Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June-2019 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2019 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells

  • Authors:
    • Pei‑Bin Lin
    • Juan Shen
    • Pei‑Yu Ou
    • Ling‑Yan Liu
    • Zhi‑Yu Chen
    • Fu‑Jiang Chu
    • Jie Wang
    • Xiao‑Bao Jin
  • View Affiliations / Copyright

    Affiliations: School of Basic Courses, Guangdong Pharmaceutical University, Guangzhou Higher Education Mega Center, Guangzhou, Guangdong 510006, P.R. China, Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou, Guangdong 510006, P.R. China
  • Pages: 3377-3385
    |
    Published online on: April 2, 2019
       https://doi.org/10.3892/or.2019.7089
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Serratia marcescens are considered to be abundant and optimal resources for obtaining prodigiosin, which can be isolated from soil, water, plants and air but rarely from insects. In the present study, a strain of Serratia marcescens named WA12‑1‑18 was isolated from the gut of Periplaneta americana, which was capable of producing high levels of pigment reaching 2.77 g/l via solid fermentation and was identified as prodigiosin by ultraviolet, high performance liquid chromatography (LC), Fourier‑transform infrared spectroscopy, LC‑mass spectroscopy and nuclear magnetic resonance. The apoptotic tumor cells treated with prodigiosin were examined by 4',6‑diamidino‑2‑phenylindole (DAPI) staining assays and transmission electron microscopy. Flow cytometry (FCM) was utilized to measure the apoptotic rate with Annexin V staining and the expression levels of proteins involved in apoptosis, including B‑cell lymphoma 2 (Bcl‑2), Bcl‑2‑associated X (Bax) and caspase‑3 were determined by western blot analysis and reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). The experimental results revealed that prodigiosin could inhibit the proliferation of HeLa cells and the half‑maximal inhibitory concentration values of prodigiosin in HeLa were 2.1, 1.2 and 0.5 µg/ml over 24, 48 and 72 h, respectively. Furthermore, DAPI staining assays and transmission electron microscopy clearly demonstrated that prodigiosin could induce HeLa cell apoptosis. FCM results revealed that the cell apoptotic rates were 19.7±1.4, 23.7±2.4 and 26.2±2.3% following the treatment with 0.5, 1.0 and 2.0 µg/ml prodigiosin for 48 h, respectively. Western blot analysis and RT‑qPCR revealed that prodigiosin could activate apoptosis‑associated molecules including Bcl‑2, Bax and caspase‑3. Therefore, the results of the present study demonstrated that the prodigiosin could induce apoptosis in HeLa cells, which may be associated with the upregulation of Bax and caspase‑3, the concomitant downregulation of Bcl‑2 levels and also triggering the extrinsic apoptotic signaling pathway.

Introduction

Serratia marcescens can be isolated from soil, water, plants and air but rarely from insects (1). Periplaneta americana (a type of American cockroach) is one of the most common household pests, found around drainage basins, sewage ducts, garbage and wall slots. However in China, it is a traditional Chinese medicine used in anti-inflammatory, antiviral, antioxidant and anticancer treatments (2). It has been reported that the extractive Periplaneta americana exerts these effects on cancer cell lines such as human cervical cancer cells (HeLa), human hepatoma cells (Bel-7402) and human lung cancer cells (H125) (3,4). Microorganisms in the gut of insects interact with each other, as well as their hosts and their environment. These interactions are thought to have the capacity to degrade the protein and protect the host against diseases through producing secondary metabolites. Serratia marcescens, a Gram-negative bacterium, has been reported to produce a large quantity of prodigiosin (5,6). Prodigiosin (2-methyl-3-pentyl-6- methoxyprodiginine) is a red colored secondary metabolite that belongs to a class of tripyrrole compounds. Prodigiosin has also shown effective antimalarial, antifungal and immunosuppressive activities, as well as anticancer activities (7–9).

In the present study, we successfully isolated a strain of Serratia marcescens named WA12-1-18 from the gut of Periplaneta americana, which was capable of producing high levels of pigment reaching 2.77 g/l via solid fermentation, which was identified as prodigiosin by ultraviolet (UV), high performance liquid chromatography (HPLC), Fourier-transform infrared spectroscopy (FTIR), LC-mass spectroscopy (LC-MS) and nuclear magnetic resonance (NMR). The aim of the present study was to analyze the antitumor effect of prodigiosin and investigate the mechanisms underlying apoptosis in HeLa cells in vitro.

Materials and methods

Isolation of Serratia marcescens from the gut of Periplaneta americana

All Periplaneta americana samples were collected from the dormitories and the outdoor surroundings of Guangdong Pharmaceutical University (Guangdong, China), which were identified morphologically and molecularly. Periplaneta americanas were fasted for 3 days and then sacrificed following anesthesia with 100% CO2 for 2 h. They were then washed with distilled water. Sterilization was conducted with 75% ethanol and 3.5% sodium hypochlorite/water solution followed by 3 washes with 1X sterile phosphate-buffered saline (PBS). The entire gut of the Periplaneta americana was extracted from the abdomen and then ground into a slurry. The bacterial fluid was diluted into 0.01, 0.005 and 0.00025 µg/ml by gradient, coated on the agar-solidified Luria-Bertani (LB) medium (Amresco, LLC, Solon, OH, USA), which contained of 75 µg/ml potassium dichromate, and then incubated in the dark at 28°C for a week (10). The morphology and surface characteristics of the bacterial colonies were examined using a scanning electron microscope. Finally, the red-pigment-producing bacterial strain was named, WA12-1-18.

Molecular identification of Serratia marcescens

The strain WA12-1-18 was cultured in LB medium broth for 2 days with shaking at 37°C and harvested by centrifugation (12,000 × g at 20°C for 15 min). DNA was extracted and amplified by polymerase chain reaction (PCR) using the genomic DNA as a template and the bacterial universal primers, 27 forward (5′-GAGTTTGATCACTGGCTCAG-3′) and 1492 reverse (5′-TACGGCTACCTTGTTACGACTT-3′). The PCR mixture (25 µl) contained 1 µl of template DNA, 2.5 µl of 10X Taq DNA polymerase buffer, 1.5 µl primers (each) and 18.5 µl ddH2O. The PCR mixture was then incubated with the following thermocycling conditions: 94°C for 3 min, followed by 35 cycles of 94°C for 0.5 min, 58°C for 0.5 min and 72°C for 1.5 min, followed by a final extension performed at 72°C for 10 min (11). The amplification products were purified using a DNA purification kit (Qiagen, Inc. Valencia, CA, USA), and sequencing was performed by Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Phylogenetic trees were then constructed from evolutionary distances using the neighbor-joining method (12).

Extraction of prodigiosin

A single colony was inoculated in 10 ml of LB medium and incubated for 12 h at 37°C, and then transferred into 200 ml LB medium and incubated for a further 3 days at 37°C. Then, 250 µl bacterial cultures were spread onto LB solid plates and incubated in the dark at a low temperature (23°C) for 72 h (13). The lawn plates were harvested and dissolved in ethanol and centrifuged at 10,000 × g for 20 min at 4°C. The upper layer was collected, dried and re-dissolved in ethylacetate, the pigment was purified by silica gel column chromatography (28×12 cm) with petroleum ether and ethylacetate/n-hexane (40:1, v:v), as described previously (14,15). At the end of these procedures, the pigment fractions were pooled and dried.

Identification of prodigiosin

As described previously (16), prodigiosin was analyzed via HPLC at the absorption wavelength 534 nm using Phenomenex Luna C-182 semipreparative column (250×10 mm; sample, 5 µl; Phenomenex, Torrance, CA, USA) with the Bio-Rad HPLC system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The separation was performed using water (solvent A) and acetonitrile/methanol (1:1; solvent B) mobile phases, and a gradient elution program at 3 ml/min with the following parameters: 0–25 min 15–100% B (linear gradient), 25–35 min 100% B and 35–40 min 15% B to re-equilibrate the column. Fractions containing the targeted compounds were combined and concentrated by solvent evaporation. UV absorption of prodigiosin in methanol at pH 5 and pH 9 was scanned using a spectrophotometer at a range of 200–800 nm. In the FTIR study, FTIR spectra were made on a Nicolet Nexus 670 FT-IR infrared spectrometer. All spectra were taken using the Attenuated Total Reflection method (17). Briefly, prodigiosin was mixed with potassium bromide in a clean glass pestle and compressed to produce a pellet. Scanning was performed following base line correction by setting a wave number range of 400–4,000/cm−1. In LC-MS analysis, the pigment was dissolved in acetonitrile, and 10 µl was analyzed in API-4000 Q trap LC-MS/MS. The operating conditions were as follows: 4,500 ionization voltage, 350°C ionization temperature, ionization mode ESI positive, a MS C18 (50×4.6 mm) column was used, 90:10 (acetonitrile:water) mobile phase, and the injection volume was 10 µl with a flow rate of 0.5 ml/min; performed as described previously (18). In addition, prodigiosin dissolved in d-chloroform was analyzed by hydrogen (1H)-NMR and carbon-13 (13C)-NMR to identify the structure of the purified product. NMR characterization (1H NMR or 13C NMR) was performed using the pulse program zg30 with a spectral width of 8,278.146 Hz using Bruker Advance 400 MHz NMR spectrophotometer (Bruker Corporation, Ettlingen, Germany) with 5 mm probe in CDCl3 solvent.

Detection of the cell proliferation assay of prodigiosin

The HeLa cell line (Experimental Animal Center of Sun Yat-sen University, Guangzhou, China) was maintained in Dulbecco's modified Eagle's medium. An MTT assay was used to measure the levels of cell proliferation. A total of 5×104 cells were treated with different concentrations (0, 0.5, 1.0 and 2.0 µg/ml) of prodigiosin for 24, 48 and 72 h at 37°C, followed by incubation in MTT (0.1 mg/ml) at 37°C for 4 h and dissolution in dimethyl sulfoxide at room temperature for 10 min. Microplate reader (at 570 nm) was used to measure the absorbance of each well. Three independent experiments were performed (19–21).

DAPI staining and transmission electron microscopy (TEM)

In order to view the nucleus, 5×104 HeLa cells were fixed in methanol, incubated with DAPI for 10 min at 37°C (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China; cat. no. KGA215-10), and analyzed using a fluorescence microscope (22). HeLa cells (5×105) were treated with different concentrations of prodigiosin (0, 0.5, 1.0 and 2.0 µg/ml) for 24 h in 6-well plate. The HeLa cells were then harvested, washed with PBS and fixed with 2.5% glutaraldehyde at 4°C for 12 h. Following washing with PBS, HeLa cells were dehydrated with ethanol and acetone, sequentially fixed with 1% osmium tetroxide (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 2 h at 37°C, followed by embedding in epoxy resin for 12 h at 37°C. Ultra-thin slices (80 nm) were then produced, stained with 1.0% uranylacetate for 5 min at room temperature and viewed on a transmission electron microscope (23,24).

Detection of apoptosis by flow cytometry

Since the emission wavelength of prodigiosin was similar to that of propidium iodide, the levels of apoptosis were detected using Annexin V. HeLa cells (5×105) were treated with prodigiosin in a concentration- (0, 0.5, 1.0 and 2.0 µg/ml) and time (24, 36 and 48 h)-dependent manner at 37°C. Following the different exposure times, cells were washed with PBS and resuspended in 150 ml of binding buffer, which contained 5 ml of Annexin V-fluorescein isothiocyanate (Biolegend Inc., San Diego, CA, USA; cat. no. 640912) and were incubated at room temperature for 15 min. The cells were analyzed using a FACScan flow cytometer and the associated software (Becton, Dickinson and Company, Franklin Lakes, NJ, USA).

Detection of the apoptotic pathway using western blotting and reverse transcription-quantitative PCR (RT-qPCR)

Western blotting was performed as previously described (25). The human caspase-3 antibody (cat. no. 9662) was purchased from Bioworld Technology, Inc. (St. Louis Park, MN, USA), and the human B-cell lymphoma 2 (Bcl-2; cat. no. 2872), Bcl-2-associated X (Bax; cat. no. 2774) antibodies and β-actin (cat. no. 8457; dilution of all primary antibodies; 1:1,000) were purchased from Bosterbio Biological Technology (Pleasanton, CA, USA). The membranes were washed with Tris-buffered saline with 0.1% Tween-20 (TBST) 3 times and incubated with secondary horseradish peroxidase-conjugated antibodies (Anti-rabbit Immunoglobulin G; cat. no. 7074; Thermo Fisher Scientific, Inc.; dilution, 1:5,000) at 25°C for 2 h. Membranes were then washed with TBST 3 more times and immune reactive protein bands were detected using an enhanced chemiluminescence kit (Beijing Transgen Biotech Co., Ltd., Beijing, China). Image Quant TL 7.0 software (GE Healthcare, Chicago, IL, USA) was employed to quantify protein expression levels. For RT-qPCR, following the supplier's protocol, TRIzol™ reagent (Promega Corporation, Madison, WI, USA) was used to extract the total RNA of HeLa cells that were treated with different concentrations (0, 0.5, 1.0 and 2.0 µg/ml) of prodigiosin, as aforementioned. RNA was quantitated by optical density measurement using a spectrophotometer. The RT-for-PCR Kit (Promega Corporation) was used for RT-PCR. Briefly, 1 µg total RNA with 1 µl 20 µM oligo(dT)18 primers was heated at 70°C for 2 min, then quenched rapidly on ice. The RT reaction was followed by the addition of 4 µl 5X Reaction buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 1 µl dNTP mixture (10 mM each dATP, dGTP, dCTP and dTTP), 20 U recombinant RNase inhibitor and 200 U MMLV reverse transcriptase in a 20 µl reaction volume. Samples were incubated at 42°C for 1 h in an air incubator, followed by inactivation of the reverse transcriptase at 95°C for 5 min. Then, 80 µl nuclease-free water was added to a final volume of 100 µl. RT-qPCR was performed using primer pairs for Bcl-2, Bax and GAPDH (Table I) with the SYBR-Green PCR Master mix (Promega Corporation) with the following thermocycling conditions: 1 cycle at 94°C for 4 min, followed by 20 cycles at 94°C for 30 sec and 68°C for 1.5 min, and finally 1 cycle at 68°C for 5 min. The ABI PRISM 7000 sequence detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the 2−∆∆Cq (26) method were used for quantitative analysis.

Table I.

List of oligonucleotides used in the present study.

Table I.

List of oligonucleotides used in the present study.

Primer namePrimer sequence (5′-3′)
Bcl-2F CTGTGGATGACTGAGTACC
Bcl-2R CAGCCAGGAGAAATCAAAC
Bax-F CTGACATGTTTTCTGACGGCAA
Bax-R GAAGTCCAATGTCCAGCCCA
GAPDH-F CTCTGCTCCTGTTCGAC
GAPDH-R ACGACCAAATCCGTTGACTC

[i] Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-asssociated; F, forward; R, reverse.

Statistical analysis

SPSS 19.0 statistical software (IBM Corp., Armonk, MA, USA) was used to evaluate the results. One-way analysis of variance was used for comparisons between multiple groups. For post hoc analyses, heterogeneity of variance was accepted if P>0.05, and the Least Significant Difference method was used. Otherwise, Dunnett's T3 method was used. Homogeneity of variance of the samples to be compared was tested using a Levene's test. The results were expressed as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of Serratia marcescens in the gut of Periplaneta americana

Observation of morphological characteristics revealed that the colony of strain surface was smooth, convex and shiny with a vivid red color (Fig. 1A). A straight pole shape with blunt ends and uneven surface waves were observed via micromorphological analysis (Fig. 1B). The 16S r DNA sequences of the red colony (comprising 1,562 nucleotides) were obtained and submitted to EzBioCloud (www.ezbiocloud.net/identify). The sequence exhibited the highest similarity (99.59%) to that of Serratia marcescens. A phylogenetic tree was constructed based on the 16S r DNA PCR products as well as on the coding gene sequences of the isolate and its nearest relatives (Fig. 1C). The strain was identified as Serratia marcescens and named WA12-1-18.

Figure 1.

Identification of Serratia marcescens from Periplaneta americana gut. (A) Morphological characteristics in Luria-Bertani medium broth. (B) Morphological characteristics as revealed by scanning electron microscopy (magnification, ×5,000). (C) Phylogenetic analysis of cloned 16S r DNA sequences.

Extraction and identification of prodigiosin

The red coating of the solid medium was collected following culture for 72 h at 23°C. The solubility test demonstrated that the dark-red powder had good solubility in polar solvent (MeOH and EtOAc) but rarely dissolved in water (Fig. 2A and B). The yield of prodigiosin was high, reaching 2.77 g/l, and the purity of this secondary metabolite produced by Serratia marcescens was 98.25% determined by HPLC (Fig. 2C). UV spectrophotometry revealed that the maximum absorptions were at 534 nm (pH=5.0) and 466 nm (pH=9.0; Fig. 2D). The FTIR peak assignments showed that the characteristic wave numbers (cm−1) were at 3,450 (N-H str aromatic), 2,924 and 2,853 (C-H2 str aliphatic), 1,729 (C-O str ether), and 1,631 and 1,581 (C=C, C=N str aromatic; Fig. 2E). The molecular mass determined by LC-MS was 324.207(m/z 324.207; Fig. 2F). The chemical shifts of prodigiosin were further confirmed by NMR spectroscopy (Fig. 2G and H): 1H-NMR (CDCl3, 300 MHz, ppm) δ 0.98 (3H, t, H11″), 1.29 (2H, m,H9″), 1.45 (2H, m, H10″), 1.59 (2H, m, H8″), 2.38 (2H, t, H7″), 2.47 (3H, s, H6″), 3.31 (1H,m, H3), 4.29 (1H, d, H3′), 4.88 (3H, s, OCH3), 5.10 (1H, brd, H3″), 5.34 (1H, m, H4), 6.37 (1H, brs, H6′),7.18 (1H, m, H2), 7.62 (1H, brs, H1), 7.71 (1H, brs, H1′); 13C-NMR (CDCl3, 75 MHz, ppm) δ 12.03 (C6″), 14.59 (C11″), 23.78(C10″), 23.90 (C7″), 26.79 (C8″), 30.94 (C9″), 37.84 (C3′), 59.57 (OCH3), 66.83 (C3), 95.46 (C6′), 108.79 (C4), 112.46 (C5′), 117.04 (C5), 123.67 (C2″), 128.35 (C2), 130.03 (C3″), 131.02(C4″), 132.50(C5″), 154.30 (C2′), and 169.22 (C4′). All characteristics corresponded to those of prodigiosin (C20H25N3O).

Figure 2.

Extraction and identification of prodigiosin. (A) Serratia marcescens spreading onto the Luria-Bertani solid plate and incubated in the dark at a low temperature (23°C) for 72 h. (B) Dry prodigiosin. (C) Purity test of prodigiosin by high performance liquid chromatography. (D) Ultraviolet absorption test of prodigiosin. (E) Fourier-transform infrared spectroscopy study of prodigiosin. (F) Liquid chromatography-mass spectroscopy analysis of prodigiosin. (G) Hydrogen-NMR and (H) carbon-13-NMR analysis of prodigiosin. NRM, nuclear magnetic resonance.

Detection of the cell proliferation assay of prodigiosin

Cell growth of prodigiosin-treated HeLa cells was measured by the MTT assay at different time points over 72 h of the treatment period. The results shown in Table II demonstrated a time- and dose-dependent decline in number of viable cells within 72 h of prodigiosin-treatment. Using the dose-response curves, the half-maximal inhibitory concentration (IC50) values of prodigiosin in HeLa were 2.1 µg/ml at 24 h, 1.2 µg/ml at 48 h and 0.5 µg/ml at 72 h, respectively.

Table II.

Inhibition effect of prodigiosin on HeLa cells by MTT assay.

Table II.

Inhibition effect of prodigiosin on HeLa cells by MTT assay.

24 h48 h72 h



GroupsInhibition rate (%)P-valueInhibition rate (%)P-valueInhibition rate (%)P-value
Control0–0–0–
0.5 µg/ml 14.3±2.7a0.040 25.5±1.2a0.007 41.5±1.2b0.005
1.0 µg/ml 26.3±3.1a0.039 40.7±2.3b0.006 74.7±2.3b0.003
2.0 µg/m 50.3±1.6b0.006 63.5±1.0c<0.0001 86.5±1.0c0.002
4.0 µg/ml 57.8±2.9b0.026 84.4±0.1c<0.0001 90.4±1.1c<0.0001
8.0 µg/ml 88.1±2.3c<0.0001 92.3±2.2c<0.0001 95.3±2.2c<0.0001
IC502.1 µg/ml 1.2 µg/ml 0.5 µg/ml

{ label (or @symbol) needed for fn[@id='tfn2-or-41-06-3377'] } According to the Shapiro-Tilk test, these results have a normal distribution, so one-way analysis of variance was used for comparisons between multiple groups.

a P<0.05

b P<0.01

c P<0.001 vs. control group. IC50, half-maximal inhibitory concentration.

DAPI staining and TEM

The results of the DAPI staining assay revealed that the number of apoptotic cells increased with the prodigiosin concentration following 24 h (Fig. 3A). The morphology of control HeLa cells at 0 µg/ml prodigiosin was used as the normal morphology (Fig. 3B). TEM revealed rich cell surface microvilli, normal nucleus and abundant cytoplasm; the endoplasmic reticulum can also be seen clearly. However, apoptosis was induced when HeLa cells were treated with 2 µg/ml prodigiosin (Fig. 3B), presenting no cell surface microvilli, folded nuclear membrane, increased nuclear heterochromatin and condensed chromatin. These phenomena suggested that the apoptotic process was induced by prodigiosin treatment.

Figure 3.

Effect of prodigiosin on HeLa cells as determined by DAPI staining and electron microscopy over 24 h. (A) DAPI staining (magnification, ×100) and (B) scanning electron microscopy (magnification, ×15,000). DAPI, 4′,6-diamidino-2-phenylindole.

Detection of apoptosis using flow cytometry

To gain further understanding of the mechanism underlying the inhibition of proliferation, the present study investigated the effect on apoptosis by flow cytometry. HeLa cells were treated with 0, 0.5, 1.0 and 2.0 µg/ml of prodigiosin for 24, 36 and 48 h, respectively. Annexin V stained cells were tested by flow cytometry for quantitation. There were Annexin V-negative and Annexin V-positive on the dot-plots, as well as the stages of apoptosis located on the upper quadrant of the dot-plot (data not shown). The results shown in Table III demonstrated that there were dose- and time-associated increases in the apoptosis of HeLa cells following prodigiosin treatment.

Table III.

Effect of prodigiosin on the apoptosis of HeLa cell as determined by flow cytometry.

Table III.

Effect of prodigiosin on the apoptosis of HeLa cell as determined by flow cytometry.

Groups24 h Apoptosis rate (%)P-value36 h Apoptosis rate (%)P-value48 h Apoptosis rate (%)P-value
Control1.2±0.5–2.8±1.1–2.6±0.6–
0.5 µg/ml3.8±0.70.068 8.5±1.2a0.043 19.7±1.4b0.006
1.0 µg/ml 6.2±1.2a0.046 10.9±1.9b0.008 23.7±2.4b0.003
2.0 µg/m 7.6±1.1a0.039 14.2±1.8b0.007 26.2±2.3b0.001

{ label (or @symbol) needed for fn[@id='tfn6-or-41-06-3377'] } According to the Shapiro-Tilk test, these results have a normal distribution, so one-way analysis of variance was used for comparisons between multiple groups.

a P<0.05

b P<0.01 vs. control group.

Detection of the apoptotic pathway using western blotting and RT-qPCR

To further elucidate the mechanism of apoptosis induced by prodigiosin, the present study evaluated the protein and mRNA levels of key regulators via western blotting and RT-qPCR. The results demonstrated that prodigiosin treatment could downregulate Bcl-2 levels, and concomitantly upregulate Bax and caspase-3 levels when compared with the control (0 µg/ml; Fig. 4A and B).

Figure 4.

Effect of prodigiosin on anti-apoptotic and proapoptotic gene expression. (A) The protein expression of Bcl-2, Bax and Caspase-3 on HeLa cells as determined by western blotting. (B) Reverse transcription-quantitative polymerase chain reaction detection of Bcl-2 and Bax mRNA levels using total RNA prepared from HeLa cells. *P<0.05 and **P<0.01 vs. control group (0 µg/ml). Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-asssociated X.

Discussion

The intestinal microbiota of insects has become a key area of interest in recent years (27). Periplaneta americanas are insects of the order Blattodea, some of which are associated with the human environment and carrier numerous microorganisms (28). There are few studies focusing on the endophytic bacteria in Periplaneta americana, especially Serratia marcescens. The microbial community in the gut is responsible for digestion, but how they participate and carry out this activity is unknown. The results of the present study therefore confirm the idea that the Periplaneta americana gut may be a specialized microhabitat of enhanced microbial activities (29). In the present study, the 16S r DNA gene based phylogenetic tree analysis showed the highest similarity (99.59%), confirming that Serratia marcescens was successfully isolated from the gut of Periplaneta americana. The authors hope that more novel microorganisms can be isolated in the group's future research. The Gram-negative bacterium Serratia marcescens is known for its ability to produce numerous secondary metabolites (30). Prodigiosin is one of the bioactivity secondary metabolites produced by Serratia marcescens. Low productivity of prodigiosin was reported under liquid fermentation (7). Therefore, in the present study, prodigiosin was obtained by solid fermentation. Compared with submerged fermentation, solid fermentation is simpler and more efficient in terms of the preparation of prodigiosin (31). Furthermore, the yield of prodigiosin from the gut of the cockroaches was 2.77 g/l, which was higher than that obtained from the body of a grasshopper and the common Serratia marcescens (32,33). It is possible that the intestinal bacteria may have the capacity to protect the host against diseases by producing secondary metabolites. The purity of prodigiosin was as high as 98.25%, as determined by HPLC, which was consistent with a previous study (34).

The structure of prodigiosin is similar to that of obatoclax, which is a Bcl-2 inhibitor (35). In the present study, prodigiosin treatment in a HeLa cell line was investigated and the results revealed that prodigiosin inhibited the proliferation of HeLa cells in a time- and dose-dependent manner, and the IC50 values were 0.5–2.1 µg/ml over 24, 48 and 72 h. In addition, another study showed that the A549 cell line was very sensitive to the prodigiosin analogue, with an IC50 value of ~2.2 mg/l (36). The results of the DAPI staining assay, flow cytometry and TEM demonstrated that prodigiosin levels increased in the apoptotic cell population in a dose- and time-dependent manner. The possible anticancer mechanisms of prodigiosin reviewed by Sruthy et al (29) is attributed as pH modulators, cell cycle inhibitors, DNA cleavage agents and mitogen activated protein kinase regulators. The present results suggested that prodigiosin-induced apoptosis may be due to the down regulation of Bcl-2 levels and the concomitant upregulation of Bax and caspase-3 levels in HeLa cells through the mitochondria pathway; these results were different from those of a previous study (37). Some studies have shown that prodigiosin from the supernatant of Serratia marcescens could induce apoptosis as an immunosuppressor in hematopoietic cancer cell lines (38). In addition, there is also evidence that prodigiosin-induced apoptosis could be associated with Bcl-2 and survivin inhibition in HT-29 cells (14). The most notable finding was that prodigiosin had nearly identical cytotoxic effects on the resistant cells when compared with their parental lines (14). An in vitro study also revealed that p53 was not induced by prodigiosin in Jurkat and HL-60 cells (39). These results suggest that prodigiosin induces apoptosis independently of p53 and DNA damage.

In conclusion, to the best of the our knowledge, the present study is the first to demonstrate that prodigiosin produced by Serratia marcescens in the Periplaneta americana gut has functions associated with inhibiting HeLa cell proliferation and promoting apoptosis. Therefore, prodigiosin isolated from Serratia marcescens from Periplaneta americana may represent a novel class of anticancer agent. However, due to the specific mechanism of apoptosis and complex regulation, the role of prodigiosin in apoptosis mechanisms requires further research to provide a theoretical and practical foundation for the future use of prodigiosin in cancer treatment.

Acknowledgements

Not applicable.

Funding

The present study was supported by a grant from the Public Welfare Research and Capacity Building Project of Guangdong Province (grant no. 2016A030303059).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

XBJ designed the experiments. PBL, JS, PYO, LYL and ZYC conducted the experiments. FJC and JW analyzed the experimental results. XBJ and PBL wrote the manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Elkenawy NM, Yassin AS, Elhifnawy HN and Amin MA: Optimization of prodigiosin production by Serratia marcescens using crude glycerol and enhancing production using gamma radiation. Biotechnol Rep. 14:47–53. 2017. View Article : Google Scholar

2 

Zhang HC, Geng FN and Shen YM: The insect gut microbiota plays crucial roles in modulating the interactions between the host and intestinal pathogens. Chin J Ethnomed Ethnopharmacy. 26:57–60. 2016.

3 

Wang J: Effect of Periplaneta americana extract on H125 lung cancer cells. Chin J Public Health. 30:1400–1402. 2014.

4 

Wang J and Xin L: Effects of Periplaneta americana L. Extract on human hepatoma cells Bel-7402. Chin J Modern Appl Pharm. 29:876–880. 2012.

5 

Oh DC, Kauffman CA, Jensen PR and Fenical W: Induced production of emericellamides A and B from the marine-derived fungus emericella sp. in competing co-culture. J Nat Prod. 70:515–520. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Rastogi S, Zhang D and Davis JT: The natural product prodigiosin binds G-quadruplex DNA. Supramolecular Chem. 28:1–12. 2016. View Article : Google Scholar

7 

Xia Y, Wang G, Lin X, Song X and Ai L: Solid-state fermentation with Serratia marcescens, Xd-1 enhanced production of prodigiosin by using bagasse as an inertia matrix. Annal Microbiol. 66:1239–1247. 2016. View Article : Google Scholar

8 

Nakashima T, Tamura T, Kurachi M, Yamaguchi K and Oda T: Apoptosis mediated cytotoxicity of prodigiosin-like red pigment produced by gamma proteobacterium and its multiple bioactivities. Biol Pharm Bull. 28:2289–2295. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Sumathi C, MohanaPriya D, Swarnalatha S, Dinesh MG and Sekaran G: Production of prodigiosin using tannery fleshing and evaluating its pharmacological effects. ScientificWorldJournal. 2014:290–327. 2014. View Article : Google Scholar

10 

Osei-Poku J, Mbogo CM, Palmer WJ and Jiggins FM: Deep sequencing reveals extensive variation in the gut microbiota of wild mosquitoes from Kenya. Mol Ecol. 21:5138–5150. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Suzuki N, Ohtaguro N, Yoshida Y, Hirai M, Matsuo H, Yamada YL, Imamura N and Tsuchiya T: A compound inhibits biofilm formation of staphylococcus aureus from streptomyces. Biol Pharm Bull. 38:889–892. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Douglas AE: Multiorganismal insects: Diversity and function of resident microorganisms. Annu Rev Entomol. 60:17–34. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Someya N, Nakajima M, Hamamoto H, Yamaguchi I and Akutsu K: Effects of light conditions on prodigiosin stability in the biocontrol bacterium Serratia marcescens, strain b2. J General Plant Pathol. 70:367–370. 2004. View Article : Google Scholar

14 

Hassankhani R, Sam MR, Esmaeilou M and Ahangar P: Prodigiosin isolated from cell wall of Serratia marcescens alters expression of apoptosis-related genes and increases apoptosis in colorectal cancer cells. Med Oncol. 32:3662015. View Article : Google Scholar : PubMed/NCBI

15 

Miao L, Wang X, Jiang W, Yang S, Zhou H, Zhai Y, Zhou X and Dong K: Optimization of the culture condition for an antitumor bacterium serratia proteamacula 657 and identification of the active compounds. World J Microbiol Biotechnol. 29:855–863. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Patil CD, Patil SV, Salunke BK and Salunkhe RB: Prodigiosin produced by Serratia marcescens NMCC46 as a mosquito larvicidal agent against Aedes aegypti and Anopheles stephensi. Parasitol Res. 109:1179–1187. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Marsac P, Pierard N, Porot L, Wim Van den bergh, Grenfell J, Mouillet V, Pouget S, Besamusca J, Farcas F, Gabet T, et al: Potential and limits of FTIR methods for reclaimed asphalt characterization. Materials Structures. 47:1273–1286. 2014. View Article : Google Scholar

18 

Pradeep S, Sarath Josh MK, Balachandran S, Sudha Devi R, Sadasivam R, Thirugnanam PE, Doble M, Anderson RC and Benjamin S: Achromobacter denitrificans, SP1 produces pharmaceutically active 25C prodigiosin upon utilizing hazardous di(2-ethylhexyl)phthalate. Bioresour Technol. 171:482–486. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Danevčič T, Borić Vezjak M, Tabor M, Zorec M and Stopar D: Prodigiosin induces autolysins in actively grown bacillus subtilis cells. Front Microbiol. 7:272016. View Article : Google Scholar : PubMed/NCBI

20 

Kimyon Ö, Das T, Ibugo AI, Kutty SK, Ho KK, Tebben J, Kumar N and Manefield M: Serratia secondary metabolite prodigiosin inhibits Pseudomonas aeruginosa biofilm development by producing reactive oxygen species that damage biological molecules. Front Microbiol. 7:9722016. View Article : Google Scholar : PubMed/NCBI

21 

Darshan N and Manonmani HK: Prodigiosin inhibits motility and activates bacterial cell death revealing molecular biomarkers of programmed cell death. AMB Express. 6:502016. View Article : Google Scholar : PubMed/NCBI

22 

Lee DJ, Lee JB, Jang HA, Ferrandon D and Lee BL: An antimicrobial protein of the riptortus pedestris, salivary gland was cleaved by a virulence factor of Serratia marcescens. Dev Comp Immunol. 67:427–443. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Chen W, Liu Y, Zhang L, Gu X, Liu G, Shahid M, Gao J, Ali T and Han B: Nocardia cyriacigeogica from bovine mastitis induced in vitro apoptosis of bovine mammary epithelial cells via activation of mitochondrial-caspase pathway. Front Cell Infect Microbiol. 7:1942017. View Article : Google Scholar : PubMed/NCBI

24 

Zhang J, Liu H, Sun Z, Xie J, Zhong G and Yi X: Azadirachtin induced apoptosis in the prothoracic gland in Bombyx mori and a pronounced Ca2+ release effect in Sf9 cells. Int J Biol Sci. 13:1532–1539. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Zheng B, Zhou Y, Zhang H, Yang G, Hong Z, Han D, Wang Q, He Z, Liu Y, Wu F, et al: Dl-3-n-butylphthalide prevents the disruption of blood-spinal cord barrier via inhibiting endoplasmic reticulum stress following spinal cord injury. Int J Biol Sci. 13:1520–1532. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Demain AL and Fang A: The natural functions of secondary metabolites. Adv Biochem Eng Biotechnol. 69:1–39. 2000.PubMed/NCBI

28 

Kan SC, Zang CZ, Yeh CW, Chang WF, Lin CC, Hung TH, Shieh CJ and Liu YC: Enhanced bioconversion rate and released substrate inhibition in (R)-phenylephrine whole-cell bioconversion via partial acetone treatment. Enzyme Microb Technol. 86:34–38. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Sruthy PB, Anjana JC, Rathinamala J and Jayashree S: The role of red pigment prodigiosin from bacteria of earthworm gut as an anticancer agent. J Microbiol Biotechnol Food Sci. 4:246–251. 2015. View Article : Google Scholar

30 

Lapenda JC, Silva PA, Vicalvi MC, Sena KX and Nascimento SC: Antimicrobial activity of prodigiosin isolated from Serratia marcescens UFPEDA 398. World J Microbiol Biotechnol. 31:399–406. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Mienda BS, Idi A and Umar A: Microbiological features of solid state fermentation and its applications - An overview. Res Biotechnol. 2:21–26. 2011.

32 

Kurbanoglu EB, Ozdal M, Ozdal OG and Algur OF: Enhanced production of prodigiosin by Serratia marcescens mo-1 using ram horn peptone. Braz J Microbial. 46:631–637. 2015. View Article : Google Scholar

33 

Wei YH and Chen WC: Enhanced production of prodigiosin-like pigment from Serratia marcescens, SMR by medium improvement and oil-supplementation strategies. J Biosci Bioeng. 99:616–622. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Suryavanshi MV, Waghmode SR, Bharti N, Choudhari PB, Hingamire TB and Shouche YS: Isolation and virtual screening of antimicrobial prodigiosin pigment from oxalotrophic Serratia marcescens OX_R strain. J Appl Pharm Sci. 6:52–58. 2016. View Article : Google Scholar

35 

Su JC, Chang JH, Huang JW, Chen PP, Chen KF, Tseng PH and Shiau CW: Copper-obatoclax derivative complexes mediate DNA cleavage and exhibit anti-cancer effects in hepatocellular carcinoma. Chem Biol Interact. 228:108–113. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Zhou W, Jin ZX and Wan YJ: Apoptosis of human lung adenocarcinoma A549 cells induced by prodigiosin analogue obtained from an entomopathogenic bacterium Serratia marcescens. Appl Microbiol Biotechnol. 88:1269–1275. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Pérez-Tomás R and Vinas M: New insights on the antitumoral properties of prodiginines. Curr Med Chem. 17:2222–2231. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Montaner B, Navarro S, Piqué M, Vilaseca M, Martinell M, Giralt E, Gil J and Pérez-Tomás R: Prodigiosin from the supernatant of Serratia marcescens induces apoptosis in haematopoietic cancer cell lines. Br J Pharmacol. 131:585–593. 2000. View Article : Google Scholar : PubMed/NCBI

39 

Elahian F, Moghimi B, Dinmohammadi F, Ghamghami M, Hamidi M and Mirzaei SA: The anticancer agent prodigiosin is not a multidrug resistance protein substrate. DNA Cell Biol. 32:90–97. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lin PB, Shen J, Ou PY, Liu LY, Chen ZY, Chu FJ, Wang J and Jin XB: Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells. Oncol Rep 41: 3377-3385, 2019.
APA
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F. ... Jin, X. (2019). Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells. Oncology Reports, 41, 3377-3385. https://doi.org/10.3892/or.2019.7089
MLA
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F., Wang, J., Jin, X."Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells". Oncology Reports 41.6 (2019): 3377-3385.
Chicago
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F., Wang, J., Jin, X."Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells". Oncology Reports 41, no. 6 (2019): 3377-3385. https://doi.org/10.3892/or.2019.7089
Copy and paste a formatted citation
x
Spandidos Publications style
Lin PB, Shen J, Ou PY, Liu LY, Chen ZY, Chu FJ, Wang J and Jin XB: Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells. Oncol Rep 41: 3377-3385, 2019.
APA
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F. ... Jin, X. (2019). Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells. Oncology Reports, 41, 3377-3385. https://doi.org/10.3892/or.2019.7089
MLA
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F., Wang, J., Jin, X."Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells". Oncology Reports 41.6 (2019): 3377-3385.
Chicago
Lin, P., Shen, J., Ou, P., Liu, L., Chen, Z., Chu, F., Wang, J., Jin, X."Prodigiosin isolated from Serratia marcescens in the Periplaneta americana gut and its apoptosis‑inducing activity in HeLa cells". Oncology Reports 41, no. 6 (2019): 3377-3385. https://doi.org/10.3892/or.2019.7089
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team