Open Access

Thymoquinone is a novel potential inhibitor of SIRT1 in cancers with p53 mutation: Role in the reactivation of tumor suppressor p73

  • Authors:
    • Mahmoud Alhosin
  • View Affiliations

  • Published online on: April 28, 2020     https://doi.org/10.3892/wasj.2020.49
  • ArticleNumber: 8
  • Copyright: © Alhosin et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The deacetylase sirtuin 1 (SIRT1) has been shown to act as a negative regulator of the function of tumor suppressor p73 through a process involving the inhibition of the acetyltransferase p300 with the subsequent inhibition of apoptosis. In cancer cells with p53 mutation, such as the human acute lymphoblastic leukemia cell line (Jurkat) and the human triple-negative breast cancer (MDA-MB-468 cells), the upregulation of p73 in response to anticancer agents, including thymoquinone (TQ), leads to the activation of several pro-apoptotic genes with the subsequent induction of apoptosis. The present study investigated the effects of TQ on SIRT1 expression in order to elucidate the mechanisms of the TQ-induced upregulation of p73 in cancers with p53 mutation. TQ induced a dose and time-dependent decrease in SIRT1 expression in the Jurkat cells associated with the upregulation of p73, the cleavage of caspase-3, and the inhibition of cell proliferation and the induction of apoptosis. The TQ-induced downregulation of SIRT1 mRNA expression in Jurkat cells was associated with an increase in the mRNA expression of p300. In MDA-MB-468 cells, TQ induced an inhibition of cell proliferation and an upregulation of p300 and SIRT1 mRNA expression. Overall, the findings of the present study suggest that p73 is activated and stabilized in Jurkat cells in response to TQ via the deacetylation/acetylation-dependent pathway involving the downregulation of SIRT1 and the upregulation of p300, respectively. These findings further suggest that the inhibition of SIRT1 by TQ may be a promising strategy for the treatment of cancers with p53 mutation.

Introduction

The deacetylase sirtuin 1 (SIRT1), a class III histone deacetylase is overexpressed in several types of cancer, including in tumors with p53 mutation, such as acute lymphoblastic leukemia (ALL) (1,2) and triple-negative breast cancer (TNBC) (3,4). The tumor suppressor gene p53 is mutated in the acute lymphoblastic leukemia cell line, Jurkat (5,6), as well as in the TNBC cell line, MDA-MB-468 cells) (7,8), rendering these cancer cell lines as useful model systems which may be used to study the anticancer effects of novel drugs on tumors with p53 mutation. A high expression level of SIRT1 has been found in primary ALL cells from patients compared to peripheral blood mononuclear cells from healthy subjects (1). Of note, Tenovin-6, a selective inhibitor of SIRT1, has been shown to reduce the growth of primary ALL cells, sensitize ALL cells to etoposide and cytarabine and to activate the tumor suppressor p53(1). In the same context, it has been shown that patients with TNBC express high levels of SIRT1 and that this overexpression is significantly associated with lymph node metastasis (3). The depletion of SIRT1 in TNBC cell lines using siRNA has also been shown to markedly suppress invasiveness, indicating that SIRT1 plays an oncogenic role in the invasiveness of TNBC (3).

SIRT1 can deacetylate histone proteins (9,10), as well as a number of non-histone proteins, including p53(11) and p73(12), which has a high degree of similarity with p53 (13,14). A number of human cancers express low levels of p73. p73 reactivation and stability in response to pharmacological tools enables cancer cells to undergo apoptosis via p53-independent pathways, which renders p73 a potent target for the anticancer therapy of tumors with p53 mutation, including ALL (15-17) and TNBC (e.g., MDA-MB-468 cells) (18,19). SIRT1 has been shown to interact with p73 and to suppress p73-dependent transcriptional activity, enabling cancer cells to escape apoptosis in response to chemotherapy (12). It has been shown that SIRT1 physically interacts with and suppresses the transactivation of the acetyltransferase p300(20), known to acetylate p73 in cancer cells (21,22). Of note, p300 has been shown to acetylate and activate p73 in response to several anticancer drugs, such as doxorubicin and cisplatin (23). Thus, targeting SIRT1 in tumors with p53 mutation, including ALL and TNBC (e.g., MDA-MB-468 cells) may be a promising tool for inducing apoptosis and decreasing tumor resistance to chemotherapy via the reactivation of p73 through an acetylation process involving p300.

Thymoquinone (TQ), the bioactive compound of the volatile oil derived from the seeds of the Nigella sativa plant, has in vitro and in vivo potent pro-apoptotic activities against various cancer cells (24-29). Compared to cancer cells, TQ exerts mild cytotoxic effects on matched normal cells and tissues, such as normal keratinocytes and mouse fibroblasts (25,30,31). TQ has been shown to inhibit the proliferation and induce the apoptosis of the p53-mutant cell line, Jurkat, through p73 upregulation; however, the TQ-induced signaling pathways leading to p73 overexpression in ALL remain largely unknown (24,26). Consequently, the aim of the present study was to evaluate whether TQ can inhibit SIRT1 expression in cancer cells with p53 mutation, such as the human ALL cell line, Jurkat, and the human TNBC cell line, MDA-MB-468 cells, leading to the reactivation and stability of p73 with subsequent apoptosis.

Materials and methods

Cell culture and treatment

Human T lymphocyte cell line (Jurkat cells) and the human TNBC cell line (MDA-MB-468 cells) were obtained from the America Type Culture Collection (ATCC). The Jurkat cells were maintained in RPMI-1640 (Sigma-Aldrich; Merck KGaA) medium and MDA-MB-468 cells in Dulbecco's modified Eagle medium (DMEM; UFC-Biotech) supplemented with 15% (v/v) fetal calf serum (FCS, Lonza BioWhittaker), 2 mM glutamine, penicillin (100 IU/ml) and streptomycin (100 µg/ml) (Sigma-Aldrich; Merck KGaA). Both cell lines were maintained in a humidified incubator containing 5% CO2 at 37˚C. For all treatments, a 10 mM solution of TQ (Sigma-Aldrich; Merck KGaA) was prepared in 10% dimethyl sulfoxide (DMSO; Merck Millipore) and appropriate working concentrations were prepared with cell culture medium. The final concentration of DMSO was always <0.1% in both the control and treatment conditions.

Cell proliferation assay

A colorimetric cell proliferation assay using the WST-1 Cell Proliferation Reagent kit (Sigma-Aldrich; Merck KGaA) was used to examine the effects of TQ on the proliferation of Jurkat cells and MDA-MB-468 cells. Briefly, the cells were seeded in 96-multi-well plates at a density of 4x104 cells/well for the Jurkat cells and 104 cells/well for the MDA-MB-468 cells. Following 24 h of incubation at 37˚C, the cells were exposed to various concentrations of TQ for 24 h. The cell proliferation rate then was evaluated through a rapid WST-1 reagent. Following 24 h of incubation, 10 µl of the WST-1 solution were added followed by incubation for an additional 3 h at 37˚C. Finally, the absorbance was read at 450 nm using a microplate ELISA reader (ELx800™; BioTek Instruments, Inc.) and Gen5 software (BioTek Instruments, Inc.) was used to analyze the results. The reaction based on the cleavage of the tetrazolium salt WST-1 to formazan by cellular mitochondrial dehydrogenases. The quantity of formazan dye in the medium is directly proportional to the number of viable metabolically active cells. The percentage of cell viability was calculated by assuming control (untreated) samples as 100% viable.

Apoptosis assay

To examine apoptosis, the Jurkat cells were seeded in 96-well plates at a density of 4x104 cells/well, grown for 24 h and exposed to various concentrations of TQ for 24 h or to 50 µM for 15 min, 30 min, 1 and 3 h. The cell apoptosis rate was evaluated using the Annexin V Binding Guava Nexin® assay by capillary cytometry (Guava Easycyte Plus HP system, with absolute cell count and 6 parameters) according to the manufacturer's recommendations (Guava Technologies Inc.). Guava Nexin® Assay utilizes Annexin V-PE.

Western blot analysis

The Jurkat cells were treated with various concentrations of TQ for 24 h or to 50 µM for 15 min, 30 min, 1 and 3 h. The cells were then harvested, centrifuged at 201 x g for 10 min at room temperature to discard the RPMI medium, washed with cold phosphate-buffered saline (PBS) and resuspended in RIPA buffer (25 mM Tris, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate and 0.1% SDS; Sigma-Aldrich; Merck KGaA) containing protease inhibitors. Equal amounts (20 µg) of total protein were separated on 10-15% polyacrylamide gels and electrophoretically transferred to a nitrocellulose membrane. After blocking with 5% non-fat dry milk and Tween-20 in PBS, the nitrocellulose membranes were incubated, at 4˚C overnight, with either mouse monoclonal anti-SIRT1 antibody (B-10: cat. no. sc-74504; Santa Cruz Biotechnology, Inc.; diluted at 1:200), mouse monoclonal anti-p73 antibody (cat. no. 558785; BD Biosciences; diluted at 1 µg/ml), rabbit polyclonal anti-cleaved caspase-3 (Asp175) antibody (cat. no. 9661; Cell Signaling Technology, Inc.; diluted at 1:1,000) or mouse monoclonal anti-β-actin antibody (cat. no. ab8227; Abcam; diluted at 1:25,000), according to the manufacturer's instructions. The membranes were then washed 3 times with PBS for 10 min. The membranes were, thereafter, incubated with the appropriate horseradish peroxidase-conjugated secondary antibody [Cell Signaling Technology, Inc.; diluted to 1:10,000 for anti-mouse antibody cat. no. 7076 and 2:10,000 for anti-rabbit antibody cat. no. 7074 at room temperature for 1 h and 30 min. The membranes were then washed with PBS 5 times. Signals were detected by chemiluminescence using the ECL Plus detection system (Amersham; GE Healthcare Life Sciences). For the quantification of SIRT1, p73 and cleaved caspase-3 proteins, images of the western blots were processed using NIH ImageJ software (Java 8).

Reverse transcription-quantitative PCR (RT-qPCR)

Cells were treated with various concentrations of TQ for 24 h. Total RNA was purified and subjected to reverse transcription using Oligo(dt) (Sigma-Aldrich; Merck KGaA) and Superscript II reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.). Quantitative PCR was performed using the LightCycler 480 SYBR-Green I Master kit (Roche Diagnostics) and the Mastercycler Realplex apparatus (Eppendorf). The results were normalized to ribosomal protein L11 (RPL11) mRNA. PCR was performed with 30 cycles of denaturation for 30 sec at 95˚C; annealing for 45 sec at 60˚C; and extension for 60 sec at 72˚C. The sequences of the primers for PCR amplification are listed in Table I. Amplicons were size-controlled on an agarose gel and the purity was assessed by analysis of the melting curves at the end of the RT-PCR reaction. The expression level of the target gene in the treated cells was measured relative to the level observed in the untreated cells and was quantified using the formula: 2-ΔΔCq (32).

Table I

Sequences of the primers used for PCR amplification.

Table I

Sequences of the primers used for PCR amplification.

Target geneSense sequence (5'-3')Antisense sequence (3'-5')
SIRT1 CCGCTTGCTATCATGAAACCA TCACAGTCTCCAAGAAGCTCT
p300 TCCTGGACAGCAGATTGGAG CTTGCGCTTCTCTGGATCAG
RPL11 ATCCTTTGGCATCCGGAGAA GTCCAGGCCGTAGATACCAA

[i] SIRT1, sirtuin 1; RPL11, ribosomal protein L11.

Statistical analysis

All data are presented as the means ± SEM of triplicates performed for the same experiment or an average of at least 3 separate experiments. Statistical analysis was performed using one-way ANOVA followed by Tukey's post hoc test using GraphPad Prism 6 software (GraphPad Software) and significant differences were indicated as with values of P<0.05.

Results

TQ induces a concentration-dependent degradation of SIRT1 associated with p73 upregulation in Jurkat cells

Firstly, the effects of TQ on SIRT1 and p73 protein expression levels in Jurkat cells were evaluated (Fig. 1A). For this purpose, the cells were incubated with increasing concentrations of TQ for 24 h. The results revealed that TQ induced the downregulation of SIRT1 in a concentration-dependent manner in the Jurkat cells (Fig. 1A). Indeed, treatment with TQ at 5 µM induced a slight decrease in the SIRT1 level and a significant decrease was detected at 10 µM. The TQ-induced SIRT1 degradation was associated with the upregulation of p73 and cleaved caspase-3. Indeed, TQ induced a significant increase in the expression levels of p73 and cleaved caspase 3 at the concentration of 10 µM (Fig. 1A). The anti-proliferative and pro-apoptotic effects of TQ on the Jurkat cells were then analyzed under the same experimental conditions. Cell proliferation in response to TQ was decreased in a concentration-dependent manner (Fig. 1B). TQ significantly inhibited cell proliferation from the concentration of 5 µM and the inhibition rate reached approximately 10 and 50% in the Jurkat cells treated with 10 and 30 µM TQ, respectively (Fig. 1B). Under the same conditions, TQ was found to induce apoptosis in a dose-dependent manner, which became significant at the concentration of 10 µM (Fig. 1C-E). Indeed, at the concentration of 10 µM, approximately 2% of Jurkat cells were in the early apoptotic stage (Fig. 1C and D) and 8% were in the late apoptotic stage (Fig. 1C and E). Taken together, these results indicated that TQ induced the downregulation of SIRT1 in Jurkat cells, which could lead to an upregulation of p73 and cleaved caspase-3, with subsequent cell proliferation inhibition and apoptosis induction.

TQ-induced p73 upregulation and apoptosis are associated with the rapid downregulation of SIRT1

In the next step, a kinetic analysis of TQ on SIRT1 expression in Jurkat cells was performed in order to determine the chronology of the molecular events induced by TQ leading to the upregulation of p73 and apoptosis. For this objective, cells were exposed to 50 µM of TQ, the concentration at which SIRT1 protein expression was undetectable after 24 h (data not shown). The time-course effects of TQ on SIRT1 expression in Jurkat cells at 50 µM revealed that SIRT1 expression began to significantly decrease after 15 min and the loss was almost complete after 3 h of treatment (Fig. 2A). A significant decrease in SIRT1 expression observed after 15 min of TQ treatment and was associated with a significant increase in the expression of p73 (Fig. 2A). Notably, TQ induced the apoptosis of Jurkat cells in a time-dependent manner (Fig. 2B-D) following the TQ-induced deregulation of the SIRT1 and p73 expression levels (Fig. 2A). Indeed, TQ caused a significant increase in the number of apoptotic cells in the early stage after 30 min (Fig. 2B and C). The percentage of apoptotic cells in the early stage reached approximately 18% after 3 h (Fig. 2B and C). These findings suggest that the TQ-induced downregulation of SIRT1 expression is a main event in the reactivation and stability of the tumor suppressor, p73, with the subsequent induction of apoptosis.

TQ induces the transcription-dependent downregulation of SIRT1 in Jurkat cells with p53 mutation

To investigate whether TQ affects SIRT1 expression also at the transcriptional level, Jurkat cells were exposed to TQ under the same conditions. As shown in Fig. 3A, the exposure of Jurkat cells to 10 µM of TQ significantly increased SIRT1 mRNA expression. At the concentration of 30 µM, TQ induced a decrease in SIRT1 mRNA expression (Fig. 3A), indicating that the TQ-induced downregulation of SIRT1 expression in Jurkat cells results from its effects at both the transcriptional and protein level. The mRNA expression levels of SIRT1 were also investigated in the human breast cancer cell line, MDA-MB-468 (Fig. 3B). TQ had no effect on SIRT1 mRNA expression at the concentrations of 5 and 10 µM, whereas its expression significantly increased following treatment of the cells with 30 µM TQ (Fig. 3B). The effects of TQ on the proliferation of MDA-MB-468 cells were also investigated. TQ significantly inhibited cell proliferation from the concentration of 5 µM and the inhibition rate reached approximately 45 and 60% in the MDA-MB-468 cells treated with 10 and 30 µM TQ, respectively (Fig. 3C). Taken together, these findings indicate that the TQ-induced downregulation of SIRT1 expression in Jurkat cells results from its effects on both the transcriptional and protein levels, and that TQ inhibits the proliferation of MDA-MB-468 cells via a mechanism independent of SIRT1 mRNA expression.

TQ induces the transcriptional upregulation of the histone acetyltransferase p300 in cancer cells with p53 mutation

SIRT1 has been shown to physically interact with and suppress the transactivation of the acetyltransferase, p300(20). Of note, p300 has been shown to acetylate and activate p73 in response to treatment with several anticancer drugs, such as doxorubicin and cisplatin (23). In the present study, in order to investigate the mechanisms underlying p73 upregulation following the decrease in the expression of the deacetylase SIRT1 in response to TQ treatment, the effects of TQ on the expression of p300 were evaluated in Jurkat and MDA-MB-468 cells. As shown in Fig. 3D, treatment of the Jurkat cells with 10 µM TQ significantly increased the transcriptional levels of p300, as detected by RT-qPCR (Fig. 3D). Indeed, at the concentration of 10 µM, an approximately 2-fold increase in p300 expression was observed (Fig. 3D), in parallel with a significant decrease in SIRT1 protein expression and a significant increase in p73 protein expression, as shown in Fig. 1A. At 30 µM, only a slight increase in the level of p300 was found compared to the control (Fig. 3D). In the MDA-MB-468 cells, TQ had no significant effect on p300 mRNA expression at the concentrations of 5 and 10 µM, while p300 expression levels began to increase at the concentration of 30 µM TQ (Fig. 3E). These results indicate that p73 is activated and stabilized in response to TQ in cancer cells with p53 mutation through the deacetylation/acetylation-dependent pathway involving the downregulation of SIRT1 protein and the upregulation of p300, respectively.

Discussion

The deacetylase SIRT1 has been shown to act as a negative regulator of the function of the tumor suppressors, p53(33) and p73(12), leading to the inhibition of apoptosis. SIRT1 has been found to directly bind to p73, reducing its transcriptional activity via a deacetylation process with the subsequent inhibition of apoptosis (12). p53 and p73 proteins have a high degree of similarity in both structure and function (13,14). Of note, in tumors with p53 mutation, including ALL (1,2,24) and TNBC (3,4), the upregulation of p73 in response to anticancer agents leads to the activation of several pro-apoptotic genes with the subsequent induction of apoptosis. Thus, it is of interest to identify novel natural compounds that can target SIRT1/p73 interaction, highlighting new strategies for cancer therapy. The present study demonstrated that treatment of Jurkat cells with TQ induced a decrease in SIRT1 protein expression in a concentration- and time-dependent manner, and that this effect was associated with an increase in p73 protein expression. The TQ-induced downregulation of SIRT1 expression was associated with an increase in cleaved caspase-3 expression and apoptosis. TQ also induced an increase in the expression of the acetyltransferase, p300, in Jurkat cells and the human breast cancer cell line, MDA-MB-468.

SIRT1 can act as either an oncogene or a tumor suppressor, depending on its cellular targets or specific cancers (34-36). Considering the fact that SIRT1 is overexpressed in several tumors with p53 mutation, including ALL (1) and TNBC (3,4,37), SIRT1 inhibition holds promise as a novel approach for cancer therapy in these tumors. The present study demonstrated that SIRT1 protein expression was downregulated in Jurkat cells treated with TQ in parallel with an increase in p73 protein expression, indicating that the low expression levels of p73 found in Jurkat cells may be a result of its degradation through the SIRT1-mediated deacetylation process; this suggests that TQ may be a novel potential inhibitor of SIRT1 in cancers with p53 mutation. This conclusion is supported by ample evidence. A recent study indicated that the pre-treatment of cancer cells with nicotinamide, an inhibitor of SIRT1, was able to increase the expression of p73 and that of pro-apoptotic, Bax (38). In the same context, it has been shown that the anti-leukemic drug, arsenic trioxide, induced an upregulation of p73 expression, leading to the apoptosis of acute promyelocytic leukemia cells via the inhibition of several oncogenes, including SIRT1(39). The results of the present study are also in line with previous results, highlighting SIRT1 as an inhibitor of p73 activity through the deacetylation-mediated process (12). Indeed, the knockdown of SIRT1 in HeLa cells using SIRT1 antisense was previously shown to result in the upregulation of p73 protein and the induction of apoptosis, while the overexpression of SIRT1 counteracted p73-induced apoptosis, indicating that SIRT1 negatively regulated the expression of p73 and apoptosis (12). This indicates that the knockdown of SIRT1 mimics the effects of TQ on the expression of p73 and apoptosis observed in the present study. The present study also demonstrated that TQ increased the expression of the acetyltransferase, p300, in Jurkat cells and MDA-MB-468 cells, suggesting that the upregulation of p73 in response to TQ involves its acetylation by p300. Of note, the significant increase in the levels of p300 mRNA in Jurkat cells detected following treatment with 10 µM TQ was inversely associated with SIRT1 protein expression and positively with p73 protein expression under the same conditions, indicating that p73 is activated and stabilized in response to TQ in Jurkat cells through the deacetylation/acetylation-dependent pathway involving the downregulation of SIRT1 and the upregulation of p300, respectively. This hypothesis is supported by the findings of several previous studies. Indeed, SIRT1 has been shown to physically interact with and suppress p300 transactivation (20). Moreover, it has been shown that the anticancer drug, doxorubicin, increases the expression of p300, leading to the acetylation of p73 in the human colon cancer cell line, HCT116(23). This indicates that the activation and stability of the tumor suppressor, p73, through the deacetylation/acetylation-dependent pathway, is the main target in tumors with p53 mutation for natural compounds exhibiting anticancer activities, including TQ.

In conclusion, the present study demonstrates that TQ induces the downregulation of the deacetylase SIRT1, with a coordinated upregulation of the tumor suppressor, p73, most likely through the acetylation-mediated process. p300 may be the most likely acetyltransferase associated with the TQ-induced p73 upregulation with the subsequent induction of apoptosis. However, TQ-induced SIRT1/p300/p73 deregulation warrants further investigation in order to decipher the chronology of the molecular events involved, namely SIRT1 downregulation, which triggers the upregulation of p300, leading to the stability and the reactivation of p73 followed by apoptosis. The findings of the present study provide new insight into the regulation of SIRT1/P73 expression upon treatment with natural anticancer drugs, as it suggests that the inhibition of SIRT1 by TQ may be a promising tool for cancer therapy in cancers with p53 mutation.

Acknowledgements

The author would like to acknowledge Mr. Mohammed A. Hassan for providing technical assistance.

Funding

No funding was received.

Availability of data and materials

All data generated or analyzed during this study are included in this published article or are available from the corresponding author on reasonable request.

Author contributions

MA designed the study, performed the research and analyzed the data, and wrote the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The author declares that there are no competing interests.

References

1 

Jin Y, Cao Q, Chen C, Du X, Jin B and Pan J: Tenovin-6-mediated inhibition of SIRT1/2 induces apoptosis in acute lymphoblastic leukemia (ALL) cells and eliminates ALL stem/progenitor cells. BMC Cancer. 15(226)2015.PubMed/NCBI View Article : Google Scholar

2 

Yu W, Li L, Wang G, Zhang W, Xu J and Liang A: KU70 inhibition impairs both non-homologous end joining and homologous recombination DNA damage repair through SHP-1 induced dephosphorylation of SIRT1 in T-cell acute lymphoblastic leukemia (T-ALL) [corrected]. Cell Physiol Biochem. 49:2111–2123. 2018.PubMed/NCBI View Article : Google Scholar

3 

Chung SY, Jung YY, Park IA, Kim H, Chung YR, Kim JY, Park SY, Im SA, Lee KH, Moon HG, et al: Oncogenic role of SIRT1 associated with tumor invasion, lymph node metastasis, and poor disease-free survival in triple negative breast cancer. Clin Exp Metastasis. 33:179–185. 2016.PubMed/NCBI View Article : Google Scholar

4 

Sinha S, Patel S, Athar M, Vora J, Chhabria MT, Jha PC and Shrivastava N: Structure-based identification of novel sirtuin inhibitors against triple negative breast cancer: An in silico and in vitro study. Int J Biol Macromol. 140:454–468. 2019.PubMed/NCBI View Article : Google Scholar

5 

Cheng J and Haas M: Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines. Mol Cell Biol. 10:5502–5509. 1990.PubMed/NCBI View Article : Google Scholar

6 

Shan X, Czar MJ, Bunnell SC, Liu P, Liu Y, Schwartzberg PL and Wange RL: Deficiency of PTEN in Jurkat T cells causes constitutive localization of Itk to the plasma membrane and hyperresponsiveness to CD3 stimulation. Mol Cell Biol. 20:6945–6957. 2000.PubMed/NCBI View Article : Google Scholar

7 

Shtraizent N, Matsui H, Polotskaia A and Bargonetti J: Hot spot mutation in TP53 (R248Q) causes oncogenic gain-of-function phenotypes in a breast cancer cell line derived from an african american patient. Int J Environ Res Public Health. 13(ijerph13010022)2015.PubMed/NCBI View Article : Google Scholar

8 

Hollestelle A, Nagel JH, Smid M, Lam S, Elstrodt F, Wasielewski M, Ng SS, French PJ, Peeters JK, Rozendaal MJ, et al: Distinct gene mutation profiles among luminal-type and basal-type breast cancer cell lines. Breast Cancer Res Treat. 121:53–64. 2010.PubMed/NCBI View Article : Google Scholar

9 

Imai S, Armstrong CM, Kaeberlein M and Guarente L: Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature. 403:795–800. 2000.PubMed/NCBI View Article : Google Scholar

10 

Vaquero A, Scher M, Lee D, Erdjument-Bromage H, Tempst P and Reinberg D: Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol Cell. 16:93–105. 2004.PubMed/NCBI View Article : Google Scholar

11 

Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L and Weinberg RA: hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell. 107:149–159. 2001.PubMed/NCBI View Article : Google Scholar

12 

Dai JM, Wang ZY, Sun DC, Lin RX and Wang SQ: SIRT1 interacts with p73 and suppresses p73-dependent transcriptional activity. J Cell Physiol. 210:161–166. 2007.PubMed/NCBI View Article : Google Scholar

13 

Dotsch V, Bernassola F, Coutandin D, Candi E and Melino G: p63 and p73, the ancestors of p53. Cold Spring Harb Perspect Biol. 2(a004887)2010.PubMed/NCBI View Article : Google Scholar

14 

Marin MC, Jost CA, Irwin MS, DeCaprio JA, Caput D and Kaelin WG Jr: Viral oncoproteins discriminate between p53 and the p53 homolog p73. Mol Cell Biol. 18:6316–6324. 1998.PubMed/NCBI View Article : Google Scholar

15 

Ahmadianpour MR, Abdolmaleki P, Mowla SJ and Hosseinkhani S: Gamma radiation alters cell cycle and induces apoptosis in p53 mutant E6.1 Jurkat cells. Appl Radiat Isot. 71:29–33. 2013.PubMed/NCBI View Article : Google Scholar

16 

Ahmadianpour MR, Abdolmaleki P, Mowla SJ and Hosseinkhani S: Static magnetic field of 6 mT induces apoptosis and alters cell cycle in p53 mutant Jurkat cells. Electromagn Biol Med. 32:9–19. 2013.PubMed/NCBI View Article : Google Scholar

17 

Laumann R, Jucker M and Tesch H: Point mutations in the conserved regions of the p53 tumour suppressor gene do not account for the transforming process in the Jurkat acute lymphoblastic leukemia T-cells. Leukemia. 6:227–228. 1992.PubMed/NCBI

18 

Lim LY, Vidnovic N, Ellisen LW and Leong CO: Mutant p53 mediates survival of breast cancer cells. Br J Cancer. 101:1606–1612. 2009.PubMed/NCBI View Article : Google Scholar

19 

Qiu WG, Polotskaia A, Xiao G, Di L, Zhao Y, Hu W, Philip J, Hendrickson RC and Bargonetti J: Identification, validation, and targeting of the mutant p53-PARP-MCM chromatin axis in triple negative breast cancer. NPJ Breast Cancer. 3:2017.PubMed/NCBI View Article : Google Scholar

20 

Bouras T, Fu M, Sauve AA, Wang F, Quong AA, Perkins ND, Hay RT, Gu W and Pestell RG: SIRT1 deacetylation and repression of p300 involves lysine residues 1020/1024 within the cell cycle regulatory domain 1. J Biol Chem. 280:10264–10276. 2005.PubMed/NCBI View Article : Google Scholar

21 

Zeng X, Chen L, Jost CA, Maya R, Keller D, Wang X, Kaelin WG Jr, Oren M, Chen J and Lu H: MDM2 suppresses p73 function without promoting p73 degradation. Mol Cell Biol. 19:3257–3266. 1999.PubMed/NCBI View Article : Google Scholar

22 

Zeng X, Li X, Miller A, Yuan Z, Yuan W, Kwok RP, Goodman R and Lu H: The N-terminal domain of p73 interacts with the CH1 domain of p300/CREB binding protein and mediates transcriptional activation and apoptosis. Mol Cell Biol. 20:1299–1310. 2000.PubMed/NCBI View Article : Google Scholar

23 

Costanzo A, Merlo P, Pediconi N, Fulco M, Sartorelli V, Cole PA, Fontemaggi G, Fanciulli M, Schiltz L, Blandino G, et al: DNA damage-dependent acetylation of p73 dictates the selective activation of apoptotic target genes. Mol Cell. 9:175–186. 2002.PubMed/NCBI View Article : Google Scholar

24 

Alhosin M, Abusnina A, Achour M, Sharif T, Muller C, Peluso J, Chataigneau T, Lugnier C, Schini-Kerth VB, Bronner C and Fuhrmann G: Induction of apoptosis by thymoquinone in lymphoblastic leukemia Jurkat cells is mediated by a p73-dependent pathway which targets the epigenetic integrator UHRF1. Biochem Pharmacol. 79:1251–1260. 2010.PubMed/NCBI View Article : Google Scholar

25 

Alhosin M, Ibrahim A, Boukhari A, Sharif T, Gies JP, Auger C and Schini-Kerth VB: Anti-neoplastic agent thymoquinone induces degradation of α and β tubulin proteins in human cancer cells without affecting their level in normal human fibroblasts. Invest New Drugs. 30:1813–1819. 2012.PubMed/NCBI View Article : Google Scholar

26 

Ibrahim A, Alhosin M, Papin C, Ouararhni K, Omran Z, Zamzami MA, Al-Malki AL, Choudhry H, Mély Y, Hamiche A, et al: Thymoquinone challenges UHRF1 to commit auto-ubiquitination: A key event for apoptosis induction in cancer cells. Oncotarget. 9:28599–28611. 2018.PubMed/NCBI View Article : Google Scholar

27 

Qadi SA, Hassan MA, Sheikh RA, Baothman OA, Zamzami MA, Choudhry H, Al-Malki AL, Albukhari A and Alhosin M: Thymoquinone-induced reactivation of tumor suppressor genes in cancer cells involves epigenetic mechanisms. Epigenet Insights. 12(2516865719839011)2019.PubMed/NCBI View Article : Google Scholar

28 

Helmy SA, El-Mesery M, El-Karef A, Eissa LA and El Gayar AM: Thymoquinone upregulates TRAIL/TRAILR2 expression and attenuates hepatocellular carcinoma in vivo model. Life Sci. 233(116673)2019.PubMed/NCBI View Article : Google Scholar

29 

Zhu WQ, Wang J, Guo XF, Liu Z and Dong WG: Thymoquinone inhibits proliferation in gastric cancer via the STAT3 pathway in vivo and in vitro. World J Gastroenterol. 22:4149–4159. 2016.PubMed/NCBI View Article : Google Scholar

30 

Gali-Muhtasib HU, Abou Kheir WG, Kheir LA, Darwiche N and Crooks PA: Molecular pathway for thymoquinone-induced cell-cycle arrest and apoptosis in neoplastic keratinocytes. Anticancer Drugs. 15:389–399. 2004.PubMed/NCBI View Article : Google Scholar

31 

Ivankovic S, Stojkovic R, Jukic M, Milos M, Milos M and Jurin M: The antitumor activity of thymoquinone and thymohydroquinone in vitro and in vivo. Exp Oncol. 28:220–224. 2006.PubMed/NCBI

32 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

33 

Langley E, Pearson M, Faretta M, Bauer UM, Frye RA, Minucci S, Pelicci PG and Kouzarides T: Human SIR2 deacetylates p53 and antagonizes PML/p53-induced cellular senescence. EMBO J. 21:2383–2396. 2002.PubMed/NCBI View Article : Google Scholar

34 

Lin Z and Fang D: The roles of SIRT1 in cancer. Genes Cancer. 4:97–104. 2013.PubMed/NCBI View Article : Google Scholar

35 

Ban J, Aryee DN, Fourtouna A, van der Ent W, Kauer M, Niedan S, Machado I, Rodriguez-Galindo C, Tirado OM, Schwentner R, et al: Suppression of deacetylase SIRT1 mediates tumor-suppressive NOTCH response and offers a novel treatment option in metastatic Ewing sarcoma. Cancer Res. 74:6578–6588. 2014.PubMed/NCBI View Article : Google Scholar

36 

Ming M, Soltani K, Shea CR, Li X and He YY: Dual role of SIRT1 in UVB-induced skin tumorigenesis. Oncogene. 34:357–363. 2015.PubMed/NCBI View Article : Google Scholar

37 

Liarte S, Alonso-Romero JL and Nicolas FJ: SIRT1 and estrogen signaling cooperation for breast cancer onset and progression. Front Endocrinol (Lausanne). 9(552)2018.PubMed/NCBI View Article : Google Scholar

38 

Sharif T, Ahn DG, Liu RZ, Pringle E, Martell E, Dai C, Nunokawa A, Kwak M, Clements D, Murphy JP, et al: The NAD(+) salvage pathway modulates cancer cell viability via p73. Cell Death Differ. 23:669–680. 2016.PubMed/NCBI View Article : Google Scholar

39 

Momeny M, Zakidizaji M, Ghasemi R, Dehpour AR, Rahimi-Balaei M, Abdolazimi Y, Ghavamzadeh A, Alimoghaddam K and Ghaffari SH: Arsenic trioxide induces apoptosis in NB-4, an acute promyelocytic leukemia cell line, through up-regulation of p73 via suppression of nuclear factor kappa B-mediated inhibition of p73 transcription and prevention of NF-kappaB-mediated induction of XIAP, cIAP2, BCL-XL and survivin. Med Oncol. 27:833–842. 2010.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

July-August 2020
Volume 2 Issue 4

Print ISSN: 2632-2900
Online ISSN:2632-2919

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Alhosin M: Thymoquinone is a novel potential inhibitor of SIRT1 in cancers with p53 mutation: Role in the reactivation of tumor suppressor p73. World Acad Sci J 2: 8, 2020
APA
Alhosin, M. (2020). Thymoquinone is a novel potential inhibitor of SIRT1 in cancers with p53 mutation: Role in the reactivation of tumor suppressor p73. World Academy of Sciences Journal, 2, 8. https://doi.org/10.3892/wasj.2020.49
MLA
Alhosin, M."Thymoquinone is a novel potential inhibitor of SIRT1 in cancers with p53 mutation: Role in the reactivation of tumor suppressor p73". World Academy of Sciences Journal 2.4 (2020): 8.
Chicago
Alhosin, M."Thymoquinone is a novel potential inhibitor of SIRT1 in cancers with p53 mutation: Role in the reactivation of tumor suppressor p73". World Academy of Sciences Journal 2, no. 4 (2020): 8. https://doi.org/10.3892/wasj.2020.49