT1-1 and siPVT1-2 PaTu8988 cells, and 68±3, 28±7 and 24±11 in siPVT1-NC, siPVT1-1 and siPVT1-2 BxPc-3 cells, respectively (Fig. 4A-C), demonstrating that downregulation of PVT1 significantly inhibited the invasion ability of PaTu8988 and BxPc-3 cells. In addition, the number of invasive cells was 20±5 and 80±8 in pCD513B-1 and pCD513B-1-PVT1 SW1990 cells, respectively (Fig. 4D and E) thus revealing that upregulation of PVT1 significantly promoted the invasion ability of SW1990 cells. Matrix-metalloproteinases (MMPs) have been confirmed to play pivotal roles in tumor cell invasion through adherence and degradation of the basement membrane and ECM (20). To determine whether PVT1 can regulate the activity of MMPs, we investigated the expression level of MMP2 and MMP9 through western blotting. In the PaTu8988 and BxPc-3 cells, knockdown of PVT1 suppressed MMP2 and MMP9 (active and total) protein levels (Fig. 4F). Conversely, in SW1990 cells overexpression of PVT1 increased MMP2 and MMP9 (active and total) protein levels (Fig. 4G). Collectively, these data revealed that PVT1 promotes the invasion ability of pancreatic cancer cells.

Figure 4.

PVT1 enhances the invasion ability of pancreatic cancer cells. (A) The invasion ability was examined using BD Matrigel invasion assay in PaTu8988 and BxPc-3 cells transfected with siPVT1-NC, siPVT1-1, siPVT1-2. (D) SW1990-transfected cells with pCD513B-1 and pCD513B-1-PVT1. (B, C and E) Invasive cells were counted and analyzed. P<0.01. (F and G) MMP2 and MMP9 (active and total) were determined using western blotting. Data are expressed as the mean ± SD from three independent experiments.

PVT1 enhances epithelial-mesenchymal transition in pancreatic cancer cells

During tumor development, tumor cells constantly communicate with the surrounding microenvironment, which can guide tumor cells to undergo a phenomenon termed EMT. EMT is regarded as a pivotal step for the promotion of tumor invasion and metastasis and plays a potential role in the progression of pancreatic cancer (21). Thus, we assessed whether PVT1 was involved in EMT to influence cancer metastasis. We examined the expression of EMT marker genes and EMT-related transcription factors using western blotting. PVT1-siRNAs increased E-cadherin expression and decreased vimentin, N-cadherin, β-catenin, Snail and Slug expression in PaTu8988 and BxPc-3 cells (Fig. 5A and B). Conversely, ectopic expression of PVT1 decreased E-cadherin expression and increased vimentin, N-cadherin, β-catenin, Snail and Slug expression in SW1990 cells (Fig. 5C). These observations strongly demonstrated that PVT1 promoted a transition from epithelial to mesenchymal phenotype.

Figure 5.

PVT1 promotes EMT in pancreatic cancer cells. (A and B) PVT1 knockdown in PaTu8988 and BxPc-3 cells reversed EMT, as detected by an increase in E-cadherin and decreases in vimentin, N-cadherin, β-catenin, Snail and Slug. (C) Treatment of SW1990 cells with pCD513B-1-PVT1 enhanced EMT compared to the control. β-actin was used as a loading control. Data are expressed as the mean ± SD from three independent experiments. *P<0.05.

PVT1 activates EMT via TGF-β/Smad signaling in human pancreatic cancer cells

Multiple studies have suggested that the TGF-β/Smad signaling pathway is a central regulator in cancer cell viability, metastasis and the EMT process. Thus, we speculated that PVT1 could regulate TGF-β/Smad signal transduction in human pancreatic cancer cells, focusing on p-Smad2/3, Smad4 and TGF-β1 since they are pivotal signaling molecules in the TGF-β/Smad signaling pathway. PVT1 knockdown increased Smad4 expression and decreased p-Smad2/3 and TGF-β1 expression in PaTu8988 and BxPc-3 cells (Fig. 6A and B). Conversely, SW1990 cells transfected with PVT1 expression plasmid decreased Smad4 expression and increased p-Smad2/3 and TGF-β1 expression (Fig. 6C). However, TGF-β1 knockdown downregulated p-Smad2/3 after we transfected BxPc-3 and SW1990 cells with pCD513B-1-PVT1 (Fig. 6D and E), indicating that PVT1 upregulates p-Smad2/3 mainly through TGF-β1 upregulation. Knockdown or overexpression of PVT1 had no influence on total Smad2/3 protein. These data revealed that PVT1 promoted EMT in pancreatic cancer cells possibly via TGF-β/Smad signaling.

Figure 6.

PVT1 enhances EMT via TGF-β/Smad signaling. (A and B) Immunoblotting of Smad2/3, p-Smad2/3, Smad4, TGF-β1 in PaTu8988 and BxPc-3 cells treated with siPVT1-NC, siPVT1-1, siPVT1-2. (C) Immunoblotting of Smad2/3, p-Smad2/3, TGF-β1 in SW1990 cells transfected with pCD513B-1-PVT1 or pCD513B-1. β-tubulin was used as a loading control. *P<0.05. Data are expressed as the mean ± SD from three independent experiments. (D and E) TGF-β1 knockdown downregulated p-Smad2/3 after BxPc-3 and SW1990 cells were transfected with pCD513B-1-PVT1.

Discussion

In the present study, we determined that PVT1 may function as an oncogene in pancreatic cancer. We revealed for the first time, to the best of our knowledge, that PVT1-induced expression of p-Smad2/3 represents a novel and critical role for controlling the growth and EMT in pancreatic cancer cells. All these findings revealed that PVT1 may be a potential candidate for the diagnosis of pancreatic cancer.

A previous study demonstrated that frequent mutation of the q24 band of chromosome 8(8q24) was associated with PVT1 expression in breast cancer (14). PVT1 expression is required for high Myc protein levels in 8q24-amplified human cancer cells (12). Our study confirmed that PVT1 expression was significantly increased in pancreatic cancer tissues compared to adjacent normal tissues, corresponding with the findings of Huang et al (19), which indicated that the reduced PVT1 expression may play an important role in the development of pancreatic cancer and may be a biomarker for the detection of cancer development and progression.

PVT1 can promote cervical cancer progression by epigenetically silencing miR-200b (22). Kong et al found that PVT1 promoted gastric cancer cell viability by epigenetically regulating p15 and p16 (23). In the present study, we confirmed that PVT1 stimulated oncogenic activities including the viability, adhesion, migration and the ability of invasion in pancreatic cancer cells consistent with previous studies in other tumors further supporting its oncogenic potential. Carcinoma cells can transition from an epithelial to mesenchymal differentiation state through a process known as EMT (24). The process of EMT is characterized by alterations in the pattern of gene expression, loss of epithelial cell junction proteins, such as E-cadherin, and an upregulation of mesenchymal markers, such as vimentin and N-cadherin (25). Loss of E-cadherin expression is considered as a key event during the induction of EMT (26). The present study confirmed that knockdown of PVT1 upregulated E-cadherin and downregulated vimentin, N-cadherin, β-catenin, Snail and Slug while PVT1 overexpression resulted in the downregulation of E-cadherin and upregulation of vimentin, N-cadherin, β-catenin, Snail and Slug. All these data revealed that PVT1 may drive typical epithelial phenotype cell transformation into spindle-shaped mesenchymal phenotype cells, promoting the ability of viability, migration and invasion in human pancreatic cancer cells.

It has been demonstrated that TGF-β acts as a potent driver of cancer progression through the induction of EMT (27). Upon stimulation by TGF-β1, Smad2/3 is activated by phosphorylation and along with Smad4, they are translocated into the nucleus to activate transcription of cancer cells, promoting EMT progression (28). Our results revealed that PVT1 promoted the growth and EMT through driving TGF-β/Smad signaling. As anticipated, PVT1 knockdown downregulated TGF-β1 and p-Smad2/3 while PVT1 overexpression upregulated active-TGF-β1, and then activated p-Smad2/3. Conversely, Smad4, a well-known tumor-suppressor gene and a major mediator of intracellular TGF-β signaling (29), was upregulated by knockdown of PVT1. These results demonstrated that knockdown of PVT1 promoted EMT via TGF-β signaling activation in pancreatic cancer cells. Notably, it is suggested that PVT1 plays an important role in treating cancer and may be a potential therapeutic target candidate in pancreatic cancer.

In conclusion, PVT1 plays a pivotal role in cell viability, adhesion, migration and invasion in pancreatic cancer cells. PVT1 may function as a key regulator of EMT in pancreatic cancer cells through the TGF-β/Smad signaling pathway. Therefore, PVT1 may prove to be clinically useful for developing a prognostic biomarker and therapeutic target for pancreatic cancer.

Acknowledgements

Thanks for all members from Lab 2508, Department of Cell Biology, School of Medicine, Jiangsu University.

Funding

The present study was supported by grants from the National Natural Science Foundation of China (nos. 81672402 and 81472333), the Provincial Natural Science Foundation of Jiangsu, China (no. BK20171305), the Research Programs of Jiangsu Provincial Commission of Health and Family Planning, China (no. H201434), the ‘Six one Project’ Research Projects of High-level Medical Personnel of Jiangsu Province (no. LGY2016054), the ‘Six Talents Peak’ High-level Talent Selection and Training Project of Jiangsu Province (no. 2014-WSW-038), the Science and Technology Support Program Project of Zhenjiang, China (nos. SH2014024) and the Qing Lan Project of Jiangsu Provincial Education Department. Revitalizing the key talent's subsidy project in science and education, Jiangsu, China (no. ZDRCC2016026) and the Natural Science Foundation of Jiangsu Province (no. BK20130474).

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

MX, XZ, WF and AG conceived, designed, coordinated the study and wrote the paper. MX, XZ and WF participated in all experiments. JZ performed and analyzed experiments shown in Fig. 1. LG, YZ, WP and DW performed and analyzed experiments in Figs. 2–4. WF and JZ performed and analyzed experiments shown in Figs. 5 and 6. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

Signed informed consent was obtained from all patients, and the study was approved by the Ethics Committee of Changhai Hospital of Shanghai, Second Military Medical University.

Consent for publication

Not applicable.

Competing interests

The authors state that they have no competing interests.

References

1 

Ilic M and Ilic I: Epidemiology of pancreatic cancer. World J Gastroenterol. 22:9694–9705. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Ma J, Siegel R and Jemal A: Pancreatic cancer death rates by race among US men and women, 1970–2009. J Natl Cancer Inst. 105:1694–1700. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM and Matrisian LM: Projecting cancer incidence and deaths to 2030: The unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res. 74:2913–2921. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Limani P, Samaras P, Lesurtel M, Graf R, DeOliveira ML, Petrowsky H and Clavien PA: Pancreatic cancer- a curable disease. Praxis (Bern 1994). 104:453–460. 2015.(In German). View Article : Google Scholar : PubMed/NCBI

6 

Mohammed S, Van Buren G II and Fisher WE: Pancreatic cancer: Advances in treatment. World J Gastroenterol. 20:9354–9360. 2014.PubMed/NCBI

7 

Zheng X, Carstens JL, Kim J, Scheible M, Kaye J, Sugimoto H, Wu CC, LeBleu VS and Kalluri R: Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer. Nature. 527:525–530. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Beuran M, Negoi I, Paun S, Ion AD, Bleotu C, Negoi RI and Hostiuc S: The epithelial to mesenchymal transition in pancreatic cancer: A systematic review. Pancreatology. 15:217–225. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Bergmann JH and Spector DL: Long non-coding RNAs: Modulators of nuclear structure and function. Curr Opin Cell Biol. 26:10–18. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Cui M, You L, Ren X, Zhao W, Liao Q and Zhao Y: Long non-coding RNA PVT1 and cancer. Biochem Biophys Res Commun. 471:10–14. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Graham M and Adams JM: Chromosome 8 breakpoint far 3′ of the c-myc oncogene in a Burkitt's lymphoma 2;8 variant translocation is equivalent to the murine pvt-1 locus. EMBO J. 5:2845–2851. 1986.PubMed/NCBI

12 

Tseng YY, Moriarity BS, Gong W, Akiyama R, Tiwari A, Kawakami H, Ronning P, Reuland B, Guenther K, Beadnell TC, et al: PVT1 dependence in cancer with MYC copy-number increase. Nature. 512:82–86. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Guan Y, Kuo WL, Stilwell JL, Takano H, Lapuk AV, Fridlyand J, Mao JH, Yu M, Miller MA, Santos JL, et al: Amplification of PVT1 contributes to the pathophysiology of ovarian and breast cancer. Clin Cancer Res. 13:5745–5755. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Zhang Z, Zhu Z, Zhang B, Li W, Li X, Wu X, Wang L, Fu L, Fu L and Dong JT: Frequent mutation of rs13281615 and its association with PVT1 expression and cell proliferation in breast cancer. J Genet Genomics. 41:187–195. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Meyer KB, Maia AT, O'Reilly M, Ghoussaini M, Prathalingam R, Porter-Gill P, Ambs S, Prokunina-Olsson L, Carroll J and Ponder BA: A functional variant at a prostate cancer predisposition locus at 8q24 is associated with PVT1 expression. PLoS Genet. 7:e10021652011. View Article : Google Scholar : PubMed/NCBI

16 

Yang YR, Zang SZ, Zhong CL, Li YX, Zhao SS and Feng XJ: Increased expression of the lncRNA PVT1 promotes tumorigenesis in non-small cell lung cancer. Int J Clin Exp Pathol. 7:6929–6935. 2014.PubMed/NCBI

17 

Ding J, Li D, Gong M, Wang J, Huang X, Wu T and Wang C: Expression and clinical significance of the long non-coding RNA PVT1 in human gastric cancer. OncoTargets Ther. 7:1625–1630. 2014. View Article : Google Scholar

18 

You L, Chang D, Du HZ and Zhao YP: Genome-wide screen identifies PVT1 as a regulator of Gemcitabine sensitivity in human pancreatic cancer cells. Biochem Biophys Res Commun. 407:1–6. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Huang C, Yu W, Wang Q, Cui H, Wang Y, Zhang L, Han F and Huang T: Increased expression of the lncRNA PVT1 is associated with poor prognosis in pancreatic cancer patients. Minerva Med. 106:143–149. 2015.PubMed/NCBI

20 

Xu T, Jing C, Shi Y, Miao R, Peng L, Kong S, Ma Y and Li L: microRNA-20a enhances the epithelial-to-mesenchymal transition of colorectal cancer cells by modulating matrix metalloproteinases. Exp Ther Med. 10:683–688. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Lamouille S, Xu J and Derynck R: Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 15:178–196. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Zhang S, Zhang G and Liu J: Long noncoding RNA PVT1 promotes cervical cancer progression through epigenetically silencing miR-200b. APMIS. 124:649–658. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Kong R, Zhang EB, Yin DD, You LH, Xu TP, Chen WM, Xia R, Wan L, Sun M, Wang ZX, et al: Long noncoding RNA PVT1 indicates a poor prognosis of gastric cancer and promotes cell proliferation through epigenetically regulating p15 and p16. Mol Cancer. 14:822015. View Article : Google Scholar : PubMed/NCBI

24 

Bogachek MV, De Andrade JP and Weigel RJ: Regulation of epithelial-mesenchymal transition through SUMOylation of transcription factors. Cancer Res. 75:11–15. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Onder TT, Gupta PB, Mani SA, Yang J, Lander ES and Weinberg RA: Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Cancer Res. 68:3645–3654. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Thiery JP: Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2:442–454. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Katsuno Y, Lamouille S and Derynck R: TGF-β signaling and epithelial-mesenchymal transition in cancer progression. Curr Opin Oncol. 25:76–84. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Heldin CH, Miyazono K and ten Dijke P: TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature. 390:465–471. 1997. View Article : Google Scholar : PubMed/NCBI

29 

Liu Y, Sheng J, Dai D, Liu T and Qi F: Smad4 acts as tumor suppressor by antagonizing lymphangiogenesis in colorectal cancer. Pathol Res Pract. 211:286–292. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang X, Feng W, Zhang J, Ge L, Zhang Y, Jiang X, Peng W, Wang D, Gong A, Xu M, Xu M, et al: Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells. Oncol Rep 40: 1093-1102, 2018.
APA
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X. ... Xu, M. (2018). Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells. Oncology Reports, 40, 1093-1102. https://doi.org/10.3892/or.2018.6462
MLA
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X., Peng, W., Wang, D., Gong, A., Xu, M."Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells". Oncology Reports 40.2 (2018): 1093-1102.
Chicago
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X., Peng, W., Wang, D., Gong, A., Xu, M."Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells". Oncology Reports 40, no. 2 (2018): 1093-1102. https://doi.org/10.3892/or.2018.6462
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang X, Feng W, Zhang J, Ge L, Zhang Y, Jiang X, Peng W, Wang D, Gong A, Xu M, Xu M, et al: Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells. Oncol Rep 40: 1093-1102, 2018.
APA
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X. ... Xu, M. (2018). Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells. Oncology Reports, 40, 1093-1102. https://doi.org/10.3892/or.2018.6462
MLA
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X., Peng, W., Wang, D., Gong, A., Xu, M."Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells". Oncology Reports 40.2 (2018): 1093-1102.
Chicago
Zhang, X., Feng, W., Zhang, J., Ge, L., Zhang, Y., Jiang, X., Peng, W., Wang, D., Gong, A., Xu, M."Long non‑coding RNA PVT1 promotes epithelial‑mesenchymal transition via the TGF‑β/Smad pathway in pancreatic cancer cells". Oncology Reports 40, no. 2 (2018): 1093-1102. https://doi.org/10.3892/or.2018.6462
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team