Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2021 Volume 46 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2021 Volume 46 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article

MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis

  • Authors:
    • Cui-Ping Wang
    • Yong-Zheng Yu
    • Hui Zhao
    • Li-Juan Xie
    • Qi-Tang Wang
    • Ye Wang
    • Qiang Mu
  • View Affiliations / Copyright

    Affiliations: The First Department of Breast Surgery, Qingdao Central Hospital, The Second Affiliated Hospital of Medical College of Qingdao University, Qingdao, Shandong 266042, P.R. China, Department of Ophthalmology, Qingdao Women and Children's Hospital, Qingdao University, Qingdao, Shandong 266034, P.R. China, Clinical Laboratory, Qingdao Central Hospital, The Second Affiliated Hospital of Medical College of Qingdao University, Qingdao, Shandong 266042, P.R. China
  • Article Number: 127
    |
    Published online on: May 11, 2021
       https://doi.org/10.3892/or.2021.8078
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs are important for the regulation of multiple cellular functions and are involved in the initiation and progression of various types of cancer, including breast cancer. Although microRNA (miR)‑454‑3p is reported to function as an oncogene in several types of human cancer, the role of miR‑454‑5p in breast cancer remains unknown. The present study demonstrated that miR‑454‑5p was upregulated in breast cancer and was associated with a poor prognosis in patients with breast cancer. Overexpression of miR‑454‑5p promoted breast cancer cell viability, migration and invasion in vitro, whereas silencing of miR‑454‑5p inhibited breast cancer proliferation, migration and invasion in vitro and suppressed tumor growth in vivo. Mechanistically, forkhead box J2 (FoxJ2) was shown to be a target of miR‑454‑5p and transactivated E‑cadherin expression. Moreover, silencing of miR‑454‑5p reversed the epithelial‑mesenchymal transition phenotype through upregulation of the FoxJ2/E‑cadherin axis. Collectively, the present findings suggested that miR‑454‑5p may serve as a novel therapeutic target and prognostic predictor for patients with breast cancer.

Introduction

Breast cancer is one of the most commonly diagnosed cancer types and the second leading cause of cancer-related mortality in women world-wide (1,2). Although early detection and systemic therapy significantly improve the outcome of patients with breast cancer, the survival rate of patients with metastatic breast cancer remains relatively low, with a 5-year survival of <25% (3,4). Therefore, it is important to understand the underlying molecular mechanism of breast carcinogenesis and progression, as well as to identify novel biomarkers and therapeutic target molecules for early diagnosis and individualized therapy.

MicroRNAs (miRNAs) are endogenous small non-coding RNAs, ~22 nucleotides in length, that are involved in gene silencing through translational repression or mRNA degradation by binding to the 3′-untranslated regions (3′-UTRs) of target genes (5). Previous studies have reported that miRNAs participate in multiple biological functions and are involved in various physiological processes, including cell proliferation, differentiation, metabolism, senescence and apoptosis (6,7). Aberrant expression of miRNAs has been shown to be involved in the development and progression of multiple human cancer types (8). In humans, miRNA (miR)-454 is located on chromosome 17q22, and it has two main mature forms: miR-454-5p and miR-454-3p. miR-454 has been identified as either an oncogene or a tumor suppressor in various types of cancer, including pancreatic cancer (9,10), colon cancer (11), melanoma (12), chondrosarcoma (13), glioma (14–16), hepatocellular carcinoma (17,18), lung cancer (19–21), laryngeal cancer (22), ovarian cancer (23), prostate cancer (24), gastric cancer (25–28), cervical cancer (29), bladder cancer (30), oral squamous cell carcinoma (31), osteosarcoma (32), renal carcinoma (33) and breast cancer (34–36). Although several studies have reported that miR-454-3p could function as an oncogene in breast cancer, the role of miR-454-5p remains unknown.

Epithelial-mesenchymal transition (EMT) is a biological process through which epithelial cells lose cell polarity and cell-cell adhesion; cells also acquire a fibroblastic morphotype with invasive and migratory properties during tissue fibrosis, embryonic development and cancer progression (37,38). EMT contributes to cancer progression, metastasis and therapeutic resistance in all types of human cancer, which may correlate with unfavorable outcomes of patients with cancer (39). Therefore, targeting components of EMT signaling is considered as a promising strategy in cancer therapy. Previous studies have shown that miRNAs participate in EMT regulation during breast cancer progression (40,41).

The present study aimed to investigate the role of miR-454-5p in breast cancer progression both in vitro and in vivo, and explored the potential mechanism of miR-454-5p on the regulation of EMT in breast cancer.

Materials and methods

Cell lines and culturing

The human breast epithelial cell line MCF10A and breast cancer cell lines MCF7, T47D, BT549, MDA-MB-231 and SKBR3 were obtained from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. MCF10A cells were cultured in DMEM/F12 (Hyclone; Cytiva) supplemented with 5% horse serum (Thermo Fisher Scientific, Inc.), 10 µg/ml insulin (Sigma-Aldrich; Merck KGaA), 20 ng/ml epidermal growth factor (R&D Systems, Inc.), 0.1 µg/ml cholera toxin (Sigma-Aldrich; Merck KGaA) and 0.5 µg/ml hydrocortisone (Sigma-Aldrich; Merck KGaA). BT549, MDA-MB-231 and SKBR3 cells were maintained in RPMI-1640 (Hyclone; Cytiva) supplemented with 10% FBS (Thermo Fisher Scientific, Inc.). MCF7 and T47D cells were cultured in DMEM (Hyclone; Cytiva) with 10% FBS. All cells were supplemented with 100 mg/ml streptomycin (Hyclone; Cytiva) and 100 IU/ml penicillin (Hyclone; Cytiva) and cultured in an atmosphere containing 5% CO2 at 37°C.

Transfections

miR-454-5p mimics (5′-GAAGUAAAGGGGCAAGAUAGGGC-3′) and negative control (5′-UUCUCCGAACGUGUCACGUUU-3′) oligonucleotides were purchased from Guangzhou RiboBio Co., Ltd. Transient transfection was conducted using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Cell were seeded in a 6-well plate at a density of 2×105 cells/well and then transfected with 200 pmol oligonucleotides at 37°C for 24 h. Experiments were performed 48 h after transfection.

The miR-454-5p antisense strand (5′-GCCCUAUCUUGCCCCUUUACUUC-3′) or inhibitor control (5′-UCUACUCUUUCUAGGAGGUUGUGA-3′; anti-Control) was cloned into the pEZX-AM04 lentiviral vector (GeneCopoeia, Inc.) and short hairpin RNA (sh)FoxJ2 (5′-GCAAGCCACGATACAGCTATT-3′) or shControl (5′-CCTAAGGTTAAGTCGCCCTCG-3′) was cloned into the pLKO.1 lentiviral vector (GeneCopoeia, Inc.). 293T cells were transfected with 10 µg lentiviral vectors and 10 µg packaging vectors when the density of cells reached 80–90%. After transfection for 48 h at 37°C, supernatants containing virus particles were harvested and purified. The lentiviral particles were used to infect targeted cells at 60% confluency with a multiplicity of infection of 30 and stable cells were selected with 800 mg/ml puromycin. The FoxJ2 knockdown efficiencies were confirmed by reverse transcription-quantitative PCR (RT-qPCR) and western blotting (Fig. S1).

RT-qPCR

Total RNA was extracted from breast cancer cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The isolated RNA was reverse transcribed into cDNA using a PrimeScript™ RT Master Mix kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. qPCR analysis was performed using SYBR Green Mix (Takara Biotechnology Co., Ltd.) on a CFX96 Touch™ Real-time PCR System (Bio-Rad Laboratories, Inc.); the thermocycling conditions were as follows: Initial denaturation for 8 min at 95°C; followed by 40 cycles of two-step PCR at 95°C for 20 sec and 60°C for 1 min. The expression of mRNA or miRNA was normalized to GAPDH or U6, respectively. Data were analyzed using the 2−ΔΔCq method (42). The qPCR primers are listed in Table I.

Table I.

Primer sequences used in quantitative PCR.

Table I.

Primer sequences used in quantitative PCR.

NamePrimer sequence (5′→3′)
FoxJ2F: ATGGCTTCTGACCTAGAGAGTAG
R: CTGCCTCGTCTTTGCTCAGG
E-cadherinF: CGAGAGCTACACGTTCACGG
R: GGGTGTCGAGGGAAAAATAGG
GAPDHF: ATGACCCCTTCATTGACCTCA
R: GAGATGATGACCCTTTTGGCT
E-cadherin R1F: CTGTACAGAGCATTTATGGCTCAA
R: TGTCTCCCTATGCTGTTGTGG
E-cadherin R2F: GAGTCTCTTGAACCCGGCA
R: CCACTGAGCTAGCAGCCTAAT
E-cadherin R3F: CACTCCAGCTTGGGTGAAAGA
R: GGCTCACTAAGACCTGGGAT

[i] F, forward; FoxJ2, forkhead box J2; R, reverse; R1/R2/R3, region 1/2/3.

Western blotting

Total protein was isolated from cells using RIPA lysis buffer containing PMSF (both from Cell Signaling Technology, Inc.). Protein concentrations were determined using a BCA Protein Assay kit (Thermo Fisher Scientific, Inc.). All samples (40 µg per lane) were separated by SDS-PAGE on 10% gels and then transferred to polyvinylidene fluoride membranes (EMD Millipore). After blocking with 5% skimmed milk for 1 h at room temperature, the membrane was incubated with primary antibodies overnight at 4°C, followed by washing with PBS and incubation with horseradish peroxidase-conjugated goat anti-rabbit (cat. no. 7074) or horse anti-mouse (cat. no. 7076) (both at a dilution of 1:2,000; Cell Signaling Technology, Inc.) secondary antibodies for 1 h at room temperature. The bands were visualized with ECL reagent (EMD Millipore). Antibodies against N-cadherin (cat. no. sc-393933), E-cadherin (cat. no. sc-71008), Vimentin (cat. no. sc-80975), FoxJ2 (cat. no. sc-514265) (all from Santa Cruz Biotechnology, Inc.) and GAPDH (cat. no. 5174; Cell Signaling Technology, Inc.) were used at a dilution of 1:1,000.

Luciferase reporter assay

For FoxJ2 3′-UTR activity analysis, the 3′-UTR of FoxJ2 mRNA and the corresponding sequence with mutations (FoxJ2-1: 5′-GCTGGCAAAGAAATGGATAGGGA-3′ to 5′-GCTGGCAAAGAAATGGATAAA A-3′; FoxJ2-2: 5′-GAAGTAAAGGGGCAAGATAGGGC-3′ to 5′-GAAGTAAAGGGGCAAGATAAAAC-3′) were cloned into a psiCHEK2 luciferase reporter plasmid (Promega Corporation). MDA-MB-231 cells were seeded into a 24-well plate at 1×104 cells/well and co-transfected with psiCHEK2-FoxJ2 (500 ng) and miR-454-5p mimics (50 pmol) or negative control using Lipofectamine 3000 for 48 h at 37°C. For E-cadherin promoter activity analysis, the E-cadherin promoter was cloned into a pGL3-basic luciferase reporter plasmid (Promega Corporation) and was transfected into MDA-MB-231 cells stably expressing anti-miR-454-5p or shFoxJ2, as well as into the control cells using Lipofectamine 3000 for 48 h at 37°C. Luciferase activity was analyzed after transfection for 48 h and the cell lysates were measured for luciferase activity using Dual-Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's instructions. The firefly luciferase activity was normalized to Renilla luciferase activity.

Chromatin immunoprecipitation (ChIP) assay

Stably transfected MDA-MB-231 cells were cross-linked with 1% formaldehyde for 15 min at room temperature. After quenching with 125 mM glycine, the cells were collected, washed and sonicated in RIPA buffer. The cross-linked lysate was sonicated (power, 20 W; duration, 30 sec/cycle for 40 cycles; temperature, 5–6°C) to obtain 500–1,500 bp fragments, which were immunoprecipitated with IgG or anti-FoxJ2 antibody (cat. no. sc-514265; Santa Cruz Biotechnology, Inc.) at 4°C for 3 h. This was followed by incubation with 50 µl protein A/G beads overnight at 4°C. qPCR was used to identify and quantify the precipitated DNA. Primers for ChIP assays are presented in Table I.

Colony formation assay

Breast cancer cells were seeded into six-well plates at 500 cells/well. Transient transfection with miR-454-5p mimics was conducted using Lipofectamine® 3000, aforementioned, or MDA-MB-231 cells stably expressing anti-miR-454-5p or shFoxJ2 were used, as well as their control cells. Cells were cultured for 20 days at 37°C, and colonies were washed with PBS, fixed with 4% paraformaldehyde for 15 min at room temperature, and stained with hematoxylin. The colonies with >50 cells were counted under a light microscope at ×100 magnification.

Cell morphology

MDA-MB-231 cells stably expressing anti-miR-454-5p or shFoxJ2, as well as their control cells, were seeded in 6-well plates at a density of 5×104 cells/well and cultured at 37°C for 24 h. Cell morphology was examined under a light microscope at ×100 magnification.

Cell viability assay

The Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.) was used to determine cell viability, according to the manufacturer's protocols. Cells were seeded into a 96-well plate at 5×103 cells/well. After transfection for 24 h, CCK-8 reagent (10 µl) was added to the medium and incubated at 37°C for 2 h. The absorbance of each sample was measured using a microplate reader (Thermo Fisher Scientific, Inc.) at 450 nm.

Immunofluorescence

Cells were plated at a density of 2×104 on glass coverslips, washed with ice-cold PBS and fixed in 4% formaldehyde solution for 15 min at room temperature. The coverslips were blocked with 2% BSA (Cell Signaling Technology, Inc.) in PBS for 30 min at room temperature and incubated with a primary antibody against E-cadherin (1:500; cat. no. sc-71008; Santa Cruz Biotechnology, Inc.) overnight at 4°C. Subsequently, cells were incubated with Alexa Fluor® 488-conjugated anti-mouse secondary antibody (1:300; cat. no. 4408; Cell Signaling Technology, Inc.) for 1 h and then stained with DAPI for 10 min, both at room temperature. The coverslips were washed with PBS and observed under a fluorescence microscope at ×400 magnification.

Cell cycle analysis

Cells were seeded into a 6-well plate at a density of 5×104 cells/well. After culture at 37°C for 24 h, cells were collected and fixed with 70% ethanol for 24 h at −20°C, followed by incubation with 10 µg/ml PI and 50 µg/ml RNase (BD Biosciences) on ice for 15 min. Cells were then assessed by flow cytometry using a BD FACSCalibur flow cytometer (BD Biosciences).

Transwell assays

Cell invasion and migration were assessed using BD Transwell chambers pre-coated with or without Matrigel, respectively (BD Biosciences). Cells were seeded (2×104 cells/well) into the upper Transwell chamber containing RPMI-1640 medium without serum; RPMI-1640 medium with 10% FBS was added to the bottom chamber. After incubation for 16 h at 37°C, the invaded or migrated cells on the lower surface were fixed in 4% formaldehyde solution for 15 min at room temperature, and subsequently stained with crystal violet for 15 min at room temperature. Images of the invaded or migrated cells were captured under a light microscope at ×100 magnification.

Bioinformatics analysis

TargetScan Human release 7.2. (http://www.targetscan.org) was used for prediction of miR-454-5p targets. The top three genes containing two potential miR-454-5p target sites were selected for further study. LASAGNA-Search 2.0 (https://www.bitnos.com/info/lasagna-search) was used to predict FoxJ2 binding sites on the E-cadherin promoter region.

Validation of gene expression and outcome by TCGA database

The expression levels of miR-454-5p were analyzed in breast cancer tissues (n=749) and normal breast tissues (n=76) obtained from The Cancer Genome Atlas (TCGA) database by using UALCAN (http://ualcan.path.uab.edu/index.html). The relationship between miR-454-5p and FoxJ2 was determined by ENCORI (http://starbase.sysu.edu.cn). The prognostic value of miR-454-5p expression was examined by using the online database, KM-Plotter (www.kmplot.com/mirpower). Patients were divided into two groups by ‘auto select best cutoff’ feature and assessed using a Kaplan-Meier survival plot.

Xenografts

Female BALB/c-nude mice (n=12; age, 5 weeks; weight, 22 g) were purchased from Vital River Lab Animal Technology Company. The mice were maintained in a specific pathogen-free environment with a 10/14-h light/dark cycle in 40–60% humidity at 27°C and had ad libitum access to food and water. The experimental procedures were approved by the Animal Experimentation Ethics Committee of Qingdao Central Hospital (Qingdao, China). A total of 1×106 stably transfected MDA-MB-231 cells were injected subcutaneously into the right mammary fat pad. Tumor volume was calculated using the following equation: (Length × width2)/2. The mice were sacrificed on day 35 after tumor implantation, and the tumors were excised and weighed. The tumor burden did not exceed the recommended dimensions (tumor diametermax ≤16.5 mm; volumemax ≤1,200 mm3). The animals were anesthetized (60 mg/kg ketamine and 5.0 mg/kg xylazine) and then sacrificed by cervical dislocation.

Statistical analysis

Statistical analyses were performed using SPSS 20.0 (IBM Corp.). Data are presented as the mean ± SD from at least three independent experiments. The unpaired Student's t-test was used to compare differences between two groups, and one-way ANOVA followed by Tukey's multiple comparison post hoc test was used when comparing >2 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-454-5p is upregulated in breast cancer and is associated with poor prognosis

To determine the role of miR-454-5p in breast cancer, the expression levels of miR-454-5p were analyzed in breast cancer tissues (n=749) and normal breast tissues (n=76) obtained from The Cancer Genome Atlas (TCGA) database by using UALCAN. Increased miR-454-5p expression levels were observed in breast cancer compared with normal tissues (Fig. 1A), and miR-454-5p expression was significantly upregulated in triple-negative and Her2+ breast cancer types (Fig. 1B). Furthermore, high miR-454-5p expression was associated with a poor prognosis in patients with breast cancer as determined using the KM-Plotter database (Fig. 1C). Subsequently, the expression levels of miR-454-5p were examined in five breast cancer cell lines (MCF7, T47D, BT549, MDA-MB-231 and SKBR3) and a normal breast epithelial cell line MCF10A. The expression levels of miR-454-5p were significantly higher in BT549, MDA-MB-231 and SKBR3 breast cancer cell lines compared with MCF10A cells (Fig. 1D). Taken together, these results indicated that miR-454-5p may serve an important role in breast cancer progression.

Figure 1.

miR-454-5p expression is upregulated breast cancer. (A) Expression levels of miR-454-5p in breast cancer and normal tissue samples from The Cancer Genome Atlas database were analyzed. (B) Expression levels of miR-454-5p in different molecular subtypes of breast cancer and normal tissue samples analyzed in TCGA database by using UALCAN. (C) Overall survival of patients with different miR-454-5p expression levels, as evaluated using Kaplan-Meier Plotter. (D) Expression levels of miR-454-5p in five breast cancer cell lines and the normal breast epithelial cell line MCF10A were examined using reverse transcription-quantitative PCR. *P<0.05 vs. MCF10A. HR, hazard ratio; miR, microRNA.

Overexpression of miR-454-5p promotes breast cancer cell proliferation, migration and invasion

As miR-454-5p was upregulated in BT549, MDA-MB-231 and SKBR3 compared to MCF10A cells, aforementioned, which suggested that miR-454-5p may serve an important role in these cell lines, MDA-MB-231 and BT549 were choose to further study. To evaluate the potential role of miR-454-5p in breast cancer progression, miR-454-5p mimics or negative controls were transfected into MDA-MB-231 and BT549 cells. The expression of miR-454-5p was effectively elevated in MDA-MB-231 and BT549 cells after transfection with miR-454-5p mimics compared with miR-NC-transfected cells, as determined by RT-qPCR (Fig. 2A). CCK-8 and colony formation assays were conducted to evaluate the effects of miR-454-5p on breast cancer proliferation. It was found that the overexpression of miR-454-5p significantly enhanced cell viability and the number of colonies in MDA-MB-231 and BT549 cells compared with the miR-NC group (Fig. 2B and C, respectively). Furthermore, the proportion of cells at the S phase was significantly increased in miR-454-5p-overexpressing MDA-MB-231 and BT549 cells compared with that of control cells (Fig. 2D). Transwell analyses were performed to assess the effects of miR-454-5p on breast cancer cell migration and invasion (Fig. 2E and F, respectively). The number of migrated and invaded cells was significantly increased in miR-454-5p-overexpressing MDA-MB-231 and BT549 cells compared with those in control cells. These results suggested that miR-454-5p may function as an oncogene in breast cancer progression.

Figure 2.

Overexpression of miR-454-5p promotes breast cancer cell proliferation, migration and invasion. (A) Expression levels of miR-454-5p in MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics or negative control were determined using reverse transcription-quantitative PCR. (B) Cell viability in MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics or negative control was assessed using a Cell Counting Kit-8 assay. (C) Colony formation analysis of MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics or negative control. (D) Cell cycle analysis of MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics or negative control. (E) Migration and (F) invasion analysis of MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics or negative control was assessed by Transwell analyses. *P<0.05 vs. miR-NC. miR, microRNA; NC, negative control.

FoxJ2 is a target of miR-454-5p

TargetScan was used to predict target genes of miR-454-5p, and the top three genes containing two potential target sites in their 3′-UTRs were ATXN7L3B, RIPPLY3 and FoxJ2 (Fig. 3A). Of the three genes, only FoxJ2 has been reported to be involved in cancer progression (43–46); therefore, it was selected for further study. The luciferase reporter assay was used to determine whether miR-454-5p could directly bind to the 3′-UTR of FoxJ2. The two putative miR-454-5p target sites in the 3′-UTR of FoxJ2 were cloned into the psiCHEK2 reporter plasmid and subsequently transfected into MDA-MB-231 cells along with miR-454-5p mimics or negative control. The luciferase activity of the FoxJ2 3′-UTR reporter construct was significantly decreased in the miR-454-5p-transfected MDA-MB-231 cells compared with luciferase activity in the miR-NC cells (Fig. 3B). This effect was abolished in the mutated FoxJ2 3′-UTR group in which both target sites for miR-454-5p were inactivated (FoxJ-1 + 2) by site-directed mutagenesis (Fig. 3C). The expression levels of FoxJ2 were notably decreased in MDA-MB-231 and BT549 cells transfected with miR-454-5p mimics compared with the expression levels in control cells, as demonstrated by RT-qPCR (Fig. 3D) and western blotting (Fig. 3E).

Figure 3.

FoxJ2 is a target of miR-454-5p. (A) Schematic illustration of the two predicted miR-454-5p target sites in FoxJ2 3′-UTR. Luciferase reporter assays were performed to demonstrate that miR-454-5p inhibits the (B) wild-type but not the (C) double-mutant FoxJ2-1 + 2 3′-UTR target sites of FoxJ2 reporter activities. (D) mRNA and (E) protein expression levels of FoxJ2 in MDA-MB-231 or BT549 cells transfected with miR-454-5p mimics or negative control was examined using reverse transcription-quantitative PCR and western blotting, respectively. (F) Relationship between miR-454-5p and FoxJ2 expression levels analyzed by ENCORI. *P<0.05 vs. miR-NC. FoxJ2, forkhead box J2; miR, microRNA; UTR, untranslated region.

To further investigate the relationship between miR-454-5p and FoxJ2, the expression levels of miR-454-5p and FoxJ2 from TCGA database was analyzed by ENCORI. As presented in Fig. 3F, the expression of miR-454-5p exhibited a negative co-expression trend with FoxJ2. Thus, these results support the bioinformatics prediction that FoxJ2 was a direct target of miR-454-5p.

Silencing of miR-454-5p inhibits breast cancer proliferation, migration and invasion by upregulating FoxJ2 expression

To further confirm the regulation of the miR-454-5p/FoxJ2 axis in breast cancer progression, stably transfected MDA-MB-231 cell lines overexpressing the anti-miR-454-5p inhibitor with or without shFoxJ2 co-transfection, as well as anti-Control cells, were generated. The expression of miR-454-5p was significantly downregulated in miR-454-5p-silenced MDA-MB-231 cells compared with that of control cells, as determined via RT-qPCR (Fig. 4A). The expression of FoxJ2 was upregulated in miR-454-5p-silenced MDA-MB-231 cells, whereas it was notably downregulated in miR-454-5p and FoxJ2-silenced MDA-MB-231 cells compared with that of control cells, as determined using western blotting (Fig. 4B). It was also found that knockdown of FoxJ2 significantly reversed the inhibitory effects of miR-454-5p silencing on the proliferation, migration and invasion of MDA-MB-231 cells as determined via CCK-8 (Fig. 4C), colony formation (Fig. 4D), cell cycle (Fig. 4E) and Transwell assays (Fig. 4F), respectively.

Figure 4.

Silencing of miR-454-5p inhibits breast cancer progression through the upregulation of FoxJ2. Expression levels of (A) miR-454-5p and (B) FoxJ2 protein in MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells, were examined by reverse transcription-quantitative PCR or western blotting, respectively. (C) Cell viability and (D) colony formation in MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells, was assessed using a Cell Counting Kit-8 assay or colony formation assay, respectively. (E) Cell cycle analysis of MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells. (F) Migration and invasion of MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells, was assessed by Transwell or Matrigel analysis, respectively. (G) Representative images of the tumors formed by MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells, at the time of harvest. Tumor (H) volume and (I) weight of xenografted mice injected with MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFoxJ2 transfection, or anti-Control cells, at the indicated times. *P<0.05. FoxJ2, forkhead box J2; miR, microRNA; sh, short hairpin RNA.

To investigate the biological effect of the miR-454-5p/FoxJ2 axis on breast cancer progression in vivo, MDA-MB-231-control, MDA-MB-231-anti-454 and MDA-MB-231-anti-454 + shFoxJ2 cells were injected into the mammary fat pads of female BALB/c-nude mice. As presented in Fig. 4G-I, tumor volumes and weights were significantly decreased in mice injected with MDA-MB-231-anti-miR-454 cells compared with those in mice injected with MDA-MB-231-control cells. Moreover, it was identified that knockdown of FoxJ2 could abolish the inhibitory effects of miR-454-5p silencing on tumor growth. Collectively, these results indicated that silencing of miR-454-5p may inhibit breast cancer progression through the upregulation of FoxJ2 expression.

Silencing of miR-454-5p reverses EMT through the transcriptional upregulation of E-cadherin

Accumulating evidence has suggested that EMT could promote progression in breast cancer (41). Therefore, it was investigated whether miR-454-5p regulated EMT to affect breast cancer progression. It was identified that miR-454-5p-silenced MDA-MB-231 cells had a cobblestone-like morphology, whereas anti-miR-454-5p + shFoxJ2 MDA-MB-231 cells and anti-Control cells maintained their spindle-like fibroblast morphology (Fig. 5A). In addition, it was demonstrated that the expression of epithelial marker E-cadherin was increased in miR-454-5p-silenced MDA-MB-231 cells, whereas the expression levels of mesenchymal markers Vimentin and N-cadherin were decreased in miR-454-5p-silenced MDA-MB-231 cells compared with the expression levels in control cells, as determined by western blotting (Fig. 5B). Moreover, knockdown of FoxJ2 could reverse this effect caused by miR-454-5p silencing (Fig. 5B). In total, three putative FoxJ2 binding sites on the E-cadherin promoter region were identified using LASAGNA-Search (47). ChIP analysis results demonstrated that FoxJ2 bound to region 1 and region 2 from the E-cadherin promoter region (Fig. 5C). Luciferase assay results indicated that knockdown of FoxJ2 significantly abolished miR-454-5p depletion-induced E-cadherin promoter activity (Fig. 5D). E-cadherin mRNA expression levels were increased in miR-454-5p-silenced MDA-MB-231 cells, whereas this effect was abolished by FoxJ2 knockdown as shown by RT-qPCR (Fig. 5E) and immunofluorescence (Fig. 5F). E-cadherin mRNA was determined to be positive co-expression trend with FoxJ2 mRNA by ENCORI (Fig. 5G). Together, these results indicated that miR-454-5p may regulated EMT through the transcriptional upregulation of E-cadherin by FoxJ2.

Figure 5.

Silencing of miR-454-5p reverses EMT through the upregulation of the FoxJ2/E-cadherin axis in breast cancer. (A) Bright-field images of MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFOXJ2 co-transfection, and anti-Control cells. (B) Expression levels of E-cadherin, N-cadherin and Vimentin in cells stably expressing anti-miR-454-5p with or without shFOXJ2 co-transfection, and anti-Control cells were examined by western blotting. (C) Chromatin immunoprecipitation analysis of miR-454-5p-silenced MDA-MB-231 cells or anti-Control cells to determine the binding of FoxJ2 to three E-cadherin promoter regions. (D) Luciferase analysis of E-cadherin promoter activity in MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFOXJ2 co-transfection, and anti-Control cells. (E) mRNA expression level of E-cadherin in MDA-MB-231 cells stably expressing anti-miR-454-5p with or without shFOXJ2 co-transfection, and anti-Control cells was examined by reverse transcription-quantitative PCR. (F) Expression of E-cadherin in cells stably expressing anti-miR-454-5p with or without shFOXJ2 co-transfection, and anti-Control cells was examined using immunofluorescence. (G) Relationship between E-cadherin and FoxJ2 expression levels analyzed by ENCORI. *P<0.05. FoxJ2, forkhead box J2; miR, microRNA; sh, short hairpin RNA.

Discussion

The results from present study demonstrated that miR-454-5p was upregulated in breast cancer compared with normal breast epithelial tissue and cell lines. Furthermore, the results suggested that miR-454-5p may promote breast cancer progression both in vitro and in vivo. FoxJ2 was identified as a direct target of miR-454-5p, and FoxJ2 may transactivate the expression of E-cadherin. Moreover, silencing of miR-454-5p reversed EMT through the transactivation of E-cadherin by FoxJ2. The present results suggested that miR-454-5p may be a potential target for breast cancer therapy.

Accumulating evidence has revealed that the dysregulation of miRNAs is involved in carcinogenesis and cancer progression in all types of human cancer, including breast cancer (41,48). Abnormal expression of miR-454 has been observed in a variety of human cancer types, suggesting that miR-454 may serve an important role in cancer development and progression (9–36). miR-454-3p has been demonstrated to function as an oncogene, and high expression of miR-454-3p may be associated with unfavorable outcome in triple-negative breast cancer (36,49). Moreover, miR-454-3p has been shown to promote breast cancer metastasis through the suppression of Wnt/β-catenin signaling antagonists (35). Consistent with these previous reports, the present study demonstrated that miR-454-5p was upregulated in breast cancer and that miR-454-5p may promote breast cancer progression both in vitro and in vivo, suggesting that miR-454-5p may function as an oncogene in breast cancer.

Fox protein family members share a highly conserved common forkhead DNA-binding domain and are widespread from yeast to humans (50). These transcription factors are crucial players in multiple cellular processes, including differentiation, proliferation, metabolism, migration and apoptosis, and are often dysregulated in cancer development and progression (50). FoxJ2 belongs to the human Fox gene family and serves an important role in embryogenesis and carcinogenesis (51). FoxJ2 has also been reported to function as a tumor suppressor in multiple types of cancer, including colorectal cancer (52), hepatocellular carcinoma (53), non-small lung cancer (43), extrahepatic cholangiocarcinoma (44), glioma (45) and breast cancer (46). In line with the aforementioned results, the present findings demonstrated that FoxJ2 was a target of miR-454-5p and that miR-454-5p may promote breast cancer progression through the downregulation of FoxJ2 expression.

EMT, a main driver of tumor metastasis, is defined as a process by which epithelial cells lose their cell polarity and cell-cell adhesions, resulting in changes to cell morphology and enhanced cell migratory and invasive abilities (37). Vimentin, N-cadherin and E-cadherin are generally considered as EMT markers. During the EMT process, the expression of E-cadherin (an epithelial marker) is decreased, whereas the expression levels of Vimentin and N-cadherin (mesenchymal markers) are increased. Several studies have reported that FoxJ2 can inhibit cancer migration, invasion and the EMT phenotype (43–44,52,53). Consistent with these findings, the present study identified a decrease in Vimentin and N-cadherin expression levels, and an increase in E-cadherin expression in miR-454-5p-silenced cells, whereas knockdown of FoxJ2 reversed these effects, suggesting that miR-454-5p may induce an EMT phenotype in breast cancer. Furthermore, it was revealed that FoxJ2 could bind to the E-cadherin promoter region and transactivated E-cadherin expression. Thus, the present results suggested that miR-454-5p promoted breast cancer progression through the induction of an EMT phenotype by downregulating the FoxJ2/E-cadherin axis.

In conclusion, the present study demonstrated that miR-454-5p was upregulated in breast cancer. It was suggested that miR-454-5p may promote breast cancer progression through the induction of EMT by targeting the FoxJ2/E-cadherin axis. Therefore, miR-454-5p may serve as a novel therapeutic target and prognostic predictor for patients with breast cancer.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

CPW and YZY contributed to writing the manuscript collection and analysis of data. HZ, LJX, YW, and QTW collected and interpreted data. QM contributed to study conception and design as well as revising and approving the final version of the manuscript. CPW and QM confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experimental procedures were approved by the Animal Experimentation Ethics Committee of Qingdao Central Hospital (Qingdao, China; approval no. KY202014301).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2020. CA Cancer J Clin. 70:7–30. 2020. View Article : Google Scholar : PubMed/NCBI

2 

DeSantis CE, Ma J, Gaudet MM, Newman LA, Miller KD, Goding Sauer A, Jemal A and Siegel RL: Breast cancer statistics, 2019. CA Cancer J Clin. 69:438–451. 2019. View Article : Google Scholar : PubMed/NCBI

3 

Bishop AJ, Ensor J, Moulder SL, Shaitelman SF, Edson MA, Whitman GJ, Bishnoi S, Hoffman KE, Stauder MC, Valero V, et al: Prognosis for patients with metastatic breast cancer who achieve a no-evidence-of-disease status after systemic or local therapy. Cancer. 121:4324–4332. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Liang Y, Zhang H, Song X and Yang Q: Metastatic heterogeneity of breast cancer: Molecular mechanism and potential therapeutic targets. Semin Cancer Biol. 60:14–27. 2020. View Article : Google Scholar : PubMed/NCBI

5 

Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Schmiedel JM, Klemm SL, Zheng Y, Sahay A, Blüthgen N, Marks DS and van Oudenaarden A: Gene expression. MicroRNA control of protein expression noise. Science. 348:128–132. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Loh HY, Norman BP, Lai KS, Rahman N, Alitheen NBM and Osman MA: The regulatory role of MicroRNAs in breast cancer. Int J Mol Sci. 20:49402019. View Article : Google Scholar : PubMed/NCBI

9 

Fan Y, Shi C, Li T and Kuang T: microRNA-454 shows anti-angiogenic and anti-metastatic activity in pancreatic ductal adenocarcinoma by targeting LRP6. Am J Cancer Res. 7:139–147. 2017.PubMed/NCBI

10 

Fan Y, Xu LL, Shi CY, Wei W, Wang DS and Cai DF: MicroRNA-454 regulates stromal cell derived factor-1 in the control of the growth of pancreatic ductal adenocarcinoma. Sci Rep. 6:227932016. View Article : Google Scholar : PubMed/NCBI

11 

Li W, Feng Y, Ma Z and Lu L: Expression of miR-454-3p and its effect on proliferation, invasion and metastasis of colon cancer. Nan Fang Yi Ke Da Xue Xue Bao. 38:1421–1426. 2018.(In Chinese). PubMed/NCBI

12 

Sun L, Wang Q, Gao X, Shi D, Mi S and Han Q: MicroRNA-454 functions as an oncogene by regulating PTEN in uveal melanoma. FEBS Lett. 589:2791–2796. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Bao X, Ren T, Huang Y, Sun K, Wang S, Liu K, Zheng B and Guo W: Knockdown of long non-coding RNA HOTAIR increases miR-454-3p by targeting Stat3 and Atg12 to inhibit chondrosarcoma growth. Cell Death Dis. 8:e26052017. View Article : Google Scholar : PubMed/NCBI

14 

Zuo J, Yu H, Xie P, Liu W, Wang K and Ni H: miR-454-3p exerts tumor-suppressive functions by down-regulation of NFATc2 in glioblastoma. Gene. 710:233–239. 2019. View Article : Google Scholar : PubMed/NCBI

15 

Shao N, Xue L, Wang R, Luo K, Zhi F and Lan Q: miR-454-3p is an exosomal biomarker and functions as a tumor suppressor in glioma. Mol Cancer Ther. 18:459–469. 2019. View Article : Google Scholar : PubMed/NCBI

16 

Fang B, Zhu J, Wang Y, Geng F and Li G: MiR-454 inhibited cell proliferation of human glioblastoma cells by suppressing PDK1 expression. Biomed Pharmacother. 75:148–152. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Li Y, Jiao Y, Fu Z, Luo Z, Su J and Li Y: High miR-454-3p expression predicts poor prognosis in hepatocellular carcinoma. Cancer Manag Res. 11:2795–2802. 2019. View Article : Google Scholar : PubMed/NCBI

18 

Zhou L, Qu YM, Zhao XM and Yue ZD: Involvement of miR-454 overexpression in the poor prognosis of hepatocellular carcinoma. Eur Rev Med Pharmacol Sci. 20:825–829. 2016.PubMed/NCBI

19 

Jin C, Lin T and Shan L: Downregulation of Calbindin 1 by miR-454-3p suppresses cell proliferation in nonsmall cell lung cancer in vitro. Cancer Biother Radiopharm. 34:119–127. 2019. View Article : Google Scholar : PubMed/NCBI

20 

Liu S, Ge X, Su L, Zhang A and Mou X: MicroRNA-454 inhibits nonsmall cell lung cancer cells growth and metastasis via targeting signal transducer and activator of transcription-3. Mol Med Rep. 17:3979–3986. 2018.PubMed/NCBI

21 

Zhu DY, Li XN, Qi Y, Liu DL, Yang Y, Zhao J, Zhang CY, Wu K and Zhao S: MiR-454 promotes the progression of human non-small cell lung cancer and directly targets PTEN. Biomed Pharmacother. 81:79–85. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Cui X, Xiao D, Cui Y and Wang X: Exosomes-derived long non-coding RNA HOTAIR reduces laryngeal cancer radiosensitivity by regulating microRNA-454-3p/E2F2 axis. Onco Targets Ther. 12:10827–10839. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Wang DY, Li N and Cui YL: Long non-coding RNA CCAT1 sponges miR-454 to promote chemoresistance of ovarian cancer cells to cisplatin by regulation of surviving. Cancer Res Treat. 52:798–814. 2020. View Article : Google Scholar : PubMed/NCBI

24 

Fu Q, Gao Y, Yang F, Mao T, Sun Z, Wang H, Song B and Li X: Suppression of microRNA-454 impedes the proliferation and invasion of prostate cancer cells by promoting N-myc downstream-regulated gene 2 and inhibiting WNT/β-catenin signaling. Biomed Pharmacother. 97:120–127. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Huang C, Liu J, Pan X, Peng C, Xiong B, Feng M and Yang X: miR-454 promotes survival and induces oxaliplatin resistance in gastric carcinoma cells by targeting CYLD. Exp Ther Med. 19:3604–3610. 2020.PubMed/NCBI

26 

Jiang D, Li H, Xiang H, Gao M, Yin C, Wang H, Sun Y and Xiong M: Long chain non-coding RNA (lncRNA) HOTAIR knockdown increases miR-454-3p to suppress gastric cancer growth by targeting STAT3/Cyclin D1. Med Sci Monit. 25:1537–1548. 2019. View Article : Google Scholar : PubMed/NCBI

27 

Xu G, Zhu H, Zhang M and Xu J: Histone deacetylase 3 is associated with gastric cancer cell growth via the miR-454-mediated targeting of CHD5. Int J Mol Med. 41:155–163. 2018.PubMed/NCBI

28 

Song Z, Li W, Wang L, Jia N and Chen B: MicroRNA-454 inhibits tumor cell proliferation, migration and invasion by downregulating zinc finger Eboxbinding homeobox 1 in gastric cancer. Mol Med Rep. 16:9067–9073. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Song Y, Guo Q, Gao S and Hua K: miR-454-3p promotes proliferation and induces apoptosis in human cervical cancer cells by targeting TRIM3. Biochem Biophys Res Commun. 516:872–879. 2019. View Article : Google Scholar : PubMed/NCBI

30 

Wang S, Zhang G, Zheng W, Xue Q, Wei D, Zheng Y and Yuan J: MiR-454-3p and miR-374b-5p suppress migration and invasion of bladder cancer cells through targetting ZEB2. Biosci Rep. 38:BSR201814362018. View Article : Google Scholar : PubMed/NCBI

31 

Guo JY, Wang YK, Lv B and Jin H: miR-454 performs tumor-promoting effects in oral squamous cell carcinoma via reducing NR3C2. J Oral Pathol Med. 49:286–293. 2020. View Article : Google Scholar : PubMed/NCBI

32 

Niu G, Li B, Sun J and Sun L: miR-454 is down-regulated in osteosarcomas and suppresses cell proliferation and invasion by directly targeting c-Met. Cell Prolif. 48:348–355. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Wu X, Ding N, Hu W, He J, Xu S, Pei H, Hua J, Zhou G and Wang J: Down-regulation of BTG1 by miR-454-3p enhances cellular radiosensitivity in renal carcinoma cells. Radiat Oncol. 9:1792014. View Article : Google Scholar : PubMed/NCBI

34 

Li X, Hou L, Yin L and Zhao S: LncRNA XIST interacts with miR-454 to inhibit cells proliferation, epithelial mesenchymal transition and induces apoptosis in triple-negative breast cancer. J Biosci. 45:452020. View Article : Google Scholar : PubMed/NCBI

35 

Ren L, Chen H, Song J, Chen X, Lin C, Zhang X, Hou N, Pan J, Zhou Z, Wang L, et al: MiR-454-3p-mediated Wnt/β-catenin signaling antagonists suppression promotes breast cancer metastasis. Theranostics. 9:449–465. 2019. View Article : Google Scholar : PubMed/NCBI

36 

Li Q, Liu J, Meng X, Pang R and Li J: MicroRNA-454 may function as an oncogene via targeting AKT in triple negative breast cancer. J Biol Res (Thessalon). 24:102017. View Article : Google Scholar : PubMed/NCBI

37 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Rastaldi MP: Epithelial-mesenchymal transition and its implications for the development of renal tubulointerstitial fibrosis. J Nephrol. 19:407–412. 2006.PubMed/NCBI

39 

Dongre A and Weinberg RA: New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat Rev Mol Cell Biol. 20:69–84. 2019. View Article : Google Scholar : PubMed/NCBI

40 

Ding L, Gu H, Xiong X, Ao H, Cao J, Lin W, Yu M, Lin J and Cui Q: MicroRNAs involved in carcinogenesis, prognosis, therapeutic resistance and applications in human triple-negative breast cancer. Cells. 8:14922019. View Article : Google Scholar : PubMed/NCBI

41 

Petri BJ and Klinge CM: Regulation of breast cancer metastasis signaling by miRNAs. Cancer Metastasis Rev. 39:837–886. 2020. View Article : Google Scholar : PubMed/NCBI

42 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

43 

Yang Q, Cao X, Tao G, Zhou F, Zhao P, Shen Y and Chen X: Effects of FOXJ2 on TGF-β1-induced epithelial-mesenchymal transition through Notch signaling pathway in non-small lung cancer. Cell Biol Int. 41:79–83. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Qiang Y, Wang F, Yan S, Zhang H, Zhu L and Chen Z, Tu F, Wang D, Wang G, Wang W and Chen Z: Abnormal expression of Forkhead Box J2 (FOXJ2) suppresses migration and invasion in extrahepatic cholangiocarcinoma and is associated with prognosis. Int J Oncol. 46:2449–2458. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Qiu X, Ji B, Yang L, Huang Q, Shi W, Ding Z, He X, Ban N, Fan S, Zhang J and Tian Y: The role of FoxJ2 in the migration of human glioma cells. Pathol Res Pract. 211:389–397. 2015. View Article : Google Scholar : PubMed/NCBI

46 

Wang Y, Yang S, Ni Q, He S, Zhao Y, Yuan Q, Li C, Chen H, Zhang L, Zou L, et al: Overexpression of forkhead box J2 can decrease the migration of breast cancer cells. J Cell Biochem. 113:2729–2737. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Lee C and Huang CH: LASAGNA-Search 2.0: Integrated transcription factor binding site search and visualization in a browser. Bioinformatics. 30:1923–1925. 2014. View Article : Google Scholar : PubMed/NCBI

48 

Crudele F, Bianchi N, Reali E, Galasso M, Agnoletto C and Volinia S: The network of non-coding RNAs and their molecular targets in breast cancer. Mol Cancer. 19:612020. View Article : Google Scholar : PubMed/NCBI

49 

Cao ZG, Li JJ, Yao L, Huang YN, Liu YR, Hu X, Song CG and Shao ZM: High expression of microRNA-454 is associated with poor prognosis in triple-negative breast cancer. Oncotarget. 7:64900–64909. 2016. View Article : Google Scholar : PubMed/NCBI

50 

Jin Y, Liang Z and Lou H: The emerging roles of fox family transcription factors in chromosome replication, organization, and genome stability. Cells. 9:2582020. View Article : Google Scholar : PubMed/NCBI

51 

Kehn K, Berro R, Alhaj A, Bottazzi ME, Yeh WI, Klase Z, Van Duyne R, Fu S and Kashanchi F: Functional consequences of cyclin D1/BRCA1 interaction in breast cancer cells. Oncogene. 26:5060–5069. 2007. View Article : Google Scholar : PubMed/NCBI

52 

Qiang Y, Feng L, Wang G, Liu J, Zhang J, Xiang L, Su C, Zhang S, Xie X and Chen E: miR-20a/Foxj2 axis mediates growth and metastasis of colorectal cancer cells as identified by integrated analysis. Med Sci Monit. 26:e9235592020. View Article : Google Scholar : PubMed/NCBI

53 

Zhang H, Tang QF, Sun MY, Zhang CY, Zhu JY, Shen YL, Zhao B, Shao ZY, Zhang LJ and Zhang H: ARHGAP9 suppresses the migration and invasion of hepatocellular carcinoma cells through up-regulating FOXJ2/E-cadherin. Cell Death Dis. 9:9162018. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang C, Yu Y, Zhao H, Xie L, Wang Q, Wang Y and Mu Q: MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis. Oncol Rep 46: 127, 2021.
APA
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., & Mu, Q. (2021). MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis. Oncology Reports, 46, 127. https://doi.org/10.3892/or.2021.8078
MLA
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., Mu, Q."MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis". Oncology Reports 46.1 (2021): 127.
Chicago
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., Mu, Q."MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis". Oncology Reports 46, no. 1 (2021): 127. https://doi.org/10.3892/or.2021.8078
Copy and paste a formatted citation
x
Spandidos Publications style
Wang C, Yu Y, Zhao H, Xie L, Wang Q, Wang Y and Mu Q: MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis. Oncol Rep 46: 127, 2021.
APA
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., & Mu, Q. (2021). MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis. Oncology Reports, 46, 127. https://doi.org/10.3892/or.2021.8078
MLA
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., Mu, Q."MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis". Oncology Reports 46.1 (2021): 127.
Chicago
Wang, C., Yu, Y., Zhao, H., Xie, L., Wang, Q., Wang, Y., Mu, Q."MicroRNA‑454‑5p promotes breast cancer progression by inducing epithelial‑mesenchymal transition via targeting the FoxJ2/E‑cadherin axis". Oncology Reports 46, no. 1 (2021): 127. https://doi.org/10.3892/or.2021.8078
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team