International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Exosomes are 30–100 nm membranous organelles that are released from cells into the extracellular microenvironment (1). Exosomes are vesicular carriers for intercellular communication, and they contain various signaling biomolecules, including proteins, metabolites, RNA, DNA, and lipids to target cells (2–4). Mass spectrometry and microarray technologies have been used to perform exosomal biomolecules profiling. These efforts have revealed that exosomal biomolecule composition varies depending on the cell type of origin (1,5). Since exosomes are found in biological fluids, including blood and urine, exosomal biomolecules with disease specificity are promising targets in liquid biopsies (6).
Cancer diagnosis at an early stage, before it has grown and spread to other organs by metastasis, is a prerequisite for successful treatment. Pancreatic cancer is one of the most deadly cancer forms and the third leading cause of cancer-related deaths in the United States (7), the EU (8) and Japan (http://ganjoho.jp/en/professional/statistics/brochure/2017_en.html). Early stage pancreatic cancer is difficult to diagnose since it is asymptomatic, making pancreatic cancer particularly challenging to treat and/or cure (9). In most cases, pancreatic cancer growth and metastasis have occurred by the time of diagnosis, leading to the poorest outcomes among the major types of cancer with a 5-year survival rate of <10% (7). While early diagnosis is essential for effective pancreatic cancer treatment and/or cure, there are currently no proven clinical tumor markers for the early stages of pancreatic cancer. However, recent developments in molecular profiling technologies have indicated that proteins and microRNAs identified in exosomes could be useful as fluid-based diagnostic and prognostic markers for pancreatic cancer (10,11).
Cell culture systems have been used for secretome analyses to identify the extracellular or exosomal proteins and microRNAs released into the medium (12–14). Using cancer cells coupled with proteomics- or transcriptomics-based approaches, we have identified an abundance of polyadenylate binding protein 1 and let-7 family microRNAs in exosomes isolated from metastatic duodenal cancer cells (15,16). In the present study, we aimed to identify pancreatic cancer metastasis. We performed exosomal proteome analysis using pancreatic cancer cell lines derived from early (primary tumors), and late stages (ascites, and metastatic tumors) of tumor progression. Comparative analyses revealed that epidermal growth factor receptor pathway substrate 8 (Eps8) protein was abundant in exosomes derived from metastatic tumors and ascites and that the amount of exosomal Eps8 was quantitatively correlated with the in vitro cell migratory activity. These observations indicating that exosomal Eps8 is a predictive biomarker for pancreatic cancer metastasis.
Cell lines used in the present study are listed in Table I. Cells were maintained in a humidified atmosphere (37°C, 5% CO2) in RPMI-1640 medium (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 2 mM L-glutamine (Nissui Pharmaceutical, Co., Ltd., Tokyo, Japan), 100 U/ml penicillin-100 mg/ml streptomycin, and 10% heat-inactivated (FBS) (all from Thermo Fisher Scientific, Inc., Waltham, MA, USA).
Real-time cell analysis (RTCA) of in vitro cell migratory and invasive activities was performed using an xCELLigence RTCA DP instrument (Roche Diagnostics, Indianapolis, IN, USA) as previously described (15). Samples were analyzed in quadruplicate as technical replicates. Data analysis was performed using the RTCA software (version 1.2) supplied with the instrument.
Exosomes were isolated from the cell culture medium as previously described (15,16). Briefly, cells were cultured for 48 h at 37°C with 5% CO2 in complete RPMI-1640 medium containing 10% FBS depleted of contaminating microvesicles by centrifugation at 100,000 × g for 18 h. Culture medium (CM) was collected and centrifuged at 800 × g for 5 min and at an additional 2,000 × g for 10 min to remove detached cells. The supernatant was then filtered through a 0.1-µm pore polyethersulfone membrane filter (Thermo Fisher Scientific, Inc.) to remove cell debris and large vesicles, then concentrated using a Centricon Plus-70 with a 100,000-MW cut-off membrane (EMD Millipore; Billerica, MA, USA). Concentrated CM was ultracentrifuged at 100,000 × g for 2 h at 4°C using a 70Ti rotor (Beckman Coulter, Inc., Brea, CA, USA). Resultant pellets were resuspended in 6 ml phosphate-buffered saline (PBS) and ultracentrifuged at 100,000 × g for 1 h at 4°C using a 100Ti rotor (Beckman Coulter, Inc.).
Exosomal proteome analysis was performed by LC-MS/MS (liquid chromatography-mass spectrometry) as previously described (15,17). Proteins (200 µg) from isolated exosomes were dissolved in lysis buffer containing 7.5 M urea and 2.5 M thiourea (both from Sigma-Aldrich; Merck KGaA), 12.5% glycerol (Chemical Industries, Osaka, Japan), 50 mM Tris, 2.5% n-octyl-β-d-glucoside, 6.25 mM Tris(2-carboxyethyl)phosphine hydrochloride, and 1.25 mM protease inhibitor (all from Sigma-Aldrich; Merck KGaA) before being rotated at 4°C for 60 min. After centrifugation at 14,000 × g for 60 min at 4°C, the supernatant was fractionated using the Agilent 1200 HPLC system (Agilent Technologies, Inc., Santa Clara, CA, USA) with an Intrada WP-RP column (0.46×25 cm, 3-µm particle size and 30-nm pore size; Imtakt, Kyoto, Japan). Collected fractions were digested with trypsin (Promega Corp., Madison, WI, USA) and analyzed by LC-MS/MS using a nanoflow LC-ESI linear ion trap-TOF NanoFrontier L mass spectrometer (Hitachi High-Technologies, Tokyo, Japan). Raw LC-ESI data were converted to peak list files using NanoFrontier L Data Processing software (Hitachi High-Technologies). The peak list files were used for protein identification with the MASCOT MS/MS ion search (http://www.matrixscience.com) and X! Tandem software (http://www.thegpm.org). Upon peptide sequence annotation, the UniProtKB/Swiss-Prot database (version 2016_10; Homo sapiens; http://www.uniprot.org/statistics/Swiss-Prot) was used with the following parameters: enzyme, trypsin or none (when used with the home-made dataset only); maximum number of missed cleavage, 1; peptide tolerance, 0.2 Da; MS/MS tolerance, 0.2 Da; variable modification, oxidation of methionine; and peptide charge, (1+, 2+ and 3+). All identified proteins with MASCOT threshold scores < 95% confidence level and peptide numbers <2 were then removed from the protein list using Scaffold software (http://www.proteomesoftware.com/products/scaffold/).
Exosomes and cells were lysed with 7.5 M urea-based lysis buffer as described above. Protein concentrations were determined by the Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Proteins (5 or 10 µg) were subjected to 8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto an Immobilon-P polyvinylidene fluoride (PVDF) membrane (0.45-mm pore size; EMD Millipore). PVDF membranes were blocked for 1 h at room temperature in Tris-buffered saline (10 mM Tris-HCl, pH 7.5, 150 mM NaCl) containing 0.01% Tween-20 and 5% non-fat dried milk (Wako Pure Chemical Industries). Blocked membranes were then incubated overnight at 4°C with primary monoclonal antibodies (listed in Table II). Membranes were then incubated for 1 h at room temperature with anti-mouse IgG antibodies conjugated with horseradish peroxidase (Table II). Specific proteins were visualized using an ECL Plus western blotting detection system (GE Healthcare, Wauwatosa, WI, USA) and a Fujifilm Luminescent Image Analyzer LAS3000 (Fujifilm, Tokyo, Japan). The molecular weight of each protein was deduced using Precision Plus Protein All Blue Standards (Bio-Rad Laboratories, Inc.).
Cells were cultured for 48 h, and total RNA was extracted using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) as previously described (15). RNA samples were quantified with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc.) and assessed using an Agilent 2100 Bioanalyzer and an RNA 6000 Nano Total RNA kit (both from Agilent Technologies, Inc.). Quantitative mRNA levels were determined using real-time RT-PCR using the Applied Biosystems 7900 HT Sequence Detection System, a TaqMan Gene Expression Assay for human EPS8 (assay ID Hs00610286_m1), and a Eukaryotic 18S rRNA Endogenous Control (Applied Biosystems; Thermo Fisher Scientific, Inc.). Only the probe sequence for EPS8 (TTGGATGAAAGCCAGAGCAGAGTGG) was provided by the manufacturer. The probes of EPS8 and 18S rRNA were labelled with FAM and VIC dyes, respectively. cDNA was generated using 100 ng of total RNA, and a High Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). RT-PCR was carried out in a total volume of 20 µl containing 100 ng of cDNA, TaqMan Fast Advanced Master Mix (Applied Biosystems), and the respective TaqMan target gene reagents. The amplification conditions were 95°C for 20 sec followed by 40 cycles of 95°C for 1 sec and 60°C for 20 sec. Samples were analyzed in triplicate as technical replicates. The EPS8 mRNA levels were defined from the cycle threshold (Ct), using the comparative Ct method (18), and each sample was normalized by comparison to 18S rRNA levels. The fold change of EPS8 mRNA levels in each cell line was determined using SU.86.86 cell EPS8 mRNA levels as a reference.
Student's t-test for comparison of cell motility between SU.86.86 and MIA PaCa-2 cell lines, the Pearson correlation coefficient to compare two variables in five analyses (exosomal Eps8 protein, intracellular Eps8 protein, intracellular Eps8 mRNA, migration, and invasion), and Multiple t-tests with Bonferroni-correction for comparison of three different cell origins of metastasis, ascites and primary tumors were used. P-values <0.05 were considered to indicate a statistically significant difference.
SU.86.86 cells were derived from a liver metastasis of a pancreatic ductal carcinoma (19). MIA PaCa-2 cells were derived from a primary pancreatic adenocarcinoma (20). Before proteome analysis, we first performed in vitro cell migration and invasion assays to evaluate if the two cell lines exhibited differences in metastatic-potential. The impedance-based RTCA has shown a strong correlation with the conventional Boyden chamber Transwell endpoint assay (15,21). Using the RTCA assay system, SU.86.86 cells had 23-fold greater cell migratory activity than did MIA PaCa-2 cells (Fig. 1A). Additionally, using a Matrigel barrier, SU.86.86 cells were found to be 20-times more invasive than MIA PaCa-2 cells (Fig. 1B). Collectively, these results indicated that the in vitro cell migratory and invasive behaviors of SU.86.86 and MIA PaCa-2 cells were correlated with their metastatic and primary tumor cell origins, respectively.
The proteome profiles of SU.86.86 and MIA PaCa-2 cell-derived exosomes were analyzed using LC-MS/MS. After 48 h of cell growth, exosomes were isolated from culture media by a series of filtration and ultracentrifugation steps as previously described (15,16). Proteome data processing identified a total of 133 proteins from exosomes derived from both cell lines (Fig. 2A, Table III). Among them, 31 proteins were identified in the exosomes of both cell types. A total of 101 proteins were uniquely identified in SU.86.86 cell-derived exosomes, and a single unique protein, histone H2A type 2-B (H2A2B), was identified in MIA PaCa-2 cell-derived exosomes.
To identify the SU.86.86 cell-specific exosomal proteins, we compared the 101 SU.86.86 cell-specific proteins with those that had been previously identified in exosomes derived from human duodenal cancer cell lines AZ-521 and AZ-P7a (Fig. 2A) (15). This comparison identified 82 proteins that were unique to SU.86.86 cell-derived exosomes (Table IV). Of the 82 proteins unique to SU.86.86, Eps8 revealed relatively high MS/MS values, including the number of matched peptides, the rate of sequence coverage, and the total spectral count. Furthermore, the Eps8 expression was elevated in pancreatic cancer cells derived from ascites and metastasis (22). Therefore, we chose to validate the presence of Eps8 in exosomes by western blot analysis.
Table IV.List of proteins specifically identified in exosomes derived from SU.86.86 compared to other cancer cell lines. |
Western blot analyses revealed that the Eps8 protein was abundant in SU.86.86 cell-derived exosomes, while no immunoreactive Eps8 signals were detected in MIA PaCa-2 cell-derived exosomes (Fig. 2B). Furthermore, intracellular Eps8 expression levels were much higher in SU.86.86 cells than in MIA PaCa-2 cells, indicating a positive correlation with tumor malignancy, as previously reported (22). Comparison of the house-keeping proteins in the exosomes of both cell types revealed variation in glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels and no immunoreactive signals for α-tubulin, making them unsuitable for normalizing exosomal protein levels previously described (15).
Eps8 was specifically detected in exosomes from metastatic-derived SU.86.86 cells. Therefore, we assessed exosomal Eps8 protein levels in other pancreatic cancer cell lines. Western blot analysis revealed positive immunoreactive Eps8 signals in exosomes from metastasis-derived pancreatic cancer cell lines, including CFPAC-1, KP-3, PK-45H, PK-8 and Capan-1 (Fig. 3A). Additionally, positive immunoreactive Eps8 signals were observed in exosomes from ascites-derived pancreatic cancer cell lines, including HuP-T3, HuP-T4 and AsPC-1. In contrast, Capan-2 was the only primary tumor cell line that exhibited Eps8 immunoreactivity. Densitometric analysis, using relative amounts of exosomal Eps8 protein, was used to quantify the Eps8 immunoreactivities observed (Fig. 4). The level of Eps8 immunoreactivity in the exosomes of different cell lines was assessed relative to that observed in SU.86.86 cell-derived exosomes, which was given a value of 1.0. The relative Eps8 immunoreactivity was 0.76, 0.15 and 0.17 in metastatic cell lines PK-45H, CFPAC-1 and KP-3, respectively. In ascites-derived cell lines HuP-T3, HuP-T4, and AsPC-1, and the Capan-2 primary tumor cell line, the relative Eps8 immunoreactivity was 0.49, 0.21, 0.15 and 0.55, respectively. Intracellular Eps8 levels varied among the cell lines, particularly those derived from metastasis (PK-1, PK-8, PK-59 and KLM-1) and primary tumors (MIA PaCa-2, BxPC-3, PANC-1 and Panc 10.05). Except for PK-8, there was either no Eps8 immunoreactivity, or less Eps8 immunoreactivity, relative to that observed intracellularly, observed in the exosomes of these cells. Also, distinct Eps8 immunoreactivity was observed in NUGC-4 and MKN45P stomach cancer cell lines and the LoVo colon cancer cell line (Fig. 3B). Furthermore, cells with relatively high intracellular Eps8 protein levels expressed greater amounts of EPS8 mRNA (Fig. 4). However, Eps8 protein and mRNA expression levels did not correlate with the amount of Eps8 in exosomes. Collectively, these results revealed that, particularly in pancreatic cancer cells derived from metastasis and ascites, Eps8 was secreted into the extracellular environment via exosomes.
It was revealed that Eps8 protein is present in the exosomes of several pancreatic cancer cell lines in addition to SU.86.86. Therefore, we evaluated the in vitro cell migratory and invasive activities in 12 pancreatic cancer cell lines. The highest levels of migratory and invasive activities were observed in SU.86.86 cells, and these were set at a value of 1 to allow for comparison (Fig. 5). The metastatic PK-45H cell line, with the relative exosomal Eps8 protein level of 0.76, revealed relatively high levels of cell migratory (0.64) and invasive activities (0.56). Additionally, in ascites-derived HuP-T4 cells, with the relative exosomal Eps8 protein level of 0.21, relatively high levels of cell migratory (0.36) and invasive activities (0.84) were observed. However, no cell motility was detected in stomach cancer-derived NUGC-4 cells and colon cancer-derived LoVo cells, which exhibited moderate levels of exosomal Eps8 immunoreactivities (Fig. 3).
Integrative comparison of the data revealed that similar to SU.86.86 cells, PK-45H cells consistently had the highest levels of in vitro cell migratory and invasive activities, exosomal and intracellular Eps8 protein, and EPS8 mRNA expression (Fig. 6A and B). Furthermore, using the Pearson correlation coefficient, we identified that exosomal Eps8 levels were significantly correlated with migratory cell levels (r=0.85, P=4.2×10−4) (Fig. 6C). Therefore, we proposed that exosomal Eps8 protein level is indicative of metastatic potential in human pancreatic cancer cells.
The present study revealed abundant levels of Eps8 protein in exosomes derived from pancreatic cancer cell lines. Furthermore, it was revealed that exosomal Eps8 levels were significantly correlated with migratory cell potential (Fig. 6C). Eps8 was initially identified as a substrate for the epidermal growth factor (EGF) receptor that enhances EGF-dependent mitogenic signals (23,24). Overexpression of Eps8 has been revealed to promote cellular proliferation and/or migration in various tumor types, including breast cancer (25), malignant glioma (26,27), pituitary tumors (28), oral squamous cell carcinoma (29), and cervical cancer (30). In Eps8-mediated tumorigenesis and proliferation, stimulated EGFR results in the activation of downstream pathways, including Eps8/Ras/MAPK, Eps8/Akt/FoxM1 and Eps8/mTOR/STAT3 were revealed (31).
Eps8 expression was enhanced in pancreatic cancer at both protein and mRNA levels (22), and Eps8 upregulation was immunohistochemically detected in 72% of paraffin-embedded clinical specimens (32). Welsch et al demonstrated that Eps8 expression levels were correlated with the degree of malignancy in pancreatic cancer cell lines (22). They found low levels of Eps8 expression in cell lines from primary pancreatic cancers (MIAPaCa-2, BxPC-3, and PANC-1), moderate Eps8 expression levels in cell lines from metastasis (SU.86.86 and Capan-1), and high Eps8 expression level in a cell line from malignant ascites (AsPC-1) (22). Additionally, their Eps8 expression levels were positively correlated with migratory potential (BxPC-3 < PANC-1<Capan-1<AsPC-1). In the present study, a moderate correlation between cell migratory capacity and intracellular Eps8 protein expression levels (r=0.65, P=2.0×10−2) was revealed but not between cell migratory capacity and intracellular EPS8 mRNA expression levels (r=0.44, P=1.5×10−1) (Fig. 6C). However, we identified a significant correlation between exosomal Eps8 protein levels and migratory cell capacity (r=0.85, P=4.2×10−4). The pancreatic cancer cell lines that exhibited relatively high exosomal Eps8 protein levels were SU.86.86 and PK-45H from metastasis, HuP-T3 from ascites, and Capan-2 from primary tumor cells (Figs. 3A and 6B). Despite originating from primary tumor cells, Capan-2 exhibited moderate cell migratory activity (Figs. 5A and 6B). These results were consistent with those revealing that Capan-2 possessed metastatic potential to the liver after being inoculated into nude mice (33). AsPC-1 cells, derived from ascites, have been previously revealed to have intracellular Eps8 protein and mRNA expression levels and migratory cell potential greater than those of metastasis-derived SU.86.86 cells (22). In our study, AsPC-1 cells had lower levels of intracellular and exosomal Eps8 protein and migratory cell levels than did SU.86.86 cells (Figs. 3A, 5A and 6B). We assume that these different results for AsPC-1 cells are at least due to culture conditions for maintenance of the cell line and preparation of samples. Additionally, among three groups of pancreatic cancer cell lines with different degrees of malignancy, intracellular Eps8 expression levels were significantly higher in cells from metastasis than in those from ascites (P=0.01628, the Bonferroni-corrected threshold for multiple t-tests =0.01667, α=0.05). Eps8 expression in ascites-derived cell lines did not significantly differ from that of primary tumor-derived cell lines (P=0.634). Eps8 expression levels in metastasis-derived cell lines were significantly higher than in primary tumor-derived cell lines (P=0.01662). We compared the levels of exosomal Eps8 protein, intracellular Eps8 mRNA, migratory and invasive activities of metastasis-, ascites-, and primary tumor-derived cell line groups and found no significant differences. Therefore, the present study indicated that there is a strong relationship between exosomal Eps8 protein level and migratory cell potential.
Exosomes play an essential role in tumor metastasis (34). Eps8 is involved in metastasis, and inhibiting Eps8 expression results in decreased levels of cell motility (26,30,32). The Eps8 protein localizes to lysosomes via the late endosomes, which function as a pre-degenerative compartment (35). The late endosomes also function as a recycling compartment, leading to extracellular secretion via fusion with the plasma membrane (1,36,37). Collectively, with the present results, it may be inferred that Eps8 protein is recruited to late endosomes, leading to either inclusion in lysosomes or extracellular secretion. Our results revealed that in pancreatic cancer cell lines with high migratory potential, Eps8 protein abundance in exosomes occurs through extracellular secretion. These observations indicated that exosomal Eps8 has a potential to be a metastatic biomarker for pancreatic cancer. Further studies need to be performed using clinical samples to validate this hypothesis. For validation, it is conceivable to use an ELISA system, which can easily detect secreted proteins in serum or plasma blood samples. For proteins embedded in exosomes, such as Eps8, it is challenging to develop an ELISA system, since detergents that may affect the assay are used for exosome lysis during the sample preparation.
Not applicable.
The present study was supported by the JSPS KAKENHI grant nos. JP26430150 and JP16K10523 to K.O.
The datasets used during the present study are available from the corresponding author upon reasonable request.
KO made substantial contributions to the design of the study, drafting of the manuscript, cell culture and the preparation of the exosomes. KH, KWN and NS were responsible for the proteome analysis using LC-MS/MS. KK and TI performed the western blotting experiments. KK, YW and SM were involved in RNA preparation and RT-PCR analysis. KY and TM supervised the study and analyzed the data. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.
This article contains no studies with human participants performed by any of the authors.
Not applicable.
The authors declare that they have no competing interests.
|
CM |
culture medium |
|
Ct |
cycle threshold |
|
EGF |
epidermal growth factor |
|
Eps8 |
epidermal growth factor receptor pathway substrate 8 |
|
FBS |
fetal bovine serum |
|
GAPDH |
glyceraldehyde 3-phosphate dehydrogenase |
|
LC-MS/MS |
liquid chromatography-mass spectrometry |
|
RTCA |
real-time cell analysis |
|
SDS-PAGE |
SDS-polyacrylamide gel electrophoresis |
|
Colombo M, Raposo G and Théry C: Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu Rev Cell Dev Biol. 30:255–289. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Greening DW, Xu R, Gopal SK, Rai A and Simpson RJ: Proteomic insights into extracellular vesicle biology-defining exosomes and shed microvesicles. Expert Rev Proteomics. 14:69–95. 2007. View Article : Google Scholar | |
|
Kalluri R: The biology and function of exosomes in cancer. J Clin Invest. 126:1208–1215. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Soung YH, Ford S, Zhang V and Chung J: Exosomes in cancer diagnostics. Cancers. 9:82017. View Article : Google Scholar : | |
|
Choi DS, Kim DK, Kim YK and Gho YS: Proteomics, transcriptomics and lipidomics of exosomes and ectosomes. Proteomics. 13:1554–1571. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
EL Andaloussi S, Mäger I, Breakefield XO and Wood MJ: Extracellular vesicles: Biology and emerging therapeutic opportunities. Nat Rev Drug Discov. 12:347–357. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Ferlay J, Partensky C and Bray F: More deaths from pancreatic cancer than breast cancer in the EU by 2017. Acta Oncol. 55:1158–1160. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Hanada K, Okazaki A, Hirano N, Izumi Y, Teraoka Y, Ikemoto J, Kanemitsu K, Hino F, Fukuda T and Yonehara S: Diagnostic strategies for early pancreatic cancer. J Gastroenterol. 50:147–154. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Nuzhat Z, Kinhal V, Sharma S, Rice GE, Joshi V and Salomon C: Tumour-derived exosomes as a signature of pancreatic cancer-liquid biopsies as indicators of tumour progression. Oncotarget. 8:17279–17291. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Le Large TYS, Bijlsma MF, Kazemier G, van Laarhoven HWM, Giovannetti E and Jimenez CR: Key biological processes driving metastatic spread of pancreatic cancer as identified by multi-omics studies. Semin Cancer Biol. 44:153–169. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Sasaki K, Sato K, Akiyama Y, Yanagihara K, Oka M and Yamaguchi K: Peptidomics-based approach reveals the secretion of the 29-residue COOH-terminal fragment of the putative tumor suppressor protein DMBT1 from pancreatic adenocarcinoma cell lines. Cancer Res. 62:4894–4898. 2002.PubMed/NCBI | |
|
Ogura S, Kaneko K, Miyajima S, Ohshima K, Yamaguchi K and Mochizuki T: Proneurotensin/neuromedin N secreted from small cell lung carcinoma cell lines as a potential tumor marker. Proteomics Clin Appl. 2:1620–1627. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Valadi H, Ekström K, Bossios A, Sjöstrand M, Lee JJ and Lötvall JO: Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 9:654–659. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Ohshima K, Kanto K, Hatakeyama K, Ide T, Wakabayashi-Nakao K, Watanabe Y, Sakura N, Terashima M, Yamaguchi K and Mochizuki T: Exosome-mediated extracellular release of polyadenylate-binding protein 1 in human metastatic duodenal cancer cells. Proteomics. 14:2297–2306. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Ohshima K, Inoue K, Fujiwara A, Hatakeyama K, Kanto K, Watanabe Y, Muramatsu K, Fukuda Y, Ogura S, Yamaguchi K and Mochizuki T: Let-7 microRNA family is selectively secreted into the extracellular environment via exosomes in a metastatic gastric cancer cell line. PLoS One. 5:e132472010. View Article : Google Scholar : PubMed/NCBI | |
|
Hatakeyama K, Ohshima K, Fukuda Y, Ogura S, Terashima M, Yamaguchi K and Mochizuki T: Identification of a novel protein isoform derived from cancer-related splicing variants using combined analysis of transcriptome and proteome. Proteomics. 11:2275–2282. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Drucker BJ, Marincola FM, Siao DY, Donlon TA, Bangs CD and Holder WD Jr: A new human pancreatic carcinoma cell line developed for adoptive immunotherapy studies with lymphokine-activated killer cells in nude mice. In Vitro Cell Dev Biol. 24:1179–1187. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Yunis AA, Arimura GK and Russin DJ: Human pancreatic carcinoma (MIA PaCa-2) in continuous culture: Sensitivity to asparaginase. Int J Cancer. 19:128–135. 1977. View Article : Google Scholar : PubMed/NCBI | |
|
Limame R, Wouters A, Pauwels B, Fransen E, Peeters M, Lardon F, De Wever O and Pauwels P: Comparative analysis of dynamic cell viability, migration and invasion assessments by novel real-time technology and classic endpoint assays. PLoS One. 7:e465362012. View Article : Google Scholar : PubMed/NCBI | |
|
Welsch T, Endlich K, Giese T, Büchler MW and Schmidt J: Eps8 is increased in pancreatic cancer and required for dynamic actin-based cell protrusions and intercellular cytoskeletal organization. Cancer Lett. 255:205–218. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Fazioli F, Minichiello L, Matoska V, Castagnino P, Miki T, Wong WT and Di Fiore PP: Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals. EMBO J. 12:3799–3808. 1993. View Article : Google Scholar : PubMed/NCBI | |
|
Castagnino P, Biesova Z, Wong WT, Fazioli F, Gill GN and Di Fiore PP: Direct binding of eps8 to the juxtamembrane domain of EGFR is phosphotyrosine- and SH2-independent. Oncogene. 10:723–729. 1995.PubMed/NCBI | |
|
Chen C, Liang Z, Huang W, Li X, Zhou F, Hu X, Han M, Ding X and Xiang S: Eps8 regulates cellular proliferation and migration of breast cancer. Int J Oncol. 46:205–214. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Cattaneo MG, Cappellini E and Vicentini LM: Silencing of Eps8 blocks migration and invasion in human glioblastoma cell lines. Exp Cell Res. 318:1901–1912. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Ding X, Zhou F, Wang F, Yang Z, Zhou C, Zhou J, Zhang B, Yang J, Wang G, Wei Z, et al: Eps8 promotes cellular growth of human malignant gliomas. Oncol Rep. 29:697–703. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Xu M, Shorts-Cary L, Knox AJ, Kleinsmidt-DeMasters B, Lillehei K and Wierman ME: Epidermal growth factor receptor pathway substrate 8 is overexpressed in human pituitary tumors: Role in proliferation and survival. Endocrinology. 150:2064–2071. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Yap LF, Jenei V, Robinson CM, Moutasim K, Benn TM, Threadgold SP, Lopes V, Wei W, Thomas GJ and Paterson IC: Upregulation of Eps8 in oral squamous cell carcinoma promotes cell migration and invasion through integrin-dependent Rac1 activation. Oncogene. 28:2524–2534. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Li Q, Bao W, Fan Q, Shi WJ, Li ZN, Xu Y and Wu D: Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition. Mol Med Rep. 14:3220–3228. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Li YH, Xue TY, He YZ and Du JW: Novel oncoprotein EPS8: A new target for anticancer therapy. Future Oncol. 9:1587–1594. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Tod J, Hanley CJ, Morgan MR, Rucka M, Mellows T, Lopez MA, Kiely P, Moutasim KA, Frampton SJ, Sabnis D, et al: Pro-migratory and TGF-β-activating functions of αvβ6 integrin in pancreatic cancer are differentially regulated via an Eps8-dependent GTPase switch. J Pathol. 243:37–50. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Uchima Y, Sawada T, Nishihara T, Maeda K, Ohira M and Hirakawa K: Inhibition and mechanism of action of a protease inhibitor in human pancreatic cancer cells. Pancreas. 29:123–131. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Peinado H, Zhang H, Matei IR, Costa-Silva B, Hoshino A, Rodrigues G, Psaila B, Kaplan RN, Bromberg JF, Kang Y, et al: Pre-metastatic niches: Organ-specific homes for metastases. Nat Rev Cancer. 17:302–317. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Welsch T, Younsi A, Disanza A, Rodriguez JA, Cuervo AM, Scita G and Schmidt J: Eps8 is recruited to lysosomes and subjected to chaperone-mediated autophagy in cancer cells. Exp Cell Res. 316:1914–1924. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Théry C, Zitvogel L and Amigorena S: Exosomes: Composition, biogenesis and function. Nat Rev Immunol. 2:569–579. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Théry C, Ostrowski M and Segura E: Membrane vesicles as conveyors of immune responses. Nat Rev Immunol. 9:581–593. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Yonemura Y, Endo Y, Yamaguchi T, Fujimura T, Obata T, Kawamura T, Nojima N, Miyazaki I and Sasaki T: Mechanisms of the formation of the peritoneal dissemination in gastric cancer. Int J Oncol. 8:795–802. 1996.PubMed/NCBI | |
|
Nishimori H, Yasoshima T, Denno R, Shishido T, Hata F, Okada Y, Ura H, Yamaguchi K, Isomura H, Sato N, et al: A novel experimental mouse model of peritoneal dissemination of human gastric cancer cells: Different mechanisms in peritoneal dissemination and hematogenous metastasis. Jpn J Cancer Res. 91:715–722. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
López-Terrada D, Cheung SW, Finegold MJ and Knowles BB: Hep G2 is a hepatoblastoma-derived cell line. Hum Pathol. 40:1512–1515. 2009. View Article : Google Scholar |