Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
September-2021 Volume 46 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2021 Volume 46 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway

  • Authors:
    • Zi-Qian Zhang
    • Xue Wang
    • Bing-Hua Xue
    • Yun Zhao
    • Fang Xie
    • Shi-Da Wang
    • Cong Xue
    • Ying Wang
    • Yan-Shu Zhang
    • Ling-Jia Qian
  • View Affiliations / Copyright

    Affiliations: Laboratory Animal Center, North China University of Science and Technology, Tangshan, Hebei 063210, P.R. China, Department of Stress Medicine, Institute of Basic Medical Sciences, Beijing 100850, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 202
    |
    Published online on: July 23, 2021
       https://doi.org/10.3892/or.2021.8153
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

High malignancy and high mortality of glioma render it urgent to elucidate the underlying mechanisms of glioma carcinogenesis and explore novel targets for therapy. Epidemiologic and clinical studies have revealed that chronic stress promotes the progression of various solid tumors and is correlated with poor prognosis; however, findings reporting the involvement of chronic stress in glioma are rare. In the present study, a chronic restraint animal model and a chronic stress cell model were established to explore the effects of chronic stress on glioma and its molecular mechanisms. The results revealed that chronic stress promoted glioma growth in vivo, and the serum levels of the stress hormones glucocorticoid (GC) and noradrenaline (NE) were significantly increased. In addition, GC and NE were verified to accelerate the proliferation of glioma cells in vitro. Mechanistically, the phosphatidylinositol 3‑kinase (PI3K)/Akt signaling pathway was revealed to be activated under stress conditions, and inhibition of the expression of p‑Akt could restrain the stress hormone‑induced glioma cell proliferation. In addition, our data indicated that the GC receptor (GR) and β‑adrenergic receptors (ADRBs) were both required for the biological functions of GC and NE in glioma cells. In conclusion, these results indicated that chronic stress and the stress hormones GC and NE activated PI3K/Akt signaling through binding to GR and ADRBs, thereby promoting glioma cell growth. Our findings may provide potential therapeutic targets and pave the way for the development of new strategies to protect patients with glioma from the detrimental effects of stress on tumor progression.

Introduction

Malignant glioma is the most common primary intracranial tumor, accounting for approximately 80% of central nervous system malignancies (1). At present, the treatment of glioma is still mainly based on surgical tumor removal supplemented by radiation therapy, chemotherapy, and other comprehensive treatment methods (2). Glioma is characterized by rapid proliferation, aggressive growth, and strong cellular heterogeneity (3,4), which is the main reason why glioma is difficult to remove completely by surgery and why glioma is associated with high recurrence rates and poor prognosis. There are numerous measures of glioma prognosis, such as overall survival (OS) at one year, progression-free survival, and median survival. Of these, median survival is the most common and widely accepted metric for establishing the prognosis of glioma multiforme. The median survival of patients with glioblastoma multiforme (5–8), the most malignant glioma, is only 1 to 2 years (9). Therefore, it is urgent to investigate the regulatory mechanisms of glioma growth and explore new therapeutic targets.

Patients with cancer suffer from mental and physical stress, which causes an adverse stress response in the body and seriously affects clinical treatment and prognosis. Epidemiologic and clinical experimental studies have revealed that chronic stress can promote the progression of tumor and is closely related to poor prognosis (10–12). The hypothalamic-pituitary-adrenal (HPA) axis and the sympathetic nervous system (SNS) are activated by chronic stress, which is characterized by increased secretion of glucocorticoid (GC) and catecholamines (13). Numerous studies have revealed that GC signaling activation may contribute to progression of solid tumors, primarily through i) inducing anti-apoptosis activity and chemotherapy resistance and ii) disrupting antitumor immunity (14–16). It has been reported that the catecholamines, especially noradrenaline (NE), can alter downstream signaling pathways by binding to membrane receptors and are involved in the regulation of tumor growth. It has been revealed that NE binds to β-adrenergic receptors (ADRBs) and activates the cAMP/PKA signaling pathway in various cancers, such as ovarian, prostate, and pancreatic cancer (17–20). Propranolol, an ADRB inhibitor, has been demonstrated to inhibit tumor growth and metastasis (21,22), which provides a new strategy for the treatment of tumors. In addition, catecholamines can also directly promote cancer cell proliferation through α-adrenergic receptors (ADRAs) (23). However, findings reporting the involvement of chronic stress in glioma are rare.

Numerous studies have revealed the changes of some genes and signaling pathways involved in the occurrence and development of glioma. The predominant signaling pathways involved in glioma cell regulation include the RAS/RAF/ERK pathway, the p53/MDM2/p21 pathway, and the phosphatidylinositol 3-kinase (PI3K)/Akt/mTOR pathway (24–26). Studies have revealed that inhibition of PI3K/Akt signaling can increase autophagy levels of tumor cells, and thereby restrain cell proliferation and induce apoptosis (27–29). Akt, also known as protein kinase B, is one of the most important downstream target kinases in the PI3K signal transduction pathway. It is in the central link of the PI3K/Akt pathway, and thus it plays an important role in a series of biological activities such as apoptosis, survival, and proliferation (30). However, there are few studies on the regulatory effects of the PI3K/Akt signaling pathway on the chronic stress-induced proliferation of gliomas.

In the present study, the effect of chronic stress on the malignant behavior of glioma was explored and its accelerative role in glioma cell proliferation was elucidated. To investigate whether chronic stress and stress hormone-induced glioma cell proliferation are regulated by the PI3K/Akt signaling pathway in vivo and in vitro, chronic stress animal experiments and cytological experiments were used. The present study was performed to investigate the targets and molecular mechanisms of chronic stress in regulating glioma progression and to provide new targets for the treatment of glioma.

Materials and methods

Animal model

A total of 10 male BALB/c nude mice (6–8 weeks old; weight, ~18 g) were used in the present study. The feeding conditions were as follows: Temperature, 18–22°C; relative humidity, 50–60%; 10–14 h light/dark cycle. Feed was added 3–4 times a week and water was changed 2–3 times a week. All of the animal experiments were approved (approval no. 2016-0002) by the Institutional Animal Care and Use Committee of the Academy of Military Medicine Sciences (Beijing, China). The experimental group was divided into the chronic restraint stress group and the control group, with 5 rats in each group. A restraint stress procedure was adopted based on previous studies (17,31). The animals in the stress group were subjected to restraint adaptation for 1 week, which was gradually extended to 6 h per day. Next, U87MG glioma cells were injected subcutaneously into the mice of both groups at 2×106 cells per mouse. Then, the stress group was subjected to restraint stress for 21 days, 6 h per day (9 am to 3 pm). Since the restrained group could not eat and drink normally during restraint, the control mice were also deprived of water and food during the restraining period. The animals in the control group were also treated with water and food deprivation during the restraint period. The health and behavior of animals were monitored and observed every Wednesday and Saturday at 9 a.m. The checks included the growth of the xenograft (measurement of tumor size), the general condition of the mice (weight and mental status), abdominal breathing (breathing rate), and paw and toe characteristics (whether the paws and toes had fight damage). Adequate food and water was ensured and mice were sacrificed after 5 weeks. The specific criteria for euthanasia applied in this experiment were according to the Guidelines for the Review of Humane Endpoints in Animal Experiments (GB/T1.1-2009; www.chinesestandard.net/PDF.aspx/GBT1.1-2009); rapid cervical dislocation for euthanasia when the tumor metastasizes or grows rapidly to the point of ulceration, causing infection or necrosis, and observation of the experimental mice for two to three min without voluntary respiration and no blink reflex, was considered as having succumbed. The tumor samples were collected and embedded in paraffin for subsequent analysis.

Cell culture and intervention

The glioma cell lines U87MG and LN229 were purchased from the Chinese National Infrastructure of Cell Line Resource. U87MG cells were cultured in MEM (Sigma-Aldrich; Merck KGaA) medium containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin, 100 U/ml streptomycin, and 100 µg/ml nonessential amino acids. LN229 cells were cultured in DMEM (Sigma-Aldrich; Merck KGaA) medium containing 10% FBS, 100 U/ml penicillin, and 100 U/ml streptomycin. All cells were cultured in a humidified incubator containing 5% CO2 at 37°C. U87MG cells were used as ‘glioblastoma of unknown origin’ and identified by short tandem repeat analysis.

Stress hormones (GC and NE), an Akt-specific inhibitor (perifosine), or receptor antagonists were added to the culture medium for intervention. Based on successful activation/inhibition in previous publications (32,33), the concentrations of all drugs were selected as follows: GC (10 µmol/l), NE (10 µmol/l), perifosine (10 µmol/l; cat. no. S1037), eplerenone [mineralocorticoid receptor (MR) antagonist, 5.2 µmol/l; cat. no. S1707], mifepristone (GR receptor antagonist, 5.2 µmol/l; cat. no. S2606), phentolamine (ADRA antagonist, 0.2 µmol/l; cat. no. S2038), propranolol (ADRB antagonist, 24 µmol/l; cat. no. S4076), atenolol (ADRB1 antagonist, 0.5 µmol/l; cat. no. S4817), and higenamine hydrochloride (ADRB2 antagonist, 1.4 µmol/l; cat. no. S3960). An equal volume of dimethyl sulfoxide (DMSO) was used as the control. The inhibitor and antagonists were purchased from Selleck Chemicals.

Immunohistochemistry

Hematoxylin-eosin (H&E) staining and immunohistochemistry were performed as previously described (28). Briefly, paraffin-embedded sections were deparaffinized in xylene and rehydrated, followed by antigen retrieval in sodium citrate. After blocking with 1% BSA (BioFroxx), the sections were incubated with anti-Ki67 (1:200; cat. no. A11005) and anti-p-Akt (1:100; cat. no. AP0004; both from ABclonal Biotech Co., Ltd.) overnight at 4°C. A DAB kit (ZLI-9018; ZSGB-BIO; OriGene Technologies, Inc.) was utilized to stain until the desired stain intensity was developed. Sections were then counterstained with hematoxylin, dehydrated, and mounted.

ELISA

Serums were collected from the stressed mice and the control mice. The serum concentrations of GC and NE were determined using a mouse GC ELISA kit (cat. no. D721183) and a mouse NE ELISA kit (cat. no. D751020; both from Sangon Biotech, Co., Ltd.), respectively, following the manufacturer's instructions. The ELISA kits were purchased from Shanghai Guduo Biological Technology Co., Ltd.

Colony formation assay

Glioma cells were inoculated into a 6-well plate at 2,000 cells/well. GC, NE, Akt signaling inhibitor, or DMSO was added and the culture solution was changed every 3 days. After culturing for 7–10 days, the cells were fixed with 2 ml of 4% paraformaldehyde for 15 min at 4°C and stained at room temperature with 10% crystal violet solution for 30 min. The colonies with >10 cells were counted under a low-power light microscope and representative images were captured.

Cell Counting Kit-8 (CCK-8) assay

Cells in logarithmic growth phase were inoculated into a 96-well plate at 500 cells/well in quintuplicate and incubated. After the cells adhered to the wall, GC, NE, inhibitors, and antagonists were added. After continuous culture for 0, 24, and 48 h, the drug-containing medium was discarded, and freshly prepared solution containing 10 µl CCK-8 (Dojindo Molecular Technologies, Inc.) was added into each well. After incubation at 37°C for 1 h, the OD value at 450 nm was measured by an enzyme mapping instrument (Varioskan Flash; Thermo Fisher Scientific, Inc.). The experiment was repeated three times.

Cell cycle experiment

The cells were digested to single cells and centrifuged at 1,000 rpm for 5 min to collect cell precipitates. Then 70% ethanol was added and cells were fixed overnight at 4°C. After washing with PBS, the cells were resuspended in 500 µl PBS containing 50 µg/ml PI, 100 µg/ml RNase A, and 0.2% Triton X-100 and incubated for 30 min at room temperature. Flow cytometry (CytomicsFC500; Beckman Coulter) was used to detect 20,000-30,000 cells. The results were analyzed by cell cycle fitting software ModFit LT 4.1 (Verity Software House).

Western blot analysis

The cells were lysed in RIPA buffer (Biosharp) containing protease inhibitors and centrifuged at 12,000 × g for 15 min at 4°C. The pellet was discarded and loading buffer (Tiangen Biotech Co., Ltd.) was added to the supernatant. Protein determination was performed by bicinchoninic acid assay. Samples were boiled for 5 min and proteins (30 µg) were separated by 10 or 12% SDS-PAGE, followed by transfer to a PVDF membrane using a dry transfer system (Bio-Rad Laboratories, Inc.). The membrane was blocked in 5% milk at room temperature for 1 h, washed 3 times in 1X TBST (0.5% Tween-20), and incubated at 4°C for 8 h with rabbit anti-PI3K (1:1,000; product no. 4255; Cell Signaling Technology, Inc.), rabbit anti-p-PI3K (1:1,000; product no. 13857; Cell Signaling Technology, Inc.), rabbit anti-Akt (1:1,000; cat. no. 51077-1-AP; ProteinTech Group, Inc.), mouse anti-p-Akt (1:1,000; cat. no. 66444-1-lg; ProteinTech Group, Inc.), or mouse anti-GAPDH (1:5,000; cat. no. 60004-1-lg; ProteinTech Group, Inc.). After washing three times in 1X TBST, membranes were incubated with HRP-labeled goat anti-rabbit IgG (1:5,000; cat. no. ZB-2301; ZSJQ-Bio) or goat anti-mouse IgG (1:5,000; cat. no. ZB-2305; ZSJQ-Bio) for 2 h at room temperature. Protein bands were visualized with an ECL western blotting substrate kit (Thermo Fisher Scientific, Inc.). The protein molecular weights of PI3K (110 kDa) and Akt (57 kDa) were so close to their corresponding phosphorylated proteins, p-PI3K (100 kDa) and p-Akt (60 kDa), that the same protein strip needed to be washed with stripping buffer and then re-incubated with the antibody as well as exposed, followed by image acquisition and analysis by ImageQuant LAS 4000 (GE Healthcare Bio-Sciences; Cytiva).

siRNA transfection and quantitative (q)PCR

The siRNAs targeting ADRB1 and ADRB2 were synthesized by TsingKe Biological Technology. Sequences of siRNAs targeting ADRB1 were as follows: Sense, 5′-CCGAUAGCAGGUGAACUCGAA−3′ and antisense, 5′-GGCUAUCGUCCACUUGAGCUU−3′. Sequences of siRNAs targeting ADRB2 were as follows: Sense, 5′-CAGAGUGGAUAUCACAUGGAA−3′ and antisense, 5′-GUCUCACCUAUAGUGUACCUU−3′. siRNA or siRNA negative control (2.2 pmol) was diluted in 200 µl of serum-free medium and mixed with a pipette. INTERFERin® (Polyplus transfection) reagent (12 µl) was added, followed by vortex for 10 sec and spinning twice. After 10 min of incubation at room temperature, the transfection mixture was added to the serum-containing medium and the cells were incubated for 48 h before performing the experiments, with the following groups: Ctrl group, siRNA negative control and siRNA group. For siRNA against Akt, the product Akt1/2 siRNA (h) (product no. sc-43609) was used, purchased from Santa Cruz Biotechnology, Inc. siRNA or siRNA negative control was diluted to 20 µmol/l with sterilized ddH2O. The transfection mixture was added to serum-containing medium, and the cells were incubated for 12 h before performing the experiments with the following groups: Ctrl group, siRNA negative control and Akt1/2 siRNA (h) group. The siRNA negative control was purchased from TsingKe Biological Technology. Sequences of siRNA negative control were as follows: SiRNA negative control forward, 5′-UUCUCCGAACGUGUCACGUTT−3′ and reverse, 5′-ACGUGACACGUUCGGAGAATT−3′. Successful siRNA knockdown was verified by qPCR. Total RNA from cells or tissues was extracted using TRIzol reagent (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. Reverse transcription (ABScriptII One Step RT-qPCR; Abclonal Biotech Co., Ltd.) reactions were performed with SYBR-Green. Real-time PCR was performed using a LightCycler 96 Real-time PCR System (Roche Diagnostics) with TB Green Premix Ex Taq kit (Takara Biotechnology Co., Ltd.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min, denaturation at 95°C for 5 sec, annealing at 60°C for 30 sec and extension at 72°C for 35 sec, for 40 cycles. β-Actin was used as the internal control. All samples were normalized to the internal controls, and fold changes were calculated via the relative quantification method (2−ΔΔCq) (34). The primer sequences used were as follows: ADRB1 forward, 5′-GACGCTCACCAACCTCTTCA-3′ and reverse, ACTTGGGGTCGTTGTAGCAG; ADRB2 forward, 5′-TGATCGCAGTGGATCGCTAC-3′ and reverse, 5′-CCACCTGGCTAAGGTTCTGG-3′; AKT1 forward, 5′-ACTGTCATCGAACGCACCTT-3′ and reverse, 5′-TCGGAGCCCCCGAGTTG-3′; AKT2 forward, 5′-CCTCTGCAAAGAGGGCATCA-3′ and reverse, 5′-GAGGATGAGCTCGAAGAGGC-3′. β-actin forward, 5′-AATCGTGCGTGACATTAAGGAG-3′, and reverse, 5′-ACTGTGTTGGCGTACAGGTCTT-3′.

Statistical analysis

All of the data are listed as the mean ± standard deviation (SD). The continuous variables were evaluated for normality before comparison for statistical differences. Paired Student's t-tests were used for comparisons between two groups. One-way analysis of variance (ANOVA) was performed to compare the values among multiple groups. Significant results of ANOVA were subjected to Tukey's post hoc test. All of the differences were two-sided. Statistical analysis was conducted with GraphPad Prism 5.0 software (GraphPad Software, Inc.) and P<0.05 was considered to indicate a statistically significant difference.

Results

Chronic stress promotes glioma growth in vivo, accompanied by an increase in serum GC and NE levels

To explore the effects of chronic stress on glioma growth, U87MG cells were subcutaneously injected into nude mice and a well-established chronic restraint stress model was adopted as previously described (17,31). Xenograft growth was monitored. The results revealed that the xenograft tumors in the stress group were larger than those in the control group at 4 weeks post-implantation (Fig. 1A). At 5 weeks post-inoculation, the tumors were removed and weighed, and the difference between the two groups was significant (Fig. 1B). Furthermore, although H&E staining revealed no significant difference in the morphology of tumor tissues between the two groups (Fig. 1C), immunohistochemical staining revealed that the positive expression rate of Ki67 in the stress group was higher than that in the control group (Fig. 1D). Thus, the results indicated that chronic stress could enhance the tumor burden in the mouse model. As GC and NE are two of the most important stress hormones, their concentrations in the serum from control and stressed mice were examined. The serum levels of both GC and NE were higher in the chronic stress group (Fig. 1E).

Figure 1.

Chronic stress promotes glioma growth in vivo. (A) Xenograft tumor growth was monitored. (B) The weight of xenograft tumors from control and stress groups was compared. (C) Representative images of hematoxylin and eosin staining of xenograft tumors. Magnification, ×100; scale bar, 100 µm. Magnification ×200; scale bar, 50 µm. (D) Representative images of immunohistochemical staining of Ki67 in xenograft tumors. Magnification, ×100; scale bar, 100 µm. Magnification, ×200; scale bar, 50 µm. (E) Concentrations (ng/ml) of glucocorticoid and norepinephrine in serum of control and stress mice after sacrifice. Data are presented as the mean ± SD (n=3). **P<0.01. GC, glucocorticoid; NE, norepinephrine.

GC and NE enhance glioma cell proliferation in vitro

To further characterize the role of chronic stress in regulating the malignant behavior of glioma cells, the stress hormones GC and NE were added to U87MG and LN229 cells in vitro. The CCK-8 assay was used to examine cell growth. Compared with the control group, the proliferation rate of the GC- and NE-treated cells was increased (Fig. 2A). Consistently, the results of the colony formation assay also revealed that the GC- and NE-treated cells formed more colonies (Fig. 2B). Furthermore, the cell cycle distribution was determined by flow cytometric analysis. The data revealed a decrease in G0/G1-phase cells and an enhanced S-phase transition after GC or NE intervention (Fig. 2C). Collectively, these results supported the theory that stress could accelerate glioma cell proliferation by increasing the concentrations of GC and NE.

Figure 2.

Stress hormones facilitate glioma cell proliferation. (A) Cell Counting Kit-8 results of U87MG and LN229 cells treated with GC (10 µmol/l) or NE (10 µmol/l). (B) Representative images and statistical analysis of colony formation assays in U87MG and LN229 cells treated with GC or NE. (C) Cell cycle assay and statistical analysis of U87MG and LN229 cells treated with GC or NE. Data are presented as the mean ± SD (n=3). **P<0.01. GC, glucocorticoid; NE, norepinephrine; n.s., no significance.

PI3K/Akt signaling is activated by chronic stress

Considering PI3K/Akt signaling is hyperactivated in various cancers and plays a critical role in cell proliferation and survival (27,28), the influence of chronic stress on PI3K/Akt signaling was evaluated. Western blot results revealed that compared with the DMSO group, the expression levels of p-PI3K and p-Akt in U87MG and LN229 cells were increased after GC or NE intervention, indicating the PI3K/Akt pathway was activated (Fig. 3A). Moreover, the immunohistochemical results further confirmed that the positive expression rate of p-Akt in xenografts in stressed mice was higher than that in xenografts in control mice (Fig. 3B). The aforementioned results indicated that the PI3K/Akt signaling pathway may have a regulatory role in chronic stress-induced glioma proliferation.

Figure 3.

Chronic stress activates the PI3K/Akt signaling pathway. (A) Western blot assay and statistical analysis of PI3K/Akt signaling-related proteins in U87MG and LN229 cells treated with GC or NE. (B) Representative images and statistical analysis of immunohistochemical staining of p-Akt in xenograft tumors from control and stress mice. Magnification, ×100; scale bar, 100 µm. Magnification, ×200; scale bar, 50 µm. Data are presented as the mean ± SD (n=3). **P<0.01. PI3K, phosphatidylinositol 3-kinase; GC, glucocorticoid; NE, norepinephrine; p-, phosphorylated; n.s., no significance.

Chronic stress promotes glioma cell proliferation via Akt signaling

To elucidate the role of Akt signaling in chronic stress-induced glioma cell proliferation, the Akt-specific inhibitor perifosine was used. Firstly, the influence of perifosine on the p-Akt levels was determined by western blot analysis. The results revealed that perifosine could effectively inhibit the expression of p-Akt (Figs. 4A and S1A). As anticipated, the reduction in p-Akt levels significantly inhibited the GC- and NE-induced growth and colony formation of U87MG and LN229 cells (Fig. 4B and C). In addition, the cell cycle analysis revealed an increased proportion of G0/G1-phase cells and a decreased proportion of S-phase cells upon treatment with GC or NE combined with perifosine compared with GC or NE treatment alone (Fig. 4D). Experiments using siRNA targeting Akt revealed the same results (Fig. S1B-D). The stress hormones GC and NE were able to promote the proliferation of glioma cells, while inhibition of the Akt signaling pathway significantly reduced the proliferation of glioma cells. Although inhibition of the Akt signaling pathway failed to completely eliminate the difference in proliferation between cells in the GC and NE groups and control cells, the ratio of GC + perifosine/DMSO + perifosine or NE + perifosine/DMSO + perifosine was decreased compared with that of GC/DMSO or NE/DMSO in the number of clones and S-phase cells (Fig. S2). In conclusion, these data indicated that inhibition of p-Akt expression, at least to some extent, inhibited stress hormone-induced glioma cell proliferation.

Figure 4.

Inhibition of Akt signaling suppresses stress-induced glioma cell proliferation. (A) Western blot assay and statistical analysis of p-Akt levels in U87MG and LN229 cells treated with GC or NE with or without Akt signaling inhibitor (perifosine, 10 µmol/l). (B) CCK8 results of U87MG and LN229 cells after the inhibition of Akt signaling. (C) Representative images and statistical analysis of colony formation assays in U87MG and LN229 cells after the inhibition of Akt signaling. (D) Cell cycle assay and statistical analysis of U87MG and LN229 cells after the inhibition of Akt signaling. Data are presented as the mean ± SD (n=3). **P<0.01. p-, phosphorylated; GC, glucocorticoid; NE, norepinephrine.

GR and ADRBs are required for GC- and NE-mediated Akt activation and glioma cell proliferation

GC directly binds to MR or GR (35). Different antagonists were used to determine the receptor type that participates in the GC-mediated Akt activation and cell proliferation. Compared with the GC-treated group, the GR antagonist mifepristone could reduce the expression of p-Akt, while the MR antagonist eplerenone revealed no effect (Fig. 5A). Consistently, CCK-8 assay results revealed that mifepristone, but not eplerenone, reduced the distinct growth capacity of U87MG and LN229 cells between the GC group and the DMSO group (Fig. 5B).

Figure 5.

GR contributes to GC-enhanced glioma cell proliferation. (A) Western blot assay and statistical analysis of p-Akt levels in U87MG and LN229 cells treated with GC with or without MR antagonist (eplerenone, 5.2 µmol/l) or GR antagonist (mifepristone, 5.2 µmol/l). (B) Cell Counting Kit-8 results of U87MG and LN229 cells with indicated treatment. Data are presented as the mean ± SD (n=3). **P<0.01. GR, glucocorticoid receptor; GC, glucocorticoid; p-, phosphorylated; MR, mineralocorticoid receptor; n.s., no significance.

Adrenergic receptors are classified as ADRAs and ADRBs. The p-Akt expression levels and cell growth rate were evaluated under different antagonist treatments. The results revealed that propranolol, the antagonist targeting ADRBs, not only abrogated the activation of p-Akt, but also abolished the discrepant glioma cell growth triggered by NE treatment (Fig. 6A and B). Considering ADRB1 and ADRB2 are the main ADRBs in glioma tissues (36), specific antagonists were further added. Lower p-Akt levels and reduced cell growth were observed in cells in which ADRB1 and ADRB2 were inhibited (Fig. 6C and D), suggesting both receptors are required for the biological function of NE in glioma cells. Moreover, intervention with low concentrations of ADRB1 and ADRB2 antagonists alone and in combination revealed that the two drugs exerted synergistic effects (Fig. S3). Experiments using siRNA targeting ADRB1/2 confirmed these results (Fig. S4).

Figure 6.

NE promotes glioma cell progression via ADRBs. (A) Western blot assay and statistical analysis of p-Akt levels in U87MG and LN229 cells treated with NE with or without ADRA antagonist (phentolamine, 0.2 µmol/l) or ADRB antagonist (propranolol, 24 µmol/l). (B) CCK-8 results of U87MG and LN229 cells after NE treatment with or without adrenergic receptor antagonists. (C) Western blot assay and statistical analysis of p-Akt levels in U87MG and LN229 cells treated with NE with or without ADRB1 antagonist (atenolol, 0.5 µmol/l) or ADRB2 antagonist (hydrochloride, 1.4 µmol/l). (D) CCK-8 results of U87MG and LN229 cells after NE treatment with or without ADRB antagonists. Data are presented as the mean ± SD (n=3). **P<0.01. NE, norepinephrine; ADRB, β-adrenergic receptor; p-, phosphorylated; ADRA, α-adrenergic receptor; CCK-8, Cell Counting Kit-8; n.s., no significance.

Discussion

Patients with cancer suffer from persistent mental and physical stress, which causes adverse stress reactions of the body and affects clinical treatment and prognosis. A large number of epidemiological investigations and clinical trials have revealed that chronic stress is closely related to the occurrence and development of a variety of tumors (37–39). However, findings reporting the involvement of chronic stress in glioma are rare. In the present study, it was revealed that chronic stress promoted glioma cell proliferation by activating PI3K/Akt signaling, indicating a stimulative role of chronic stress in glioma progression.

Periodic immobilization is a well-established chronic stress paradigm, in which stressed mice are restrained in a confined space that prevents them from moving freely or turning around but does not unduly compress them. This method has already been demonstrated to induce high levels of HPA axis and SNS activity characteristic of chronic stress (21,40,41). Thus, this paradigm was adopted to evaluate the effect of chronic stress on glioma growth in vivo. U87MG cells were injected subcutaneously into the mice, which were subjected to restraint stress for 21 days. It was revealed that the xenografts from the stressed mice exhibited enhanced tumor growth (larger size and higher weight). Consistently, the number of Ki67+ cells was significantly increased in the chronic stress group compared with that of the control group. These results indicated that chronic stress promoted glioma growth in vivo.

Chronic stress can induce aberrant persistent activation of the HPA axis and the SNS, leading to enhanced release of GC and the simultaneous elevation of catecholamine levels (42,43). In the present study, it was also demonstrated that the serum levels of GC and NE in chronic stressed mice were increased compared with control mice. Numerous studies have reported that stress-induced hormones contribute to tumor progression through a number of important biological processes, such as exerting antiapoptotic effects, inducing chemotherapy resistance, and disrupting antitumor immunity (14,44–46). The concentrations of these stress-related hormones are 1 nmol/l in normal human circulation, reaching up to 100 nmol/l under stress conditions and 10 µmol/l in the tumor microenvironment (47). To further verify whether chronic stress has the same stimulatory effect on glioma proliferation in vitro, the glioma cell lines U87MG and LN229 were treated with the stress hormones GC and NE at 10 µmol/l. The experimental results revealed that after intervention with stress hormones, the cell growth rate and clone number were significantly increased compared with the control group, and more cells were in the S phase. The aforementioned results were in agreement with the results of the animal studies, revealing that chronic stress also promoted glioma proliferation in vitro.

The activation of PI3K/Akt signaling can promote the proliferation of cancer cells and inhibit their apoptosis. Studies have revealed that inhibition of the activity of the PI3K/Akt signaling pathway can promote autophagy in tumor cells, thereby suppressing cell proliferation and inducing apoptosis (29,46,48). Consistently, the PI3K/Akt signaling pathway can inhibit anticancer drug-induced autophagy in U87MG cells (49). In the present study, it was also revealed that inhibiting PI3K/Akt signaling decreased glioma cell growth, colony formation, and S-phase transition. However, whether the PI3K/Akt signaling pathway plays a regulatory role in the chronic stress-induced proliferation of glioma cells remains unclear. Herein, the changes in the levels of PI3K/Akt signaling-related proteins upon chronic stress in vitro and in vivo were detected by western blotting and immunohistochemical assays. The results revealed that the signaling pathway was activated. Furthermore, perifosine, an Akt inhibitor, was used to block the pathway in vitro. Functional assays revealed that in U87MG cells, the number of clones increased up to 1.81-fold after GC treatment compared with the control, whereas after inhibition of Akt signaling, the number of GC-induced clones increased only 1.31-fold. In the cell cycle analysis, the number of S-phase cells increased to 1.25-fold after GC treatment compared with the control, while there was no proliferation trend of GC-induced S-phase cells compared with the control after inhibition of Akt signaling. Notably, similar results were obtained in LN229 cells and after NE treatment. In conclusion, these data indicated that inhibition of p-Akt expression, at least to some extent, suppressed stress hormone-induced glioma cell proliferation.

It has been reported that stress hormones are involved in the regulation of signaling pathways in tumor cells through binding to their receptors, among which GC primarily binds to GR (14), and NE has been revealed to combine with ADRA or ADRB (23,50). Herein, in order to investigate which receptor is required for the biological effects of GC and NE in glioma, the hormone binding to the receptors was reduced by using receptor antagonists of the GC-related receptors GR and MR and the NE-related receptors ADRA and ADRB. The results of protein immunoblotting experiments demonstrated that GR and ADRB antagonists could effectively reduce the expression of p-Akt. Consistently, CCK-8 results revealed that the two antagonists decreased the proliferation of glioma cells. Although the ADRBs can be divided into β1, β2, and β3 receptors, studies have reported that glioma tissues mainly express β1- and β2-adrenergic receptors (35,51,52). Therefore, the β1- and β2-receptors separately were further blocked. CCK-8 results revealed that this reduced the proliferation of glioma cells, indicating that both receptors are required for the regulation of glioma cell growth by NE. Collectively, our data indicated that GC mainly bound to GR and NE bound to ADRB1 and ADRB2 to exert their biological effects in glioma. In clinical practice, patients with glioma are bound to suffer from negative emotions and stress due to the disease. Therefore, glioma treatment can be combined with surgery and targeted blockade of the PI3K/Akt signaling pathway or blockade of GC/NE signaling and their corresponding receptors GR/ADRBs to achieve a more desirable therapeutic effect. Nevertheless, the molecular mechanisms by which the PI3K/Akt signaling pathway is activated after binding of stress hormones to receptors remain unknown.

In summary, our experiments are the first to explore the ability of chronic stress and stress-induced hormones to promote glioma proliferation in vivo and in vitro. Mechanistically, GC and NE mainly bound to GR and ADRBs and further activated the PI3K/Akt signaling pathway. The findings of the present study may provide potential therapeutic targets and facilitate the development of new strategies to protect patients with glioma from the detrimental effects of stress on tumor progression. However, there are still shortcomings in our experiments, such as not considering the sample size adequately in order to adhere to the 3R principle of animal welfare (Reduction, Replacement, Refinement) (53), and thus the sample size will be increased accordingly to render the data more scientific and reliable when the same problems will be encountered in future experiments.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was supported (grant nos. 81702454, 31771290 and 31571173) by the National Natural Science Foundation of China.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ZQZ performed the experiments. ZQZ and XW analyzed and interpreted the data as well as critically revised the manuscript for important intellectual content. ZQZ performed the statistical analysis and drafted the manuscript. YSZ and LJQ provided administrative and technical support and also supervised the study. ZQZ, XW, BHX, YZ, FX, SDW, CX and YW contributed to the conception and design of the study. All authors read and approved the final manuscript and agree to be accountable for all aspects of the research.

Ethics approval and consent to participate

All of the animal experiments were approved (approval no. 2016-0002) by the Institutional Animal Care and Use Committee of the Academy of Military Medicine Sciences (Beijing, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

GC

glucocorticoid

NE

noradrenaline

PI3K

phosphatidylinositol 3-kinase

GR

glucocorticoid receptor

MR

mineralocorticoid receptor

ADRA

α-adrenergic receptor

ADRB

β-adrenergic receptor

HPA

hypothalamic-pituitary-adrenal

SNS

sympathetic nervous system

FBS

fetal bovine serum

DMSO

dimethyl sulfoxide

SD

standard deviation

MR

mineralocorticoid receptor

References

1 

Ostrom QT, Gittleman H, Fulop J, Liu M, Blanda R, Kromer C, Wolinsky Y, Kruchko C and Barnholtz-Sloan JS: CBTRUS statistical report: Primary brain and central nervous system tumors diagnosed in the united states in 2008–2012. Neuro Oncol. 17 (Suppl 4):iv1–iv62. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Chinot OL, Wick W, Mason W, Henriksson R, Saran F, Nishikawa R, Carpentier AF, Hoang-Xuan K, Kavan P, Cernea D, et al: Bevacizumab plus radiotherapy-temozolomide for newly diagnosed glioblastoma. N Engl J Med. 370:709–722. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Cuddapah VA, Robel S, Watkins S and Sontheimer H: A neurocentric perspective on glioma invasion. Nat Rev Neurosci. 15:455–465. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Chen J, McKay RM and Parada LF: Malignant glioma: Lessons from genomics, mouse models, and stem cells. Cell. 149:36–47. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Gately L, McLachlan SA, Dowling A and Philip J: Life beyond a diagnosis of glioblastoma: A systematic review of the literature. J Cancer Surviv. 11:447–452. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch SJ, Holland E, et al: A multivariate analysis of 416 patients with glioblastoma multiforme: Prognosis, extent of resection, and survival. J Neurosurg. 95:190–198. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Carlsson SK, Brothers SP and Wahlestedt C: Wahlestedt, Emerging treatment strategies for glioblastoma multiforme. EMBO Mol Med. 6:1359–1370. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Witthayanuwat S, Pesee M, Supaadirek C, Supakalin N, Thamronganantasakul K and Krusun S: Survival analysis of glioblastoma multiforme. Asian Pac J Cancer Prev. 19:2613–2617. 2018.PubMed/NCBI

9 

Omuro A and DeAngelis LM: Glioblastoma and other malignant gliomas: A clinical review. JAMA. 310:1842–1850. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Graham J, Ramirez A, Love S, Richards M and Burgess C: Stressful life experiences and risk of relapse of breast cancer: Observational cohort study. BMJ. 324:14202002. View Article : Google Scholar : PubMed/NCBI

11 

Chida Y, Hamer M, Wardle J and Steptoe A: Do stress-related psychosocial factors contribute to cancer incidence and survival? Nat Clin Pract Oncol. 5:466–475. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Magnon C, Hall SJ, Lin J, Xue X, Gerber L, Freedland SJ and Frenette PS: Autonomic nerve development contributes to prostate cancer progression. Asian J Androl. 15:713–714. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Gray JD, Kogan JF, Marrocco J and McEwen BS: Genomic and epigenomic mechanisms of glucocorticoids in the brain. Nat Rev Endocrinol. 13:661–673. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Yang H, Xia L, Chen J, Zhang S, Martin V, Li Q, Lin S, Chen J, Calmette J, Lu M, et al: Stress-glucocorticoid-TSC22D3 axis compromises therapy-induced antitumor immunity. Nat Med. 25:1428–1441. 2019. View Article : Google Scholar : PubMed/NCBI

15 

Volden PA and Conzen SD: The influence of glucocorticoid signaling on tumor progression. Brain Behav Immun. 30 (Suppl):S26–S31. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Skor MN, Wonder EL, Kocherginsky M, Goyal A, Hall BA, Cai Y and Conzen SD: Glucocorticoid receptor antagonism as a novel therapy for triple-negative breast cancer. Clin Cancer Res. 19:6163–6172. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Thaker PH, Han LY, Kamat AA, Arevalo JM, Takahashi R, Lu C, Jennings NB, Armaiz-Pena G, Bankson JA, Ravoori M, et al: Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinoma. Nat Med. 12:939–944. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Park SY, Kang JH, Jeong KJ, Lee J, Han JW, Choi WS, Kim YK, Kang J, Park CG and Lee HY: Norepinephrine induces VEGF expression and angiogenesis by a hypoxia-inducible factor-1α protein-dependent mechanism. Int J Cancer. 128:2306–2316. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Radu M, Semenova G, Kosoff R and Chernoff J: PAK signalling during the development and progression of cancer. Nat Rev Cancer. 14:13–25. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Park MH, Lee HS, Lee CS, You ST, Kim DJ, Park BH, Kang MJ, Heo WD, Shin EY, Schwartz MA and Kim EG: p21-Activated kinase 4 promotes prostate cancer progression through CREB. Oncogene. 32:2475–2482. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Le CP, Nowell CJ, Kim-Fuchs C, Botteri E, Hiller JG, Ismail H, Pimentel MA, Chai MG, Karnezis T, Rotmensz N, et al: Chronic stress in mice remodels lymph vasculature to promote tumour cell dissemination. Nat Commun. 7:106342016. View Article : Google Scholar : PubMed/NCBI

22 

Na Z, Qiao X, Hao X, Fan L, Xiao Y, Shao Y, Sun M, Feng Z, Guo W, Li J, et al: The effects of beta-blocker use on cancer prognosis: A meta-analysis based on 319,006 patients. Onco Targets Ther. 11:4913–4944. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Lamkin DM, Sung HY, Yang GS, David JM, Ma JC, Cole SW and Sloan EK: α2-Adrenergic blockade mimics the enhancing effect of chronic stress on breast cancer progression. Psychoneuroendocrinology. 51:262–270. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Gao J, Liu X, Yang F, Liu T, Yan Q and Yang X: By inhibiting Ras/Raf/ERK and MMP-9, knockdown of EpCAM inhibits breast cancer cell growth and metastasis. Oncotarget. 6:27187–27198. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Das S: MDM2 Inhibition in a subset of sarcoma cell lines increases susceptibility to radiation therapy by inducing senescence in the polyploid cells. Adv Radiat Oncol. 5:250–259. 2020. View Article : Google Scholar : PubMed/NCBI

26 

O'Donnell JS, Massi D, Teng MWL and Mandala M: PI3K-AKT-mTOR inhibition in cancer immunotherapy, redux. Semin Cancer Biol. 48:91–103. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Jia X, Wen Z, Sun Q, Zhao X, Yang H, Shi X and Xin T: Apatinib suppresses the proliferation and apoptosis of gastric cancer cells via the PI3K/Akt signaling pathway. J buon. 24:1985–1991. 2019.PubMed/NCBI

28 

Chen H, Zhou L, Wu X, Li R, Wen J, Sha J and Wen X: The PI3K/AKT pathway in the pathogenesis of prostate cancer. Front Biosci (Landmark Ed). 21:1084–1091. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Costa RLB, Han HS and Gradishar WJ: Targeting the PI3K/AKT/mTOR pathway in triple-negative breast cancer: A review. Breast Cancer Res Treat. 169:397–406. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Ediriweera MK, Tennekoon KH and Samarakoon SR: Role of the PI3K/AKT/mTOR signaling pathway in ovarian cancer: Biological and therapeutic significance. Semin Cancer Biol. 59:147–160. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Cui B, Luo Y, Tian P, Peng F, Lu J, Yang Y, Su Q, Liu B, Yu J, Luo X, et al: Stress-induced epinephrine enhances lactate dehydrogenase A and promotes breast cancer stem-like cells. J Clin Invest. 129:1030–1046. 2019. View Article : Google Scholar : PubMed/NCBI

32 

Chen D, Tan Y, Li Z, Li W, Yu L, Chen W, Liu Y, Liu L, Guo L, Huang W and Zhao Y: Organoid cultures derived from patients with papillary thyroid cancer. J Clin Endocrinol Metab. 106:1410–1426. 2021. View Article : Google Scholar : PubMed/NCBI

33 

Hu R, Li X, Peng C, Gao R, Ma L, Hu J, Luo T, Qing H, Wang Y, Ge Q, et al: miR-196b-5p-enriched extracellular vesicles from tubular epithelial cells mediated aldosterone-induced renal fibrosis in mice with diabetes. BMJ Open Diabetes Res Care. 8:e0011012020. View Article : Google Scholar : PubMed/NCBI

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Zhe D, Fang H and Yuxiu S: Expressions of hippocampal mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) in the single-prolonged stress-rats. Acta Histochem Cytochem. 28(41): 89–95. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Zhang D, Ma Q, Shen S and Hu H: Inhibition of pancreatic cancer cell proliferation by propranolol occurs through apoptosis induction: The study of beta-adrenoceptor antagonist's anticancer effect in pancreatic cancer cell. Pancreas. 38:94–100. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Surman M and Janik ME: Stress and its molecular consequences in cancer progression. Postepy Hig Med Dosw (Online). 71:485–499. 2017. View Article : Google Scholar : PubMed/NCBI

38 

Umamaheswaran S, Dasari SK, Yang P, Lutgendorf SK and Sood AK: Stress, inflammation, and eicosanoids: An emerging perspective. Cancer Metastasis Rev. 37:203–211. 2018. View Article : Google Scholar : PubMed/NCBI

39 

Zhang X, Zhang Y, He Z, Yin K, Li B, Zhang L and Xu Z: Chronic stress promotes gastric cancer progression and metastasis: An essential role for ADRB2. Cell Death Dis. 10:7882019. View Article : Google Scholar : PubMed/NCBI

40 

Starr LR, Dienes K, Li YI and Shaw ZA: Chronic stress exposure, diurnal cortisol slope, and implications for mood and fatigue: Moderation by multilocus HPA-Axis genetic variation. Psychoneuroendocrinology. 100:156–163. 2019. View Article : Google Scholar : PubMed/NCBI

41 

Verbeek E, Colditz I, Blache D and Lee C: Chronic stress influences attentional and judgement bias and the activity of the HPA axis in sheep. PLoS One. 14:e02113632019. View Article : Google Scholar : PubMed/NCBI

42 

Kvetnansky R, Sabban EL and Palkovits M: Catecholaminergic systems in stress: Structural and molecular genetic approaches. Physiol Rev. 89:535–606. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Chetty S, Friedman AR, Taravosh-Lahn K, Kirby ED, Mirescu C, Guo F, Krupik D, Nicholas A, Geraghty A, Krishnamurthy A, et al: Stress and glucocorticoids promote oligodendrogenesis in the adult hippocampus. Mol Psychiatry. 19:1275–1283. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Pistritto G, Trisciuoglio D, Ceci C, Garufi A and D'Orazi G: Apoptosis as anticancer mechanism: Function and dysfunction of its modulators and targeted therapeutic strategies. Aging (Albany NY). 8:603–619. 2016. View Article : Google Scholar : PubMed/NCBI

45 

D'Alterio C, Scala S, Sozzi G, Roz L and Bertolini G: Paradoxical effects of chemotherapy on tumor relapse and metastasis promotion. Semin Cancer Biol. 60:351–361. 2020. View Article : Google Scholar : PubMed/NCBI

46 

Obradović MMS, Hamelin B, Manevski N, Couto JP, Sethi A, Coissieux MM, Münst S, Okamoto R, Kohler H, Schmidt A and Bentires-Alj M: Glucocorticoids promote breast cancer metastasis. Nature. 567:540–544. 2019. View Article : Google Scholar : PubMed/NCBI

47 

Shin KJ, Lee YJ, Yang YR, Park S, Suh PG, Follo MY, Cocco L and Ryu SH: Molecular mechanisms underlying psychological stress and cancer. Curr Pharm Des. 22:2389–2402. 2016. View Article : Google Scholar : PubMed/NCBI

48 

Butler DE, Marlein C, Walker HF, Frame FM, Mann VM, Simms MS, Davies BR, Collins AT and Maitland NJ: Inhibition of the PI3K/AKT/mTOR pathway activates autophagy and compensatory Ras/Raf/MEK/ERK signalling in prostate cancer. Oncotarget. 8:56698–56713. 2017. View Article : Google Scholar : PubMed/NCBI

49 

Zhang H, Zhu Y, Sun X, He X, Wang M, Wang Z, Wang Q, Zhu R and Wang S: Curcumin-loaded layered double hydroxide nanoparticles-induced autophagy for reducing glioma cell migration and invasion. J Biomed Nanotechnol. 12:2051–2062. 2016. View Article : Google Scholar : PubMed/NCBI

50 

Cole SW and Sood AK: Molecular pathways: Beta-adrenergic signaling in cancer. Clin Cancer Res. 18:1201–1206. 2012. View Article : Google Scholar : PubMed/NCBI

51 

Homburger V, Lucas M, Rosenbaum E, Vassent G and Bockaert J: Presence of both beta1-and beta2-adrenergic receptors in a single cell type. Mol Pharmacol. 20:463–469. 1981.PubMed/NCBI

52 

Schwalbe T, Huebner H and Gmeiner P: Development of covalent antagonists for β1-and β2-adrenergic receptors. Bioorg Med Chem. 27:2959–2971. 2019. View Article : Google Scholar : PubMed/NCBI

53 

O'Connor MD: The 3R principle: Advancing clinical application of human pluripotent stem cells. Stem Cell Res Ther. 4:212013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang Z, Wang X, Xue B, Zhao Y, Xie F, Wang S, Xue C, Wang Y, Zhang Y, Qian L, Qian L, et al: Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway. Oncol Rep 46: 202, 2021.
APA
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S. ... Qian, L. (2021). Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway. Oncology Reports, 46, 202. https://doi.org/10.3892/or.2021.8153
MLA
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S., Xue, C., Wang, Y., Zhang, Y., Qian, L."Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway". Oncology Reports 46.3 (2021): 202.
Chicago
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S., Xue, C., Wang, Y., Zhang, Y., Qian, L."Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway". Oncology Reports 46, no. 3 (2021): 202. https://doi.org/10.3892/or.2021.8153
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Z, Wang X, Xue B, Zhao Y, Xie F, Wang S, Xue C, Wang Y, Zhang Y, Qian L, Qian L, et al: Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway. Oncol Rep 46: 202, 2021.
APA
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S. ... Qian, L. (2021). Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway. Oncology Reports, 46, 202. https://doi.org/10.3892/or.2021.8153
MLA
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S., Xue, C., Wang, Y., Zhang, Y., Qian, L."Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway". Oncology Reports 46.3 (2021): 202.
Chicago
Zhang, Z., Wang, X., Xue, B., Zhao, Y., Xie, F., Wang, S., Xue, C., Wang, Y., Zhang, Y., Qian, L."Chronic stress promotes glioma cell proliferation via the PI3K/Akt signaling pathway". Oncology Reports 46, no. 3 (2021): 202. https://doi.org/10.3892/or.2021.8153
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team