Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June-2019 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2019 Volume 41 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma

  • Authors:
    • Deliang Yu
    • Jing Zhao
    • Yuhong Wang
    • Jing Hu
    • Qinchuan Zhao
    • Jibin Li
    • Jianjun Zhu
  • View Affiliations / Copyright

    Affiliations: Department of Digestive Surgery, Xijing Hospital of Digestive Disease, Fourth Military Medical University, Xi'an, Shaanxi 710032, P.R. China, State Key Laboratory of Cancer Biology and Experimental Teaching Center of Basic Medicine, Fourth Military Medical University, Xi'an, Shaanxi 710032, P.R. China, Emergency Department, The 7th Medical Center of the PLA General Hospital, Beijing 100700, P.R. China, Department of Biology, School of Basic Medicine, Shanxi Medical University, Taiyuan, Shanxi 030001, P.R. China
  • Pages: 3347-3354
    |
    Published online on: April 16, 2019
       https://doi.org/10.3892/or.2019.7119
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Histamine receptor H3 (HRH3) is mainly expressed in the central nervous system, where it is involved in the regulation of the release of various neurotransmitters in the brain. Recent studies have demonstrated that the expression of HRH3 is upregulated in several types of cancer. However, the functional effect of HRH3 on tumor progression remains largely unknown, particularly in hepatocellular carcinoma (HCC). In the present study, the expression of HRH3 in 96 HCC patients was first evaluated, and its clinical significance was analyzed. Subsequently, the functional roles of HRH3 in HCC growth and metastasis were systematically explored in vitro and in vivo using its agonist (imetit) or antagonist (clobenpropit). It was observed that HRH3 was significantly upregulated in HCC tissues, while its expression was significantly associated with recurrence‑free survival and overall survival in HCC patients. Functional experiments also demonstrated that HRH3 upregulation facilitated the growth and metastasis of HCC cells by inducing the formation of lamellipodia. These findings revealed that HRH3 serves an important role in the growth and metastasis of HCC cells, which provides experimental evidence supporting the application of HRH3 as a potential therapeutic target in HCC treatment.

Introduction

Histamine is a biogenic amine that is released throughout the entire body of an organism via the autocrine and/or paracrine mechanisms (1–3). The multiple actions of histamine are mediated by its receptors, including H1, H2, H3 and H4, which belong to the family of G protein-coupled receptors (4,5). Histamine receptor H3 (HRH3) is an integral membrane protein that regulates neurotransmitter release (6). In addition, HRH3 increases the voltage-dependent calcium currents in smooth muscles, and innervates the heart and blood vessels in the cardiovascular system (1). In multiple sclerosis patients, it was observed that HRH3 was highly expressed in oligodendroglial cells obtained from demyelination lesions, indicating the existence of a genetic association between susceptibility to multiple sclerosis and an exonic single nucleotide polymorphism in HRH3 (7). Decrease in HRH3 function was linked to epileptic activity in the temporal neocortex and hippocampus of patients with pharmacoresistant mesial temporal lobe epilepsy (8). It has also been reported that histamine and histamine receptors (HRs) are critical molecules during carcinogenesis and inflammation (9). Clobenpropit, an HRH3 antagonist, was observed to significantly lower the multiplicity of colonic adenocarcinoma, suggesting that HRH3 may be a possible oncoprotein and potential target in tumor therapies (10). Hepatocellular carcinoma (HCC) is one of the most common malignant tumors, and its incidence rate ranks the second among malignant tumors and >200,000 people succumb to HCC every year in China (11). However, the functional roles of HRH3 in tumor growth and metastasis remain largely unknown, particularly in HCC.

The full-length HRH3 protein is composed of 445 amino acids (1). Thus far, at least 20 isoforms of the human HRH3 have been identified based on the various splicing mRNA forms; however, their regional expression and function currently remain unclear (1). The stimulation of HRH3 negatively regulates the synthesis of histamine via inhibiting adenylate cyclase, which then catalyzes the formation of the second messenger cyclic adenosine monophosphate, followed by the activation of histidine decarboxylase (1). Thus, the activation of HRH3 leads to a decrease in histamine synthesis in neurons. However, the activation of the HRH3 signaling pathway has been poorly elaborated in cancer cells, particularly in HCC cells.

In the present study, the expression and functional roles of HRH3 in HCC were systematically investigated. The study results improve the understanding on the pathological roles of HRH3 and provide experimental evidence for the application of HRH3 as a potential therapeutic target in HCC.

Materials and methods

Reagents and antibodies

The HRH3 antagonist clobenpropit and agonist imetit were purchased from Abcam (Cambridge, UK). The primary antibodies used in western blot analysis and their working concentrations were as follows: HRH3 (dilution 1:1,000; cat. no. ab236952; Abcam) and β-actin (dilution 1:3,000; cat. no. 20536-1-AP; ProteinTech Group, Inc., Chicago, IL, USA). In immunohistochemical (IHC) analysis, the HRH3 antibody was used at a dilution of 1:200. In immunofluorescence analysis, the HRH3 (dilution 1:200) and F-actin (dilution 1:300; cat. no. ab205; Abcam) antibodies were used.

Cell culture and tissue collection

The HLF, JHH-2, Huh-1 and HLE cell lines were from Japanese Collection of Research Biosources Cell Bank (JCRB), and were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences, Logan, UT, USA). SNU739, SNU368, SNU354 and SNU878 cell lines were from the Korean Cell Line Bank (KCLB), and were routinely cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (HyClone; GE Healthcare Life Sciences).

Between January 2009 and January 2012, a total of 96 Han Chinese patients with primary HCC were recruited from Xijing Hospital of the Fourth Military Medical University (Xi'an, China). There was no previous history of other cancers for all patients. All patients received surgery within 2 months after diagnosis and no patient received anticancer treatment before surgery. All tissue samples were stored in liquid nitrogen. The present study was approved by the Ethics Committee of the Fourth Military Medical University (Xi'an, China) and written informed consent was obtained from all the patients involved in the study.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from tissue samples or cultured cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA concentration was measured by spectrophotometer (One Drop Nanjing, China) and was adjusted to 50 ng/µl with ddH2O. RT was performed using the PrimeScript RT reagent kit (Takara Bio, Inc., Ostu, Japan) according to the manufacturer's protocol. Next, qPCR was performed using the SYBR 2X qPCR Master Mix (Takara Bio, Inc.) in order to determine HRH3 expression, with GAPDH serving as the internal control. The cycling parameters were as follows: 95°C for 15 sec, 55°C for 15 sec and 72°C for 15 sec for 40 cycles. All primer sequences used in qPCR are listed in Table I. The relative expression of target genes was determined using the 2−ΔΔCq method (12).

Table I.

Sequences of primers used in polymerase chain reaction.

Table I.

Sequences of primers used in polymerase chain reaction.

GenePrimer sequence (5′ to 3′)
HRH3Forward: GGTACGAAACCTCCTTCTGGC
Reverse: CTCTGGTGGGCCACTCACTTC
GAPDHForward: GGAGCGAGATCCCTCCAAAAT
Reverse: GGCTGTTGTCATACTTCTCATGG

[i] HRH3, histamine receptor H3.

Western blot analysis

Cells or tissues were lysed in cold RIPA buffer and protein concentrations were determined using a BCA protein assay kit (Beyotime Institute of Biotechnology, Haimen, China). A total of 50 µG protein was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then proteins were transferred to polyvinylidene difluoride (PVDF) membranes, which was blocked by soaking in 5% non-fat milk for 1 h at room temperature. The membranes were incubated with specific primary antibodies against HRH3 and β-actin overnight at 4°C, and then with horseradish peroxidase-conjugated secondary antibody (dilution 1:10,000; cat. no. SA00001-2; ProteinTech Group, Inc.) at room temperature for 2 h. Finally, the protein bands were visualized using an enhanced chemiluminescence detection system (Clinx Science Instruments Co., Ltd., Shanghai, China). ImageJ software (NIH; National Institutes of Health, Bethesda, MD, USA) was used to quantify the protein band intensity.

IHC analysis

HCC tissues were fixed in 4% paraformaldehyde and embedded in paraffin. IHC analysis was then performed on 4-µm paraffin-embedded sections using an IHC kit (Invitrogen; Thermo Fisher Scientific, Inc.). The expression level of target proteins was blindly evaluated by two pathologists according to the proportion and intensity of positive cells within five microscopic visual fields/slide, as previously described (13). The final score between 0–3 was determined as low expression and a score >3 was determined as high expression.

Immunofluorescence analysis

HCC cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. Cells were then permeabilized with 0.2% Triton X-100 in PBS followed by blocking in blocking buffer (2% BSA in PBS) for 30 min. Cells were incubated overnight at 4°C with HRH3 antibody at 1:200 dilution or F-actin antibody at 1:300 dilution followed by immunofluorescence-goat anti-rabbit IgG H&L (FITC) (dilution 1:100; cat. no. ab6717; Abcam). The nuclear counterstain is DAPI (dilution 1:5,000; cat. no. C1002; Beyotime Institute of Biotechnology).

Cell viability assay

SNU-739 and SNU-368 cells were seeded into 96-well plates at a density of 1,000 cells/well and incubated for 100 µM imetit, or 100 µM clobenpropit, or dimethyl sulfoxide (DMSO) for 24 h, and the cell viability was measured by an MTS assay (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. The microplates were read in a spectrophotometer at 490 nm.

Colony formation assay

SNU-739 and SNU-368 cells (1×103/well) were seeded into 6-well plates and cultured for two weeks. Subsequent to staining with 1% crystal violet, the number of colonies formed was counted.

Wound healing assay

SNU-739 and SNU-368 cell migration was measured by a wound healing assay. Briefly, ~105 cells were seeded into a 6-well plate and incubated until they reached 80% confluence. Next, a scratch wound was made in each well using a pipette tip, and this time-point was marked as 0 h. Images of the cells were captured at 0 and 48 h in order to assess the migration ability.

Transwell migration assay

For Transwell migration assays, Transwell insert (Becton Dickinson Biosciences, San Jose, USA) were placed into the wells of 24-well culture plates, SNU-739 and SNU-368 cells (~104) cultured in medium with 1% FBS was added to the upper chamber. In the lower chamber of the Transwell insert, medium with 10% FBS was added. Following incubation for 48 h, cells that had migrated to the lower surface of the filter were stained with 1% crystal violet, and then the non-migrated cells remaining on the upper membrane were removed with a cotton wool. Migration was determined by counting the number of cells in five random microscopic fields/well.

In vivo assays for tumor growth

A total of 18 BALB/c male nude mice (5 weeks old; body weight, 18–22 g) were purchased the from Animal Center of the Fourth Military Medical University (Xi'an, China), and were housed under a 12-h light/dark cycles at 20–22 with 60% humidity and had free access to food and water. The mice were randomly divided into three groups (n=6/group). Mice were subjected to a subcutaneous injection of 1×107 SNU-368 cells into their back in order to contract xenografts. After one week, imetit (40 µg/kg/mouse in 100 µl DMSO) or clobenpropit (20 µg/kg/mouse in 100 µl DMSO) or DMSO (100 µl/mouse) was administered by tail vein injection every three days for one month. The tumor volume (mm3) was measured every three days, as previously described (14). After one month of treatment, the mice were sacrificed by injection of an overdose of pentobarbital sodium, the tumor nodules were harvested, and images of tumor tissues were captured. All animal experimental procedures were approved by the Ethics Committee of the Fourth Military Medical University.

Statistical analysis

Experiments were repeated three times, where appropriate. Data are represented as the mean ± standard error of the mean. SPSS software (version 17.0; SPSS, Inc., Chicago, IL, USA) was used to conduct statistical analyses, and P<0.05 was considered to denote a statistically significant difference. Paired or unpaired t-tests were used for comparisons between two groups, while one-way analysis of variance (ANOVA) was used for comparisons among three or more groups. Overall survival (OS) and recurrence-free survival (RFS) in relation to HFH3 expression were evaluated by the Kaplan-Meier survival curve and the log-rank test.

Results

HRH3 is upregulated in HCC tissues and contributes to tumor progression and worse prognosis

The mRNA and protein expression levels of HRH3 were first evaluated in 10 paired tumor and peritumor tissues from HCC patients. RT-qPCR and western blot analysis data demonstrated that HRH3 was significantly upregulated in HCC tissues when compared with peritumor tissues (Fig. 1A and B). The expression of HRH3 was then further evaluated by IHC analysis in 96 paired tumor and peritumor tissues from HCC patients. As shown in Fig. 1C, HRH3 was significantly upregulated in HCC tissues when compared with the paired peritumor tissues.

Figure 1.

Upregulation of HRH3 was common in HCC tissues, and was associated with tumor progression and poor prognosis. (A) Reverse transcription-quantitative polymerase chain reaction and (B) western blot analyses of HRH3 expressions in 10 paired tumor and peritumor tissues from HCC patients. *P<0.05 tumor vs. peritumor. (C) Representative IHC staining images (left panel) and IHC scores (right panel) of HRH3 in 96 paired tumor and peritumor tissues from HCC patients (magnification, ×200; scale bar, 50 µm). Kaplan-Meier analysis for association of (D) overall survival and (E) recurrence-free survival with HRH3 expression in 96 tumor issues from HCC patients. **P<0.01. HRH3, histamine receptor H3; HCC, hepatocellular carcinoma; T, tumor; P, peritumor; IHC, immunohistochemical.

The prognostic significance of HRH3 was also assessed in the 96 HCC patients based on the IHC data from the tumor tissues. Kaplan-Meier survival analysis revealed that HCC patients with high HRH3 expression had significantly shorter OS and RFS as compared with those in patients exhibiting low HRH3 expression (Fig. 1D and E). Taken together, these data indicated that HRH3 contributes to the progression and poor prognosis of HCC.

HRH3 promotes HCC cell growth in vitro

To explore the potential function of HRH3 in cell growth, a series of in vitro biological experiments were performed using an agonist (imetit) or antagonist (clobenpropit) of HRH3. Immunofluorescence and western blot data demonstrated that the expression of HRH3 in SNU-368 and SNU-739 cells was relatively high among the seven HCC cell lines examined (Fig. 2A and B). Next, the MTS assay revealed that HCC cells treated with HRH3 agonist (imetit) exhibited a significantly faster growth compared with the control (DMSO-treated) cells, whereas HCC cells treated with HRH3 antagonist (clobenpropit) exhibited significantly slower growth than the control cells (Fig. 2C). Consistent with this, the number of colonies and 5-ethynyl-2′-deoxyuridine (EdU)-positive cells were significantly increased in HCC cells after treatment with imetit, whereas these were significantly decreased in HCC cells following treatment with clobenpropit, when compared with the respective control group (Fig. 2D and E).

Figure 2.

HRH3 promoted HCC cell growth in vitro. (A) Immunofluorescence images and (B) western blot analyses for the expression of HRH3 in seven HCC cell lines (scale bar, 20 µm). SNU-368 and SNU-739 cells were treated with DMSO (control), imetit (5 µM) or clobenpropit (20 µM), and then evaluated by (C) MTS cell viability assay, (D) EdU incorporation assay to examine cell proliferation (scale bar, 50 µm), and (E) colony formation assay. *P<0.05 and **P<0.01. HRH3, histamine receptor H3; HCC, hepatocellular carcinoma; DMSO, dimethyl sulfoxide.

HRH3 promotes the migration of HCC cells in vitro

The effects of HRH3 on the migration of HCC cells were also investigated using scratch wound healing and Transwell assays. The scratch wound healing assay revealed that the migration ability of HCC cells was markedly increased when HRH3 was activated by imetit. By contrast, the migration capability of HCC cells was significantly decreased following treatment with clobenpropit (Fig. 3A). Similarly, the Transwell migration assay also indicated that activation of HRH3 by imetit significantly enhanced the migration ability of HCC cells, while inhibition of HRH3 by clobenpropit had the opposite effect (Fig. 3B). These results indicated that HRH3 increased the migration abilities of HCC cells.

Figure 3.

Histamine receptor H3 promoted the migration of hepatocellular carcinoma cells. (A) Scratch wound healing and (B) Transwell migration assays were used to examine the migration abilities of SNU-368 and SNU-739 cells treated with DMSO (control), imetit (5 µM) or clobenpropit (20 µM). Magnification, ×40; Scale bar, 50 µm. *P<0.05 and **P<0.01. DMSO, dimethyl sulfoxide.

HRH3 promotes the migration of HCC by inducing lamellipodium formation

Lamellipodia are flattened extensions of the cell that serve a key role in cell migration. To explore the mechanisms by which HRH3 promotes HCC cell migration, lamellipodium formation was evaluated in SNU-368 and SNU-739 cells following treatment with imetit or clobenpropit. F-actin staining results demonstrated that stimulation of HRH3 through binding of the agonist imetit markedly increased lamellipodium formation in HCC cells. By contrast, inhibition of HRH3 through binding of the antagonist clobenpropit significantly decreased lamellipodium formation in HCC (Fig. 4). These results suggested that HRH3 promoted the migration of HCC cells mainly through regulating actin rearrangement.

Figure 4.

Histamine receptor H3 promoted the migration of hepatocellular carcinoma cells by inducing lamellipodium formation. (A) Lamellipodium formation was analyzed by F-actin staining in (A) SNU-368 and (B) SNU-739 cells treated with DMSO (control), imetit (5 µM) or clobenpropit (20 µM). Magnification, ×60; Scale bar, 20 µm. *P<0.05 and **P<0.01. DMSO, dimethyl sulfoxide.

HRH3 promotes HCC cell growth in vivo

To further investigate the tumorigenic effect of HRH3 in vivo, a xenograft model was constructed in nude mice using the SNU-368 cell line. As shown in Fig. 5A and B, a significant increase in the growth capacity (tumor volume and weight) was observed in xenograft tumors treated with imetit when compared with the control xenograft tumors. By contrast, clobenpropit treatment significantly inhibited the growth of xenograft tumors.

Figure 5.

HRH3 promoted HCC xenograft growth in vivo. (A) Subcutaneous tumor growth curve of HCC cells treated as indicated in nude mice. (B) Dissected tumors from sacrificed mice are shown (upper panel), and the tumor weight was determined after tumor nodules were harvested (lower panel). **P<0.01. HCC, hepatocellular carcinoma; DMSO, dimethyl sulfoxide.

Discussion

Recently, high expression levels of HRs have been reported in different cancer types, including gastrointestinal cancer, melanoma, pancreatic and breast cancer (6,9). The results in the present study demonstrated that HRH3 was significantly upregulated in HCC tissues and contributed to tumor progression, suggesting that increased HRH3 level may serve as a potential prognostic marker for HCC patients. Consistent with these results, a previous study in breast cancer reported that the expression of HRH3 was significantly higher in carcinoma tissues compared with that in benign lesions and non-tumor breast tissues (15). Similarly, HRH3 expression was significantly higher in adrenocortical cancer samples in comparison with that in normal adrenal cortex and benign adrenocortical adenomas (16). Another study reported that HRH3 was upregulated in glioblastoma and glioma cell lines when compared with normal brain tissue and astrocytes, while overexpression of HRH3 was associated with glioma progression (17). However, He et al (18) reported that gene polymorphisms of HRH3 are irrelevant in breast cancer. Taken together, all these results indicate that HRH3 is upregulated in malignant carcinomas, suggesting that it may serve as a novel therapeutic target in a number of malignancies.

Previous functional studies have reported that HRH3 induces dual effects on tumor proliferation, and promotes cell proliferation and tumor growth in several types of cancer. For instance, Lin et al (17) have indicated that inhibition of HRH3 suppresses glioblastoma cell growth. Furthermore, it has been demonstrated that histamine increased MDA-MB-231 cell proliferation via HRH3, suggesting that HRH3 is involved in the regulation of breast cancer growth (19). In addition, the proliferation of breast cancer cells was markedly suppressed upon treatment with an HRH3 antagonist, such as OUP-186 and clobenpropit (19). A study by Cricco et al (20) indicated that HRH3 was involved in pancreatic carcinoma cell growth, and that the proliferation was increased through activating HRH3. By contrast, the stimulation of HRH3 through binding of an agonist inhibited the growth of cholangiocarcinoma in vitro and in vivo (21), while it also inhibited the biliary growth of BDL rats (22). In addition, the results of Davenas et al (23) demonstrated that HRH3 antagonists increased McA-RH7777 hepatoma cell proliferation, suggesting that HRH3 may negatively regulate McA-RH7777 cell growth. Consistent with previous studies (17,19,20), the results reported in the present study indicated that stimulation of HRH3 by imetit significantly increased the proliferation ability of HCC cells, whereas inhibition of HRH3 by clobenpropit markedly suppressed HCC cell proliferation, which indicated that overexpression of HRH3 promoted HCC progression. The dual roles of HRH3 in cancer cell growth may be cell-type specific, however, this warrants more comprehensive investigation.

Previous experiments have proven that HRH3 serves an important role in promoting tumor invasion and metastasis. For example, the decrease in cholangiocarcinoma invasion was proven to be mediated by the activation of HRH3 (21). In addition, the study of Lin et al (17) demonstrated that inhibition of HRH3 suppressed glioblastoma tumor invasion. Furthermore, the histamine-HRH3 axis signaling prompted MDA-MB-231 cell migration, suggesting that HRH3 may be involved in the regulation of breast cancer progression (19). Consistent with these previous studies, the present study demonstrated that activation of HRH3 promoted HCC cell migration, while the inhibition of HRH3 suppressed the metastasis of HCC cells, which further supports the functional roles of HRH3 in promoting the metastasis of malignant carcinomas.

Thus far, the mechanisms by which HRH3 promotes malignant carcinoma growth and metastasis remain undefined. Francis et al (21) demonstrated that HRH3 inhibited cholangiocarcinoma growth by PKCα-dependent ERK1/2 dephosphorylation. In addition, HRH3 has been proven to increase proliferation through regulation of the cell cycle in normal and tumor epithelial tissues (24–26). The results of Lin et al (17) also indicated that inhibition of HRH3 led to suppressed invasion and epithelial-mesenchymal transition of glioblastoma by inactivating the PI3K/Akt and MEK/ERK pathways. The lamellipodium is a dynamic surface extension of the cell, which serves a pivotal role in cell migration (27). The present study demonstrated that activation of HRH3 promoted HCC cell migration with increased formation of lamellipodia, whereas inhibition of HRH3 suppressed the migration of HCC cells, with decreased formation of lamellipodia. Furthermore, phosphorylation of paxillin has been demonstrated to be involved in the progression and metastasis of different malignancies (28,29). A previous study from our group has also reported that phosphorylation of paxillin was involved in the formation of lamellipodia in HCC cells (30). Considering that mounting evidences have indicated that PKC and PKA are commonly triggered by the activation of HRs, it can be speculated that HRH3 induces the formation of lamellipodia mainly by activating PKC or PKA, although this requires further investigation.

In conclusion, the present study revealed that HRH3 was upregulated in HCC tissues and was closely correlated with poor prognosis in HCC patients. Furthermore, upregulation of HRH3 facilitated HCC cell growth and metastasis. In our future study, small interference RNA-based experiments will be applied to provide further support for the findings of the present study. Taken together, the results of the present study suggest that HRH3 may be used as a novel therapeutic target in HCC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81472298 and 81502085).

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.

Authors' contributions

DY performed most experiments and wrote the manuscript. YW and QZ participated in the cell proliferation and metastasis analyses. JZhao participated in the in vivo experiments and immunofluorescence assay. JH performed data analysis. JL was involved in the conception of the study. JZhu designed the overall study, analyzed the results and also wrote the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All human and animal experiments conducted in the present study were approved by the Ethics Committee of the Fourth Military Medical University (Xi'an, China). Written informed consent was obtained from all patients involved in the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Singh M and Jadhav HR: Histamine H3 receptor function and ligands: Recent developments. Mini Rev Med Chem. 13:47–57. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Coruzzi G, Adami M and Pozzoli C: Role of histamine H4 receptors in the gastrointestinal tract. Front Biosci. 4:226–239. 2012. View Article : Google Scholar

3 

Hegyesi H, Darvas Z, László V, Pós Z, Pállinger E, Hirschberg K, Kovács P and Falus A: Retinoic acid enhances histamine content and H1 receptor expression in human neuroblastoma cell line Paju. Anticancer Res. 24:1657–1663. 2004.PubMed/NCBI

4 

Kitakaze M: Clinical evidence of the role of histamine in heart failure. J Am Coll Cardiol. 67:1553–1555. 2016. View Article : Google Scholar : PubMed/NCBI

5 

de Esch IJ, Thurmond RL, Jongejan A and Leurs R: The histamine H 4 receptor as a new therapeutic target for inflammation. Trends Pharmacol Sci. 26:462–469. 2005.PubMed/NCBI

6 

Medina VA and Rivera ES: Histamine receptors and cancer pharmacology. Brit J Pharmacol. 161:755–767. 2010. View Article : Google Scholar

7 

Chen Y, Zhen W, Guo T, Zhao Y, Liu A, Rubio JP, Krull D, Richardson JC, Lu H and Wang R: Histamine receptor 3 negatively regulates oligodendrocyte differentiation and remyelination. PLoS One. 12:e1893802017. View Article : Google Scholar

8 

Bhowmik M, Khanam R and Vohora D: Histamine H3 receptor antagonists in relation to epilepsy and neurodegeneration: A systemic consideration of recent progress and perspectives. Brit J Pharmacol. 167:1398–1414. 2012. View Article : Google Scholar

9 

Yang XD, Ai W, Asfaha S, Bhagat G, Friedman RA, Jin G, Park H, Shykind B, Diacovo TG, Falus A and Wang TC: Histamine deficiency promotes inflammation-associated carcinogenesis through reduced myeloid maturation and accumulation of CD11b+Ly6G+ immature myeloid cells. Nat Med. 17:87–95. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Tanaka T, Kochi T, Shirakami Y, Mori T, Kurata A, Watanabe N, Moriwaki H and Shimizu M: Cimetidine and clobenpropit attenuate inflammation-associated colorectal carcinogenesis in male ICR mice. Cancers. 8(pii): E252016. View Article : Google Scholar : PubMed/NCBI

11 

Wong MC, Jiang JY, Goggins WB, Liang M, Fang Y, Fung FD, Leung C, Wang HH, Wong GL, Wong VW, et al: International incidence and mortality trends of liver cancer: A global profile. Sci Rep. 7:458462017. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Huang Q, Lei Z, Cao H, Li J, Lyu Y, Guo X, Zhang J, Ji L, Ren T, An J, et al: Increased mitochondrial fission promotes autophagy and hepatocellular carcinoma cell survival through the ROS-modulated coordinated regulation of the NFKB and TP53 pathways. Autophagy. 12:999–1014. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Zhu J, Jin M, Wang J, Zhang H, Wu Y, Li D, Ji X, Yang H, Yin C, Ren T, et al: TNFα induces Ca2+ influx to accelerate extrinsic apoptosis in hepatocellular carcinoma cells. J Exp Clin Canc Res. 37:432018. View Article : Google Scholar

15 

Medina V, Croci M, Crescenti E, Mohamad N, Sanchez-Jiménez F, Massari N, Nuñez M, Cricco G, Martin G, Bergoc R, et al: The role of histamine in human mammary carcinogenesis: H3 and H4 receptors as potential therapeutic targets for breast cancer treatment. Cancer Biol Ther. 7:28–35. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Szabó PM, Wiener Z, Tömböl Z, Kovács A, Pócza P, Horányi J, Kulka J, Riesz P, Tóth M, Patócs A, et al: Differences in the expression of histamine-related genes and proteins in normal human adrenal cortex and adrenocortical tumors. Virchows Arch. 455:133–142. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Lin JJ, Zhao TZ, Cai WK, Yang YX, Sun C, Zhang Z, Xu YQ, Chang T and Li ZY: Inhibition of histamine receptor 3 suppresses glioblastoma tumor growth, invasion, and epithelial-to-mesenchymal transition. Oncotarget. 6:17107–17120. 2015.PubMed/NCBI

18 

He GH, Lin JJ, Cai WK, Xu WM, Yu ZP, Yin SJ, Zhao CH and Xu GL: Associations of polymorphisms in histidine decarboxylase, histamine N-methyltransferase and histamine receptor H3 genes with breast cancer. PLoS One. 9:e977282014. View Article : Google Scholar : PubMed/NCBI

19 

Tanaka S, Sakaguchi M, Yoneyama H, Usami Y and Harusawa S: Histamine H3 receptor antagonist OUP-186 attenuates the proliferation of cultured human breast cancer cell lines. Biochem Biophys Res Commun. 480:479–485. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Cricco GP, Mohamad NA, Sambuco LA, Genre F, Croci M, Gutiérrez AS, Medina VA, Bergoc RM, Rivera ES and Martín GA: Histamine regulates pancreatic carcinoma cell growth through H3 and H4 receptors. Inflamm Res. 57 (Suppl 1):S23–S24. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Francis H, Onori P, Gaudio E, Franchitto A, DeMorrow S, Venter J, Kopriva S, Carpino G, Mancinelli R, White M, et al: H3 histamine receptor-mediated activation of protein kinase Calpha inhibits the growth of cholangiocarcinoma in vitro and in vivo. Mol Cancer Res. 7:1704–1713. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Francis H, Franchitto A, Ueno Y, Glaser S, DeMorrow S, Venter J, Gaudio E, Alvaro D, Fava G, Marzioni M, et al: H3 histamine receptor agonist inhibits biliary growth of BDL rats by downregulation of the cAMP-dependent PKA/ERK1/2/ELK-1 pathway. Lab Invest. 87:473–487. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Davenas E, Rouleau A, Morisset S and Arrang JM: Autoregulation of McA-RH7777 hepatoma cell proliferation by histamine H3 receptors. J Pharmacol Exp Ther. 326:406–413. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Kennedy L, Hodges K, Meng F, Alpini G and Francis H: Histamine and histamine receptor regulation of gastrointestinal cancers. Transl Gastrointest Cancer. 1:215–227. 2012.PubMed/NCBI

25 

Grandi D, Schunack W and Morini G: Epithelial cell proliferation is promoted by the histamine H3 receptor agonist (R)-α-methylhistamine throughout the rat gastrointestinal tract. Eur J Pharmacol. 538:141–147. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Medina V, Cricco G, Nuñez M, Martín G, Mohamad N, Correa-Fiz F, Sanchez-Jimenez F, Bergoc R and Rivera ES: Histamine-mediated signaling processes in human malignant mammary cells. Cancer Biol Ther. 5:1462–1471. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Machesky LM: Lamellipodia and filopodia in metastasis and invasion. Febs Lett. 582:2102–2111. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Brown MC, Perrotta JA and Turner CE: Serine and threonine phosphorylation of the paxillin LIM domains regulates paxillin focal adhesion localization and cell adhesion to fibronectin. Mol Biol Cell. 9:1803–1816. 1998. View Article : Google Scholar : PubMed/NCBI

29 

Huang C, Jacobson K and Schaller MD: A role for JNK-paxillin signaling in cell migration. Cell Cycle. 3:4–6. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Ren T, Zhang H, Wang J, Zhu J, Jin M, Wu Y, Guo X, Ji L, Huang Q, Zhang H, et al: MCU-dependent mitochondrial Ca2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells. Oncogene. 36:5897–5909. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu D, Zhao J, Wang Y, Hu J, Zhao Q, Li J and Zhu J: Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma. Oncol Rep 41: 3347-3354, 2019.
APA
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., & Zhu, J. (2019). Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma. Oncology Reports, 41, 3347-3354. https://doi.org/10.3892/or.2019.7119
MLA
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., Zhu, J."Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma". Oncology Reports 41.6 (2019): 3347-3354.
Chicago
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., Zhu, J."Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma". Oncology Reports 41, no. 6 (2019): 3347-3354. https://doi.org/10.3892/or.2019.7119
Copy and paste a formatted citation
x
Spandidos Publications style
Yu D, Zhao J, Wang Y, Hu J, Zhao Q, Li J and Zhu J: Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma. Oncol Rep 41: 3347-3354, 2019.
APA
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., & Zhu, J. (2019). Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma. Oncology Reports, 41, 3347-3354. https://doi.org/10.3892/or.2019.7119
MLA
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., Zhu, J."Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma". Oncology Reports 41.6 (2019): 3347-3354.
Chicago
Yu, D., Zhao, J., Wang, Y., Hu, J., Zhao, Q., Li, J., Zhu, J."Upregulated histamine receptor H3 promotes tumor growth and metastasis in hepatocellular carcinoma". Oncology Reports 41, no. 6 (2019): 3347-3354. https://doi.org/10.3892/or.2019.7119
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team